Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Jan 1.
Published in final edited form as: J Biochem Mol Toxicol. 2016 Sep 8;31(1):1–7. doi: 10.1002/jbt.21834

Dose-Dependent Effects of Alpha-Naphthylisothiocyanate Disconnect Biliary Fibrosis from Hepatocellular Necrosis

Nikita Joshi 1,3, Jessica L Ray 2, Anna K Kopec 2,3, James P Luyendyk 1,2,3
PMCID: PMC5509966  NIHMSID: NIHMS874654  PMID: 27605088

Abstract

Exposure of rodents to the xenobiotic α-naphthylisothiocyanate (ANIT) is an established model of experimental intrahepatic bile duct injury. Administration of ANIT to mice causes neutrophil-mediated hepatocellular necrosis. Prolonged exposure of mice to ANIT also produces bile duct hyperplasia and liver fibrosis. However, the mechanistic connection between ANIT-induced hepatocellular necrosis and bile duct hyperplasia and fibrosis is not well-characterized. We examined impact of two different doses of ANIT, by feeding chow containing ANIT (0.05%, 0.1%), on the severity of various liver pathologies in a model of chronic ANIT exposure. ANIT-elicited increases in liver inflammation and hepatocellular necrosis increased with dose. Remarkably, there was no connection between increased hepatocellular necrosis and bile duct hyperplasia and peribiliary fibrosis, as these pathologies increased similarly in mice exposed to either dose of ANIT. The results indicate that the severity of hepatocellular necrosis does not dictate the extent of bile duct hyperplasia/fibrosis in ANIT-exposed mice.

Keywords: liver, fibrosis, hepatocellular necrosis, bile duct, biliary hyperplasia, ANIT, alpha-naphthylisothiocyanate

INTRODUCTION

α-naphthylisothiocyanate (ANIT) is a xenobiotic utilized as an experimental tool to identify mechanisms of liver injury caused by bile duct damage (1–4). ANIT undergoes glutathione conjugation within hepatocytes and is transported into the bile by the transporter, MRP2 (5). The ANIT-glutathione conjugate is unstable in bile, which produces a scenario where ANIT undergoes repetitive rounds of absorption and metabolism via enterohepatic recirculation (4,6,7). This produces cytotoxic concentrations of ANIT in the bile, causing initial selective damage to bile duct epithelial cells (BDECs) (5,7,8).

Administration of a single, large dose of ANIT to rodents produces acute cholestatic liver injury characterized by focal hepatocellular necrosis (3,9–11). Preventing ANIT transport into bile reduces ANIT-induced hepatocellular necrosis, implying ANIT biliary injury is a prerequisite for hepatocellular necrosis (5). Focal hepatocellular necrosis in rodents given an acutely toxic dose of ANIT resembles early liver pathology in mice subjected to bile duct ligation (BDL), an experimental setting of acute, obstructive cholestatic liver injury (2,3,9,10). In both acute ANIT- and BDL-induced liver injury, hepatic neutrophil accumulation is observed and exaggerated neutrophil activation is critical for hepatocellular necrosis (3,12,13). Collectively, these studies support the hypothesis that acute hepatocellular necrosis in acute cholestasis is mediated by inflammatory cells, activated in part by the release of proinflammatory bile acids into the liver parenchyma (14).

Persistent exposure of rodents to ANIT through the diet represents an experimental setting of bile duct hyperplasia and peribiliary fibrosis (15–17). Mechanisms of peribiliary fibrosis in chronic ANIT exposure resemble other models of chronic cholestatic liver injury (long-term BDL; Mdr2−/− mice) (16,18–24). Expression of the heterodimeric alphaVbeta6 (αvβ6) integrin by BDECs leads to local activation of latent-transforming growth factor β (TGFβ) and activation of neighboring fibroblasts (16,25–28). Exaggerated peribiliary fibrosis resembles the onion skin-like fibrosis observed in patients with primary sclerosing cholangitis (29). Interestingly, in mice exposed chronically to ANIT, serum markers of hepatocellular injury are minimally elevated, and focal hepatocellular necrosis is minimal (16,20,30). Although both peribiliary fibrosis and hepatocellular necrosis are observed in mice chronically exposed to ANIT (15,18,20,31), it is currently unknown whether these two pathologies are intrinsically connected. To begin to address this question, we examined whether the ANIT dose-response relationship could reveal disconnects between hepatocellular necrosis, inflammation, bile duct hyperplasia and peribiliary fibrosis in an experimental setting of chronic ANIT exposure.

MATERIALS AND METHODS

Mice

Age-matched 9-week-old male mice on a C57BL/6J background (Jackson Laboratory, Bar Harbor, ME) were used for these studies. Mice were housed at an ambient temperature of approximately 22°C with alternating 12 hour light/dark cycles and provided water and rodent chow ad libitum prior to study initiation. Mice were maintained in an Association for Assessment and Accreditation of Laboratory Animal Care International-accredited facility at Michigan State University. All animal procedures were approved by Michigan State University Institutional Animal Care and Use Committee.

ANIT diet model

Custom diets were prepared by Dyets, Inc. (Bethlehem, PA). The ANIT diet was a standard rodent chow diet containing either 0.05% or 0.1% ANIT (Sigma-Aldrich, St. Louis, MO). Based on average chow consumption, the daily dose of ANIT is approximately 60 mg/kg and 120 mg/kg, respectively. Groups of mice were fed ANIT diet for a total of 4 weeks, ad libitum. Mice were anesthetized with isoflurane, and blood was collected from the caudal vena cava into an empty syringe, allowed to clot, and spun at 10,000 × g for 2 minutes for collection of serum. The liver was excised and briefly immersed in phosphate-buffered saline. A small section (~20 mg) of the right medial lobe was collected for RNA isolation and snap frozen in liquid nitrogen. The left lateral lobe was fixed in 10% neutral buffered formalin for 96 hours prior to routine processing. The remaining liver was cut into approximately 100 mg sections and flash-frozen in liquid nitrogen.

Histopathology, clinical chemistry and immunohistochemistry

For analysis of liver histopathology by light microscopy, formalin-fixed paraffin-embedded liver sections were cut at 5 μm and stained with hematoxylin and eosin (H&E), sirius red, or immunohistochemically for cytokeratin-19 (CK-19) antigen by the Michigan State University Investigative Histopathology Laboratory as described previously (18,31). Hepatocellular necrosis was quantified in a masked fashion by examining 5 representative 40X H&E-stained liver sections from each animal and expressed as percent of total tissue area. For quantification of sirius red (collagen deposits) and CK-19 staining (BDECs), images of stained liver sections were captured using a Virtual Slide System VS110 (Olympus, Hicksville, NY) with a 20X objective. The area of positive sirius red and CK-19 staining in at least 200 images per tissue was determined in an automated and unbiased fashion using a batch macro and the color de-convolution tool in ImageJ. Serum activity of alanine aminotransferase (ALT) was determined using commercial reagents (Infinity ALT/GPT Thermo Fisher, Waltham, MA).

RNA isolation, cDNA synthesis, and quantitative real-time PCR

Total RNA was isolated from approximately 20 mg of snap-frozen liver using TRI Reagent according to the manufacturer’s protocol (Molecular Research Center, Cincinnati, OH). 1 μg of total RNA was utilized for the synthesis of cDNA, accomplished using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA) and a C1000 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA). SYBR Green quantitative real-time PCR (qPCR) amplification was performed using a CFX Connect thermal cycler (Bio-Rad) with primers purchased from IDT (Coralville, IA). Primers were purchased from IDT (Coralville, IA). The expression of each gene was normalized to the housekeeper gene GAPDH and the relative levels of each gene were evaluated using the ΔΔCt method. Primer sequences are listed in Table 1.

Table 1.

Gene names and primer sequences (5′-> 3′) for transcripts verified by qPCR.

Gene Name Gene ID Gene Symbol Species Forward primer Reverse primer
Glyceraldehyde-3-phosphate dehydrogenase 14433 Gapdh mouse GTGGACCTCATGGCCTACAT TGTGAGGGAGATGCTCAGTG
Collagen, type I, alpha 1 12842 Col1a1 mouse GAGCGGAGAGTACTGGATCG GCTTCTTTTCCTTGGGGTTC
Integrin beta 6 16420 Itgb6 mouse CTCACGGGTACAGTAACGCA AAATGAGCTCTCAGGCAGGC
Interleukin 1 beta 16176 Il1b mouse AGCTTCCTTGTGCAAGTGTCT GACAGCCCAGGTCAAAGGTT
Interleukin 6 16193 Il6 mouse TCCTCTCTGCAAGAGACTTCC TTGTGAAGTAGGGAAGGCCG
Chemokine (C-C motif) ligand 2 20296 Ccl2 mouse GTCCCTGTCATGCTTCTGG GCTCTCCAGCCTACTCATTG
Chemokine (C-X-C motif) ligand 1 14825 Cxcl1 mouse GCTGGGATTCACCTCAAGAA TGGGGACACCTTTTAGCATC
Chemokine (C-X-C motif) ligand 2 20310 Cxcl2 mouse AAGTTTGCCTTGACCCTGAA AGGCACATCAGGTACGATCC
Open in a new tab

Statistics

Comparison of 3 or more groups was performed using one-way analysis of variance and Student-Newman-Keuls post-hoc test. Data were considered significant when the p-value was less than 0.05.

RESULTS

Dose-dependent increase in hepatocellular necrosis and inflammatory gene induction in ANIT-exposed mice

Liver histology was unremarkable in mice fed control chow (Figure 1A). In agreement with previous studies, ANIT-exposed mice developed marked bile duct hyperplasia (Figure 1A, asterisks). Exposure of mice to 0.05% ANIT diet for 4 weeks was associated with very mild hepatocellular injury, indicated by increased serum ALT activity (~1.5 fold increase) and very minimal hepatocellular necrosis (Figure 1B–C). Mice fed 0.1% ANIT diet developed significantly more hepatocellular injury, as indicated by a more marked increase in serum ALT activity (~5 fold increase) and area of hepatocellular necrosis (Figure 1A–C, arrows). Compared to mice fed a control diet, hepatic expression of pro-inflammatory genes CCL2, IL6 and CXCL2 increased in mice exposed to 0.05% ANIT. Notably, hepatic expression of each of these mRNAs increased further in mice exposed to 0.1% ANIT (Figure 2A–C). In addition, induction of IL1β and CXCL1 mRNAs increased only in mice exposed to 0.1% ANIT (Figure 2D–E). Consistent with this observation, evaluation of H&E-stained liver sections suggested increased neutrophil accumulation in livers of mice exposed to 0.1% ANIT compared to 0.05% ANIT (Figure 1A). Collectively, the results indicate that hepatocellular necrosis and inflammation are dose-dependent in mice exposed to ANIT chronically via the diet.

Figure 1. Dose-dependent increase in liver injury in ANIT-exposed mice.

Figure 1

Open in a new tab

Male, wild-type C57Bl/6J mice were fed standard control rodent chow or identical chow containing 0.05% or 0.1% ANIT for 4 weeks. (A) Representative photomicrographs show liver sections stained with hematoxylin and eosin. Asterisks indicate biliary hyperplasia. Arrows indicate hepatocellular necrosis. (B) Serum ALT activity and (C) area of hepatocellular necrosis were determined as described in Materials and Methods. Data are expressed as mean + SEM; n=5−10 mice per group. *p<0.05 vs. control diet. #p<0.05 vs. 0.05% ANIT-exposed mice.

Figure 2. Dose-dependent increase in inflammatory gene induction in ANIT-exposed mice.

Figure 2

Open in a new tab

Male, wild-type C57Bl/6J mice were fed standard control rodent chow or identical chow containing 0.05% or 0.1% ANIT for 4 weeks. Hepatic expression of mRNAs encoding the proinflammatory genes (A) CCL2 (B) IL6 (C) CXCL2 (D) IL1β and (E) CXCL1 was determined by real-time qPCR. Data are expressed as mean + SEM; n=5–10 mice per group. *p<0.05 vs. control diet. #p<0.05 vs. 0.05% ANIT-exposed mice.

ANIT-induced biliary hyperplasia is disconnected from hepatocellular necrosis

To quantify ANIT-induced bile duct hyperplasia, we stained liver sections for cytokeratin-19 (CK-19), a marker of bile ducts in mouse liver. Bile duct area increased significantly in mice exposed to 0.05% ANIT, compared to control diet, indicating development of classic biliary hyperplasia (Figure 3A–B). Surprisingly, ANIT-induced bile duct hyperplasia was similar in mice exposed to 0.1% ANIT diet (Fig. 3A–B). Expression of ITGβ6 mRNA, which encodes the β subunit of the αvβ6 integrin, is largely restricted to BDECs in settings of cholestatic liver injury (16,25,26,28). Consistent with this, expression of hepatic ITGβ6 mRNA, one component of the BDEC-selective profibrogenic αvβ6 integrin, increased similarly in mice exposed to 0.05% and 0.1% ANIT diet (Figure 3C). The results indicate that increased hepatocellular necrosis is not paralleled by increased bile duct hyperplasia in ANIT-exposed mice.

Figure 3. Effect of ANIT exposure on bile duct hyperplasia.

Figure 3

Open in a new tab

Male, wild-type C57Bl/6J mice were fed standard control rodent chow or identical chow containing 0.05% or 0.1% ANIT for 4 weeks. (A) Representative photomicrographs show liver sections stained for cytokeratin-19 (CK-19, brown). (B) CK-19 staining was quantified as described in Materials and Methods. (C) Hepatic expression of ITGβ6 mRNA was determined by real-time qPCR. Data are expressed as mean + SEM; n=5–10 mice per group. *p<0.05 vs. control diet.

ANIT-induced peribiliary fibrosis is connected to bile duct hyperplasia, not hepatocellular necrosis

Exposure to 0.05% ANIT in chow for 4 weeks increased peribiliary collagen protein deposition and COL1A1 mRNA levels in liver compared to control-diet fed mice (Figure 4A–C). Interestingly, COL1A1 mRNA induction and increased collagen protein deposition were similar in mice exposed to 0.1% ANIT (Figure 4A–C), suggesting that increased hepatocellular necrosis in mice exposed to 0.1% ANIT (Figure 1) was not a mechanistic determinant of fibrosis severity. Indeed, in mice exposed to 0.1% ANIT, collagen deposits were not observed within areas of hepatocellular necrosis (Figure 4C).

Figure 4. Effect of ANIT exposure on biliary fibrosis in mice.

Figure 4

Open in a new tab

Male, wild-type C57Bl/6J mice were fed standard control rodent chow or identical chow containing 0.05% or 0.1% ANIT for 4 weeks. (A) Quantification of sirius red staining was performed as described in Material and Methods. (B) Hepatic expression of profibrogenic COL1A1 mRNA was determined by real-time qPCR. (C) Representative photomicrographs show liver sections stained for collagen deposits with sirius red. The dashed outline demarcates an area of hepatocellular necrosis. Data are expressed as mean + SEM; n = 5–10 mice per group. *p<0.05 vs. control diet-exposed mice.

DISCUSSION

Experimental ANIT exposure has been utilized to discover mechanisms of liver disease stemming from biliary injury (1,2). Here we found that hepatocellular necrosis and hepatic inflammatory gene induction increased in a dose-dependent manner in ANIT-exposed mice. However, whereas bile duct hyperplasia and fibrosis were increased by ANIT, a connection to ANIT dose was not observed. The results suggest that hepatocellular necrosis is not required for ANIT-induced bile duct hyperplasia. Moreover, the observation that hepatocellular necrosis and biliary fibrosis do not uniformly increase with dose suggests a distinct mechanistic basis for each lesion.

Upregulation of the heterodimeric αvβ6 integrin is evident on BDECs in multiple models of cholestatic liver injury/fibrosis, including in mice exposed chronically to ANIT (16,25–27). The αvβ6 integrin converts latent TGFβ1 into its active form, and multiple studies have shown this pathway contributes to biliary fibrosis (16,18,25,26). Notably, inhibition of αvβ6 reduces liver fibrosis in a modified BDL where hepatocellular injury is not a primary feature (26). Moreover, inhibition of αvβ6 had no effect on serum ALT activity in ANIT-exposed mice (16). These studies identify αvβ6 integrin-mediated TGFβ1 activation as a profibrogenic pathway distinct from the mechanisms controlling hepatocellular necrosis in cholestatic liver injury. Indeed, whereas hepatic ITGβ6 mRNA induction tracked with bile duct hyperplasia but not hepatocellular necrosis at different doses of ANIT.

Previous studies have implicated neutrophils in the progression of hepatocellular injury caused by cholestasis. Neutrophil accumulation is a hallmark of focal hepatocellular necrotic lesions observed in acute cholestasis (3,12,32–34). Neutrophil depletion reduces hepatocellular necrosis caused by ANIT and BDL (13,33,35) and inhibition of CXC chemokine-mediated neutrophil recruitment or deficiency in critical adhesion molecules reduces necrosis (32,33). In agreement, we observed a marked increase in hepatic proinflammatory gene induction and histological evidence of neutrophil accumulation coincident with increased hepatocellular necrosis in 0.1% ANIT-exposed mice. Of importance, this increase in inflammation and hepatocellular necrosis occurred without a reflective increase in peribiliary fibrosis, further suggesting fibrosis and hepatocellular necrosis are mechanistically distinct lesions. Moreover, areas of focal hepatocellular necrosis in ANIT-exposed mice were devoid of collagen, suggesting these lesions are adequately repaired. Overall, this disconnect is supported by other studies noting that neutrophils are not major contributors to liver fibrosis in chronic cholestatic liver injury (32).

Understanding the unique driving forces of hepatocellular necrosis and peribiliary fibrosis during cholestasis has several important implications, including but not limited to the importance of characterizing dose-related effects of ANIT in experimental settings. The observation that hepatocellular necrosis and biliary fibrosis are disconnected is important for interpretation of studies seeking novel antifibrotic drugs. For example, in models where hepatocellular injury is intrinsically connected to fibrosis, such as chronic administration of the hepatotoxicant carbon tetrachloride (36,37), drugs could be inferred as antifibrotic even if their mode of action is to inhibit carbon tetrachloride hepatotoxicity. In contrast, drugs that prevent hepatocyte necrosis may not have direct effects on biliary hyperplasia and fibrosis in ANIT-exposed mice. This emphasizes the need to consider etiology of liver fibrosis when comparing effects of interventions in different models of chronic liver injury. In summary, our studies reveal an important disconnect between hepatocellular necrosis and bile duct hyperplasia/fibrosis in mice exposed chronically to ANIT, providing potential explanation for prior studies identifying dichotomy in the mechanisms driving fibrosis in different experimental settings.

Acknowledgments

This work was supported by the National Institutes of Health National Institute of Environmental Health Sciences [R01 ES017537]. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Environmental Health Sciences or the National Institutes of Health.

References

  • 1.Becker BA, Plaa GL. The nature of alpha-naphthylisothiocyanate-induced cholestasis. Toxicol Appl Pharmacol. 1965;7(5):680–685. doi: 10.1016/0041-008x(65)90125-0. [DOI] [PubMed] [Google Scholar]
  • 2.Plaa GL, Priestly BG. Intrahepatic cholestasis induced by drugs and chemicals. Pharmacol Rev. 1976;28(3):207–273. [PubMed] [Google Scholar]
  • 3.Hill DA, Jean PA, Roth RA. Bile duct epithelial cells exposed to alpha-naphthylisothiocyanate produce a factor that causes neutrophil-dependent hepatocellular injury in vitro. Toxicol Sci. 1999;47(1):118–125. doi: 10.1093/toxsci/47.1.118. [DOI] [PubMed] [Google Scholar]
  • 4.Jean PA, Roth RA. Naphthylisothiocyanate disposition in bile and its relationship to liver glutathione and toxicity. Biochem Pharmacol. 1995;50(9):1469–1474. doi: 10.1016/0006-2952(95)02051-9. [DOI] [PubMed] [Google Scholar]
  • 5.Dietrich CG, Ottenhoff R, de Waart DR, Oude Elferink RP. Role of MRP2 and GSH in intrahepatic cycling of toxins. Toxicology. 2001;167(1):73–81. doi: 10.1016/s0300-483x(01)00459-0. [DOI] [PubMed] [Google Scholar]
  • 6.Carpenter-Deyo L, Marchand DH, Jean PA, Roth RA, Reed DJ. Involvement of glutathione in 1-naphthylisothiocyanate (ANIT) metabolism and toxicity to isolated hepatocytes. Biochem Pharmacol. 1991;42(11):2171–2180. doi: 10.1016/0006-2952(91)90353-7. [DOI] [PubMed] [Google Scholar]
  • 7.Jean PA, Bailie MB, Roth RA. 1-naphthylisothiocyanate-induced elevation of biliary glutathione. Biochem Pharmacol. 1995;49(2):197–202. doi: 10.1016/0006-2952(94)00469-2. [DOI] [PubMed] [Google Scholar]
  • 8.Orsler DJ, Ahmed-Choudhury J, Chipman JK, Hammond T, Coleman R. ANIT-induced disruption of biliary function in rat hepatocyte couplets. Toxicol Sci. 1999;47(2):203–210. doi: 10.1093/toxsci/47.2.203. [DOI] [PubMed] [Google Scholar]
  • 9.Luyendyk JP, Cantor GH, Kirchhofer D, Mackman N, Copple BL, Wang R. Tissue factor-dependent coagulation contributes to alpha-naphthylisothiocyanate-induced cholestatic liver injury in mice. Am J Physiol Gastrointest Liver Physiol. 2009;296(4):G840–849. doi: 10.1152/ajpgi.90639.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bergheim I, Guo L, Davis MA, Duveau I, Arteel GE. Critical role of plasminogen activator inhibitor-1 in cholestatic liver injury and fibrosis. J Pharmacol Exp Ther. 2006;316(2):592–600. doi: 10.1124/jpet.105.095042. [DOI] [PubMed] [Google Scholar]
  • 11.Zidek N, Hellmann J, Kramer PJ, Hewitt PG. Acute hepatotoxicity: a predictive model based on focused illumina microarrays. Toxicol Sci. 2007;99(1):289–302. doi: 10.1093/toxsci/kfm131. [DOI] [PubMed] [Google Scholar]
  • 12.Kodali P, Wu P, Lahiji PA, Brown EJ, Maher JJ. ANIT toxicity toward mouse hepatocytes in vivo is mediated primarily by neutrophils via CD18. Am J Physiol Gastrointest Liver Physiol. 2006;291(2):G355–363. doi: 10.1152/ajpgi.00458.2005. [DOI] [PubMed] [Google Scholar]
  • 13.Dahm LJ, Schultze AE, Roth RA. An antibody to neutrophils attenuates alpha-naphthylisothiocyanate-induced liver injury. J Pharmacol Exp Ther. 1991;256(1):412–420. [PubMed] [Google Scholar]
  • 14.Allen K, Jaeschke H, Copple BL. Bile acids induce inflammatory genes in hepatocytes: a novel mechanism of inflammation during obstructive cholestasis. Am J Pathol. 2011;178(1):175–186. doi: 10.1016/j.ajpath.2010.11.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Joshi N, Kopec AK, Towery K, Williams KJ, Luyendyk JP. The antifibrinolytic drug tranexamic acid reduces liver injury and fibrosis in a mouse model of chronic bile duct injury. J Pharmacol Exp Ther. 2014;349(3):383–392. doi: 10.1124/jpet.113.210880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sullivan BP, Weinreb PH, Violette SM, Luyendyk JP. The coagulation system contributes to alphaVbeta6 integrin expression and liver fibrosis induced by cholestasis. Am J Pathol. 2010;177(6):2837–2849. doi: 10.2353/ajpath.2010.100425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Golbar HM, Izawa T, Ichikawa C, et al. Slowly progressive cholangiofibrosis induced in rats by alpha-naphthylisothiocyanate (ANIT), with particular references to characteristics of macrophages and myofibroblasts. Exp Toxicol Pathol. 2013;65(6):825–835. doi: 10.1016/j.etp.2012.12.001. [DOI] [PubMed] [Google Scholar]
  • 18.Joshi N, Kopec AK, O’Brien KM, et al. Coagulation-driven platelet activation reduces cholestatic liver injury and fibrosis in mice. J Thromb Haemost. 2015;13(1):57–71. doi: 10.1111/jth.12770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kopec AK, Joshi N, Luyendyk JP. Role of hemostatic factors in hepatic injury and disease: Animal models de-liver. J Thromb Haemost. 2016 doi: 10.1111/jth.13327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Luyendyk JP, Kassel KM, Allen K, et al. Fibrinogen deficiency increases liver injury and early growth response-1 (Egr-1) expression in a model of chronic xenobiotic-induced cholestasis. Am J Pathol. 2011;178(3):1117–1125. doi: 10.1016/j.ajpath.2010.11.064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Moon JO, Welch TP, Gonzalez FJ, Copple BL. Reduced liver fibrosis in hypoxia-inducible factor-1alpha-deficient mice. Am J Physiol Gastrointest Liver Physiol. 2009;296(3):G582–592. doi: 10.1152/ajpgi.90368.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Popov Y, Patsenker E, Fickert P, Trauner M, Schuppan D. Mdr2 (Abcb4)−/− mice spontaneously develop severe biliary fibrosis via massive dysregulation of pro- and antifibrogenic genes. J Hepatol. 2005;43(6):1045–1054. doi: 10.1016/j.jhep.2005.06.025. [DOI] [PubMed] [Google Scholar]
  • 23.Fickert P, Fuchsbichler A, Wagner M, et al. Regurgitation of bile acids from leaky bile ducts causes sclerosing cholangitis in Mdr2 (Abcb4) knockout mice. Gastroenterology. 2004;127(1):261–274. doi: 10.1053/j.gastro.2004.04.009. [DOI] [PubMed] [Google Scholar]
  • 24.Zhang Y, Hong JY, Rockwell CE, Copple BL, Jaeschke H, Klaassen CD. Effect of bile duct ligation on bile acid composition in mouse serum and liver. Liver Int. 2012;32(1):58–69. doi: 10.1111/j.1478-3231.2011.02662.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Popov Y, Patsenker E, Stickel F, et al. Integrin alphavbeta6 is a marker of the progression of biliary and portal liver fibrosis and a novel target for antifibrotic therapies. J Hepatol. 2008;48(3):453–464. doi: 10.1016/j.jhep.2007.11.021. [DOI] [PubMed] [Google Scholar]
  • 26.Patsenker E, Popov Y, Stickel F, Jonczyk A, Goodman SL, Schuppan D. Inhibition of integrin alphavbeta6 on cholangiocytes blocks transforming growth factor-beta activation and retards biliary fibrosis progression. Gastroenterology. 2008;135(2):660–670. doi: 10.1053/j.gastro.2008.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wang B, Dolinski BM, Kikuchi N, et al. Role of alphavbeta6 integrin in acute biliary fibrosis. Hepatology. 2007;46(5):1404–1412. doi: 10.1002/hep.21849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Munger JS, Huang X, Kawakatsu H, et al. The integrin alpha v beta 6 binds and activates latent TGF beta 1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell. 1999;96(3):319–328. doi: 10.1016/s0092-8674(00)80545-0. [DOI] [PubMed] [Google Scholar]
  • 29.Hirschfield GM, Karlsen TH, Lindor KD, Adams DH. Primary sclerosing cholangitis. Lancet. 2013;382(9904):1587–1599. doi: 10.1016/S0140-6736(13)60096-3. [DOI] [PubMed] [Google Scholar]
  • 30.Chang ML, Yeh CT, Chang PY, Chen JC. Comparison of murine cirrhosis models induced by hepatotoxin administration and common bile duct ligation. World J Gastroenterol. 2005;11(27):4167–4172. doi: 10.3748/wjg.v11.i27.4167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Joshi N, Kopec AK, Ray JL, et al. Fibrin deposition following bile duct injury limits fibrosis through an alphaMbeta2-dependent mechanism. Blood. 2016;127(22):2751–2762. doi: 10.1182/blood-2015-09-670703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Xu J, Lee G, Wang H, Vierling JM, Maher JJ. Limited role for CXC chemokines in the pathogenesis of alpha-naphthylisothiocyanate-induced liver injury. Am J Physiol Gastrointest Liver Physiol. 2004;287(3):G734–741. doi: 10.1152/ajpgi.00300.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Gujral JS, Farhood A, Bajt ML, Jaeschke H. Neutrophils aggravate acute liver injury during obstructive cholestasis in bile duct-ligated mice. Hepatology. 2003;38(2):355–363. doi: 10.1053/jhep.2003.50341. [DOI] [PubMed] [Google Scholar]
  • 34.Li MK, Crawford JM. The pathology of cholestasis. Semin Liver Dis. 2004;24(1):21–42. doi: 10.1055/s-2004-823099. [DOI] [PubMed] [Google Scholar]
  • 35.Gujral JS, Liu J, Farhood A, Hinson JA, Jaeschke H. Functional importance of ICAM-1 in the mechanism of neutrophil-induced liver injury in bile duct-ligated mice. Am J Physiol Gastrointest Liver Physiol. 2004;286(3):G499–507. doi: 10.1152/ajpgi.00318.2003. [DOI] [PubMed] [Google Scholar]
  • 36.Fujimoto J, Limuro Y. Carbon tetrachloride-induced hepatotoxicity. 2. Vol. 9. Elsevier; 1997. [Google Scholar]
  • 37.Fujii T, Fuchs BC, Yamada S, et al. Mouse model of carbon tetrachloride induced liver fibrosis: Histopathological changes and expression of CD133 and epidermal growth factor. BMC Gastroenterol. 2010;10:79. doi: 10.1186/1471-230X-10-79. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES