Skip to main content
NCBI home page
Ecology and Evolution logoLink to Ecology and Evolution
. 2016 Sep 14;6(19):7126–7140. doi: 10.1002/ece3.2446

Origins of two hemiclonal hybrids among three Hexagrammos species (Teleostei: Hexagrammidae): genetic diversification through host switching

Hiroyuki Munehara 1,✉, Miho Horita 1,2,3, Motoko R Kimura‐Kawaguchi 1,2, Aya Yamazaki 1,2
PMCID: PMC5513241  PMID: 28725387

Abstract

Two natural, hemiclonal hybrid strains were discovered in three Hexagrammos species. The natural hybrids, all of which were females that produced haploid eggs containing only the Hexagrammos octogrammus genome (maternal ancestor; hereafter Hoc), generated F1 hybrid‐type offspring by fertilization with haploid sperm of Hexagrammos agrammus or Hexagrammos otakii (paternal species; Hag and Hot, respectively). This study was performed to clarify the extent of diversification between the two hybrids and the maternal ancestor. Genealogical analysis using mtDNA revealed that all 38 Hoc/Hot hybrids formed a branch (Branch I) with 18 of the 33 Hoc/Hag hybrids. No haplotype sharing was observed with the maternal ancestor. Further, microsatellite DNA analysis suggested that the members of Branch I shared the same hemiclonal genome set. The results suggested that Hoc/Hot hybrids originated by anomalous hybridization, or “host switching,” between Hoc/Hag and Hot, and not from interspecific hybridization between Hoc and Hot. The remaining 9 of 11 Hoc/Hag haplotypes and all of the 27 Hoc haplotypes were mixed within the genealogical tree, as if they had originated from multiple mutations. However, Hoc/Hag could also mate with Hoc. Although offspring from this host switch (Backcross‐Hoc) have the same genome as normal Hoc, a part of their genome retains genetic factors capable of producing hemiclones. Consequently, when a descendant of a BC‐Hoc hybrid mates with Hag males, a new hemiclone lineage will arise. Multiple haplotype revival through host switching from a single mutation in hybrids is another possible hypothesis for the observed mixing of Hoc/Hag haplotypes within the mtDNA genealogical tree.

Keywords: hybridogenesis, diversification of hybrids, host switching, maternal inheritance, Improving longevity through host switching backcross

1. Introduction

Although most eukaryotes have retained sexual reproduction with recombination as a reproductive strategy, some have developed unisexual modes of reproduction, such as clonal reproduction (parthenogenesis and gynogenesis) and hemiclonal reproduction (hybridogenesis), which involve hybridization between different species (Dawley, 1989; Hubbs & Hubbs, 1932; Lampert & Schartl, 2008). In clonal modes of unisexual reproduction, females produce unreduced diploid or triploid eggs by different cytogenetic mechanisms that develop normally without any biological or genetic contribution from males, and no male offspring are produced (Dawley, 1989). Unlike sexual reproduction, in which there is the added cost of producing of males, unisexually reproducing organisms do not incur these additional costs during reproduction (Maynard Smith, 1978). Consequently, unisexual taxa are considered to be at an advantage in terms of their ability to colonize new habitats and outcompete organisms that employ sexual reproduction (Avise, 2008). However, unlike sexually reproducing organisms, unisexual taxa are more likely to accumulate deleterious mutations (Kondrashov, 1988; Rice & Friberg, 2009). Consequently, the long‐term survival of unisexual taxa that lack novel genetic adaptations to perturbations in the environment or to attacks by parasites is relatively limited (Bengtsson, 2009; Neiman & Koskella, 2009), implying that they are potentially evolutionary dead ends that are at greater risk of extinction (Bell, 1982; Bengtsson, 2009; Maynard Smith, 1986). In response to these limitations, several mechanisms have been identified that mitigate against the severe genetic disadvantages associated with a unisexual mode of reproduction (Loewe & Lamatsch, 2008; Schartl, Wilde, Schlupp, & Parzefall, 1995). For example, in the Amazon molly (Poecilia formosa), small parts of the paternal genome (microchromosomes) can remain in the oocyte during gynogenesis (Lamatsch, Nanda, Schlupp, Epplen, & Schmid, 2004; Schartl et al., 1995). In addition, polyploidy has been observed in both clonal and hemiclonal species, including the topminnow (Poeciliopsis monacha‐lucida) (Cimino & Schultz, 1970; Schultz, 1969; Vrijenhoek, Dawley, Cole, & Bogart, 1989), Pelophylax (formerly Rana) water frog complex (Graf & Pelaz, 1989), Cobitis spiny loach hybrids (Choleva et al., 2012; Janko, Culling, Ráb, & Kotlík, 2005; Janko et al., 2007), and the Pond loach (Misgurnus anguillicaudatus) (Itono et al., 2006). These additional genome components can benefit an organism by providing more genetic material that can be acted on by mutation and selection (Ohno, 1970; Volff 2005). The presence of these additional genetic materials have enabled some unisexual organisms to mitigate against the effects of deleterious mutations (Loewe & Lamatsch, 2008; Schartl, Nanda, et al., 1995), enabling unisexual systems to persist and last for longer than predicted periods over evolutionary time (Loewe & Lamatsch, 2008; Lynch & Gabriel, 1990; Maynard Smith, 1992). For example, the Amazon molly has been estimated to be about 120,000–280,000 years old, which is equivalent to approximately 360,000–840,000 generations (Lampert & Schartl, 2008; Meyer, Salzburger, & Schartl, 2006; Schartl, Wilde, et al., 1995; Stöck, Lampert, Möller, Schlupp, & Schartl, 2010), and Cobitis spiny loach hybrids have existed for approximately 300,000 years (Janko et al., 2005).

Hybridogenesis is a form of hemiclonal reproduction that results in the production of haploid eggs that contain only the maternal genome as the paternal genome is discarded (Cimino, 1972; Schultz 1969, Schultz, 1973). Interestingly, the females reproduce by backcrossing with males of the paternal ancestor; this phenomenon has been reported in the topminnow (P. monacha‐lucida), Pelophylax water frog complex (Ogielska, 2009; Uzzell & Berger, 1975), stick insects (Scali, 2009), Iberian minnow (Carmona, Sanjur, Doadrio, Machordom, & Vrijenhoek, 1997), Australian carp gudgeon (Hypseleotris hybrid) (Schmidt, Bond, Adams, & Hughes, 2011), and greenling (Hexagrammos hybrid) (Kimura‐Kawaguchi et al., 2014). Male hybridogenesis in which the maternal genome is discarded has also been reported in the Pelophylax water frog complex (Lehtonen, Schmidt, Heubel, & Kokko, 2013) and the Australian carp gudgeon (Schmidt et al., 2011).

In hybridogenesis, although females produce genetically identical haploid eggs without any genetic recombination, genetic variation is maintained by renewal of the paternal genome every generation. In this way, hybridogenesis compensates for the costs associated with sexual reproduction while retaining some of the benefits of clonal reproduction (Vrijenhoek, 1994). These advantages, despite involving a unisexual mode of reproduction, should enable hemiclonal animal lineages to remain viable for longer than clonal lineages.

Hybridogenesis, gynogenesis, and parthenogenesis are all considered to have originated from hybridization between different species (Lamatsch & Stöck, 2009; Vrijenhoek, Angus, & Schultz, 1977). Speciation in two geographically separated populations can occur when a contiguous population is separated by a vicariant event of some kind. Under such conditions, genetic differences gradually arise between the separated populations, often resulting in what is referred to as allopatric speciation (Coyne & Orr, 2004). In such cases, if secondary contact occurs before premating reproductive isolation has fully developed, natural hybrids will appear (Barton & Hewitt, 1989). Although most hybrids typically have low fitness and low reproductive viability due to the inherent incompatibility of the genomes from different species, in some instances, hybrids may be able to survive by employing unisexual reproduction without the recombination of genomes (Ellstrand et al., 2010).

For example, hemiclonal reproduction has recently been reported in two Hexagrammos hybrid strains (Kimura‐Kawaguchi et al., 2014). The natural hybrids produce haploid eggs containing only the Hexagrammos octogrammus genome (maternal ancestor) and generate F1 hybrid‐type offspring by fertilization with the haploid sperm of either Hexagrammos agrammus or Hexagrammos otakii (paternal species); in this way, the genome set of the natural hybrids is composed of a hemiclonally transmitted maternal genome and a recombined paternal genome. Similarly, because the second generations of a backcross between natural hybrids and paternal species reproduce by hybridogenesis in the same way as the maternal generation of the natural hybrids, hemiclonal reproduction is maternally inherited over successive generations by backcrossing with paternal species. In addition, Kimura‐Kawaguchi et al. (2014) also found that artificial F1 hybrids produced by crossing pure species generated recombinant gametes, suggesting that although the artificial F1 hybrids have the same genome composition as hemiclonal hybrids, hemiclonal hybrids do not always result from a hybridization event. In addition, hemiclonal hybrids exhibit genetic differences (mutations) that do not occur in wild‐type parental species.

Maternal inheritance markers can be used to clarify when hybridization occurred. Genealogical relationships among parental Hexagrammid species were estimated using polymorphic mitochondrial and nuclear DNA markers (Crow, KAnamoto, & Bernardi, 2004). Hexagrammos agrammus and H. otakii (paternal species) are the most closely related taxa in this genus. The common ancestor of H. agrammus and H. otakii (paternal species) underwent allopatric divergence from H. octogrammus (maternal ancestor) approximately 2.2–3.6 million years ago, and H. otakii and H. agrammus underwent sympatric divergence from the common ancestor approximately 1.2–2.0 million years ago. Secondary contact between the maternal and paternal species probably occurred after sympatric speciation during the Pleistocene (Brykov & Podlesnykh, 2001; Shinohara, 1994). Hexagrammos hybridization is the only known hybridogenetic system in marine fishes inhabiting the North Pacific Ocean. The potentially low extinction potential of these Hexagrammos hybrids is considered to be due to the diversity of habitats, and the longevity, structure, and fluctuation in populations of these species would likely differ from (hemi)clonal organisms distributed in more restricted environments, such as rivers and ponds. The present study was conducted to clarify the origin and diversification of two Hexagrammos hybrids and the maternal parent species (H. octogrammus) using maternal inheritance markers.

2. Materials and Methods

2.1. Fish sampling and species identification

For genealogical analysis of the two natural, hemiclonal, hybrid strains, H. octogrammus/H. agrammus (Hoc/Hag) and H. octogrammus/H. otakii (Hoc/Hot), and the maternal ancestor H. octogrammus (Hoc), fishes were captured using gill nets and traps on a coastal reef off Usujiri, Japan, from 2004 to 2010 (Fig. 1). Specimens were identified based on diagnostic external morphological diagnostic characteristics, such as the number of lateral lines, flap pairs, and the caudal fin shape, following Nakabo (2000) and Shinohara (1994), as described previously (Kimura‐Kawaguchi et al., 2014). A total of 40 Hoc, 31 Hoc/Hag, and 38 Hoc/Hot specimens were used in the present study. Muscle or fin tissue samples were collected from the fish and preserved in 99% ethanol at −10°C until genetic analysis. The paternal species, H. agrammus and H. otakii, and the closely related Hexagrammos decagrammus, Hexagrammos lagocephalus, Hexagrammos stelleri, Pleurogrammus azonus, and Pleurogrammus monopterygius, all of which are held in the collection at the Usujiri Fisheries Station, were included in the genealogical analysis.

Figure 1.

Figure 1

Open in a new tab

Genealogical tree for Hoc, Hoc/Hag, and Hoc/Hot derived from three regions of mtDNA: Cyt b, 12S‐16S rRNA, and CoI. Numbers above nodes indicate bootstrap values obtained from 1000 replications. The colored symbols adjacent to each haplotype indicate the presence of Hoc (blue), Hoc/Hag (red), and Hoc/Hot (yellow)

In addition, to estimate the allele frequencies for the paternal species of the two natural hybrid strains using microsatellites, 33 H. agrammus and 34 H. otakii were captured using hand nets while SCUBA diving on a coastal reef off Usujiri, Japan, from 2010 to 2013. Tissues from these specimens were preserved in 99% ethanol and stored at −10°C until genetic analysis.

2.2. Polymerase chain reaction conditions and mitochondrial DNA sequencing

Total genomic DNA was extracted using a Quick Gene DNA tissue kit S (Fujifilm, Japan) according to the manufacturer's instructions and stored in a refrigerator at 4°C until use.

Three regions of the mitochondrial genome (i.e., cytochrome b [cyt b], 12S‐16S rRNA, and cytochrome oxidase [CO] I) of the mitochondrial DNA of Hoc/Hag, Hoc/Hot, Hoc, and the outgroup species were sequenced (Table 1). The first two regions and the third region were amplified using the primer sets of Kimura, Yanagimoto, and Munehara (2007) and Ward, Zemlak, Innes, Last, and Hebert (2005), respectively. Polymerase chain reactions (PCRs) were performed in 50 μl volumes containing 25 μl Emerald Amp™ PCR Master Mix (Takara Bio Inc., Japan), 22 μl sterile distilled water, 0.5 μl of each 5 μmol/l primer, and 2 μl of template DNA (50–100 ng). The PCR profiles for the three regions consisted of an initial denaturation step at 94°C for 2 min, followed by 30–40 cycles of denaturation at 94°C for 30 s, annealing at 55°C, and extension at 72°C for 30 s, with a final extension step of 72°C for 7 min. After the final extension step, samples were stored at 4°C. Amplification was performed using a Takara PCR Thermal Cycler Dice (Takara Bio Inc.), and PCR products were purified using a NucleoSpin® Gel and PCR Clean‐up kit (Macherey‐Nagel GmbH & Co. KG, Germany). PCR products were sequenced with an autosequencer (3130 Genetic Analyzer, Applied Biosystems, CA) by Macrogen Japan Corporation using the same PCR primers.

Table 1.

PCR primer sequences used in the present study

Locus (accession no.) Sequence 5′‐‐‐‐‐‐‐‐‐‐‐3′ (upper, forward; lower, reverse)
cytochrome b (AF087409, 087410, 087412) ATGGCAAGCCTACGAAAA
TCCTAAGGCCTTGTTTTCT
12‐16S rRNA (AF084629, 084631) CGGGAACTACGAGCAAAAG
TCTTTTAGTCTTTCCCTGGGG
COI (DQ107581–DQ108334) TCAACCAACCACAAAGACATTGGCAC
TAGACTTCTGGGTGGCCAAAGAATCA
hexoc 6 (AB690324) GGATAGTTTGTTCCTGTCAG
AAATGTTTGTCCCCAAACCC
hexoc 14 (AB690329) CGGGGTAGTGAAGCATGAT
TTTTGTACTTGTGTTTTCCT
hexoc 21 (AB690332) CACATTTCTACAACAGCTTG
AGTTATGACATGAGCTGAAGA
Open in a new tab

2.3. Sequence analysis

Specimen sequences were aligned using the Clustal W computer program (Higgins, Thompson, & Gibson, 1994). Genealogical analysis among haplotypes was performed using MEGA software (version 6.06; Tamura, Stecher, Peterson, Filipski, & Kumar, 2013). The nucleotide substitution model for each gene was selected using Kakusan4 (Tanabe, 2011), and sequence data were also subjected to a maximum‐likelihood (ML) analysis. Phylogenetic relationships between each partition were inferred by the ML method using RAxML (version 7.2.8; Stamatakis, 2006). Nucleotide divergences were computed using the Kimura 2‐parameter model (Kimura, 1980), and a genealogical tree was constructed using the neighbor‐joining method (Saitou & Nei, 1987). The robustness of the topology nodes was assessed using the bootstrap method with 1000 replications (Felsenstein, 1985). Unrooted statistical parsimony haplotype networks were created to connect mitochondrial DNA (mtDNA) haplotypes using TCS 1.21 (Clement, Posada, & Cradell, 2000).

2.4. Allelic analysis using microsatellite DNA

In hybridogenesis, nuclear DNA inherited from the maternal ancestor is maternally inherited in the same way as mtDNA, which means that microsatellite marker is also well suited for genealogical analysis in hemiclone organisms. To examine the sharing of alleles among the natural hybrids (Hoc/Hag and Hoc/Hot) and Hoc, three highly polymorphic microsatellite loci (hexoc 6, hexoc 14, and hexoc 21) were examined (Table 1, Kimura‐Kawaguchi et al., 2014). The methods used for the amplification of microsatellite DNA and genotyping of PCR products were the same as those employed in a previous study (Kimura‐Kawaguchi et al., 2014).

3. Results

3.1. Genealogical analysis of Hexagrammos octogrammus and the two natural hybrid strains using mtDNA

Nucleotide sequences were obtained for a total of 2,498 base pairs (bp), 994 bp of the Cyt b region, 918 bp of the 12S‐16S rRNA region, and 586 bp of the COI region. A total of 35 haplotypes (including subhaplotypes defined as the same arrangement of nucleotides except for a synonymous substitution) were identified in sequences from 109 individuals: 27 haplotypes from 40 Hoc individuals, 11 haplotypes from 31 Hoc/Hag individuals, and two haplotypes from 38 Hoc/Hot individuals (Table 2). The identified haplotypes had 63 polymorphic sites. Sequences of each haplotype and of each outgroup were deposited in GenBank under the accession numbers listed in Table S1.

Table 2.

Variable nucleotide sites in 2,498 bp of 35 haplotypes, including three subhaplotypes in the three mtDNA regions assayed in Hoc, Hoc/Hag, and Hoc/Hot

Haplotypes Nucleotide position
Cyt b 12S‐16S rRNA COI
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2
1 2 2 2 2 2 3 3 4 4 5 5 5 5 5 5 6 6 7 7 7 7 7 8 8 9 9 9 9 9 9 9 9 9 0 1 3 4 4 6 6 6 6 7 7 7 8 9 9 9 1 1 1 1 2 3 3 3 3 4 4 4 4
8 2 4 4 7 8 3 4 0 5 3 4 5 6 7 9 6 8 2 3 5 6 7 8 9 0 3 3 4 4 4 6 6 9 5 8 4 1 6 4 5 6 7 0 2 8 3 2 4 8 4 7 8 9 1 0 5 7 8 0 1 3 4
6 2 4 9 3 5 7 8 8 6 4 0 5 7 6 7 9 1 6 5 6 2 7 2 7 0 0 6 2 5 8 0 3 0 1 8 6 8 6 6 1 1 6 9 8 0 6 7 4 9 5 2 1 0 7 4 5 0 5 6 5 6 5
hap1 A C C C A T C A T C G A A T C G A T G A A C C C T T G C T T A C G T G T G T C C C T C C T T A C A G C G C A G T G G A G A C G
hap2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . .
hap3‐1 . . . . . . . G . . . . . . . A . . . . . . . T . . . . . . . T . . . C . . . . . . . . . . G . . A . A . . . . . . . . . . .
hap3‐2 . . . . . . . . . . . . . . . A . . . . . . . T . . . . . . . T . . . C . . . . . . . . . . G . . A . A . . . . . . . . . . .
hap4 . . . . . . . . . . A . . . T . . . . . . . . . . . . . . . . . . . . C . . . . . . . . A . G . . A . . . . . . . . . . . . .
hap5 . . . . . . . . . . A . . . T . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A . . . . . . . . . . . . .
hap6 G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . T . . G . . A . . . . . . . . . . . . .
hap7 . T . . . . . . . . . T . . . . G . . . . . . . C . . . . . . . . . . C . . . . . . . . . . G . . A . . T G . . . . . . T . .
hap8 . . T . . . . . . . . . . . . . . C . . . . . . . . . T . . . . . . . C . . . . . . . . . . G . . A . . . . . . . . . . . . .
hap9 . . T . . . . G . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A . . . . . . . . . . . . .
hap10 . . T . . . T . . . . . . . . . . . . . G T . . . . . . . . G . . . . C . . . . . . . . . . G . . A . . T . . . . . . . . . .
hap11 . . . T . . T . C . . . . . . . . . . . . . . . . . . . C . . . . . . C . . . . . . . T . . G . . A . . T . A . . . . . . . .
hap12 . . . . G C T . . . . . . . . . . . . . . . T . . . . . . . . . . . . C . . . . . . . . . . G T . A . . T . . C . . . . . . A
hap13 . . . . . . T G . . . . . C . . . . . . G . . . . . A . . . . . . . . C . . . . A . . . . . G . . A . . T . . . . . . . . . .
hap14 . . . . . . T G . . . . . . . . . . . . G . . . . C . . . . . . . . . C . . . . . . . . . . G . . A . . T . . . A . . . . . .
hap15‐1 . . . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A . . . . . . . . . . . . .
hap15‐2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A . . . . . . . . . . . . .
hap15‐3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . C . G . . A . . . . . . . . . . . . .
hap16 . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A . . . . . . . . T . . . .
hap17 . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A . . . . . . . . . . . . .
hap18 . . . . . . . . . . A . T . T . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A . . . . . . . A . . . . .
hap19 . . . . . . . . . . A . . . T . . . . . . . . . . C . . . . . . . . . C A . . . . . . . . . G . . A . . . . . . . . . . . . .
hap20 . . . . . . . . . . A . . . T . . . . G . . . . . . . . . C . . . . . C . . . . . . . . . . G . . A . . . . . . . . . . . . .
hap21 . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A T . . . . . . . . . . . .
hap22 . . . . . . . . . . . . . . . A . . . . . . . T . . . . . . . T . . . C . . . . . . T . . . G . . A . A . . . . . . . A . . .
hap23 . . . . . . . . . . . . . . . A . . . . . . . T . . . . . . . T . . . C . . . . . . T . . . G . . A . A . . . . . . . . . . .
hap24 . . . . . . . . . . . . . . . A . . . . . . . T . . . . . . . T . . . C . . . . . . . . . . G . . A . . . . . . . . . . . . .
hap25 . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . .
hap26 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . C . . . . . . . . . . G . G A . . . . . . . . . . . . .
hap27 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . C . C . . . . . . . . G . . A . . . . . . . . . . . . .
hap28 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . C . . . . . . . . . . G . . A . . . . . . . . . . . . .
hap29 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C A C . . . . . . . . . C G . . A . . . . . . . . . . . . .
hap30 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A . . . . . . . . . . . T .
hap31 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . A . . C . . . . G . . A . . . . . . . . . . . . .
hap32 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . . G . . A . . T . . . . . . . . . .
Open in a new tab

Dots indicate nucleotide identity with the haplotype 1 sequence.

The maximum‐likelihood analysis showed that the two natural hybrid strains (i.e., Hoc/Hag and Hoc/Hot) formed a cluster within Hoc—separately from both Hot and Hag—implying that both hybrid strains had Hoc as the maternal species (Fig. 1). Within the Hoc cluster, the Hoc/Hag and Hoc haplotypes were mixed with the other samples in the genealogical tree, with Hoc/Hag exhibiting multiple hemiclones as if they had originated independently from separate mutations. Conversely, all of the Hoc/Hot haplotypes belonged to a single branch (Branch I) within the clade consisting of a combination and closely related Hoc, Hoc/Hag, and Hoc/Hot haplotypes.

A total of 32 haplotypes were included in the haplotype network for Hoc, Hoc/Hag, and Hoc/Hot individuals (Fig. 2). Two of the haplotypes (hap 3 and hap 15) contained two and three subhaplotypes (subhap 3‐1 and 3‐2, subhap 15‐1, 15‐2 and 15‐3), which could be distinguished from each other by a nonsynonymous substitution. From 1 to 20 mutational steps were found among the 11 Hoc/Hag haplotypes. Three of the haplotypes that Hoc/Hag shared with Hoc were connected by four and seven mutational steps. All 38 of the Hoc/Hot hybrids and 18 Hoc/Hag hybrids were clustered in Branch I, and 37 of the Hoc/Hot hybrids and 17 of the Hoc/Hag hybrids shared hap 1. A total of 56 (70.9%) of the 79 hybrids used in the present study were grouped in one cluster, and there were no haplotypes that shared the Hoc maternal ancestor. The extent of genetic divergence in Branch I was very low, with only one substitution in 2,498 bp detected in 12S‐16S rRNA. Conversely, the minimum number of mutational sites between Hoc and Hoc/Hot (hap1 and subhap 15‐2) was one substitution in 12S‐16S rRNA and two substitutions in COI. Thus, the results showed that the mtDNA of Hoc/Hot was more similar to Hoc/Hag than it was to the maternal ancestor, Hoc.

Figure 2.

Figure 2

Open in a new tab

Parsimony‐based haplotype network for Hoc, Hoc/Hag, and Hoc/Hot inferred based on three mtDNA regions: Cyt b, 12S‐16S rRNA, and CoI. Values in pie charts show the haplotype number. The size of each pie chart corresponds to the haplotype frequency, and the color of each pie represents Hoc (blue), Hoc/Hag (red), and Hoc/Hot (yellow). Open circles represent hypothetical haplotypes that were not empirically sampled. Bars indicate the synonymous substitutions required for transition between haplotypes

3.2. Sharing of alleles among the two natural hybrid strains and Hexagrammos octogrammus

The characteristics of the microsatellite loci used for genotyping are shown in Table 3. In the parental species (Hag, Hot, and Hoc), all three loci had sufficiently high heterozygosities and low Hardy–Weinberg equilibrium deviation probabilities, which meant that the microsatellite loci were well suited for genetic analysis and that there were marked differences in the size of alleles among parental species (Fig. 3). Conversely, in the two natural hybrids, the observed heterozygosities approached to 1, except for hexoc 6 in Hoc/Hag, and the probability of deviation from Hardy–Weinberg equilibrium assessed by a chi‐squared test was high (Table 3). This finding was illustrated by the natural hybrids that possessed a hemiclonal genome set inherited from the maternal ancestor (Hoc) and a different genome set inherited from the paternal species (Hot or Hag).

Table 3.

Summary of polymorphic microsatellite loci for the two natural hybrids and the three parental species

Species name Locus name Size range (bp) No of allele H o H e Chi‐squared test p Value
Hexagrammos octogrammus (N = 40) Hexoc 6 88–154 29 0.925 0.947 0.206 .036
Hexoc 14 88–138 15 0.950 0.907 0.330 .099
Hexoc 21 132–186 23 0.900 0.929 0.011 .130
Hoc/Hag (N = 31) Hexoc 6 96–128 12 0.710 0.765 0.683 .079
Hexoc 14 80–134 13 0.912 0.888 0.993 .020
Hexoc 21 100–162 21 1.000 0.859 0.976 .193
Hoc/Hot (N = 38) Hexoc 6 116–182 24 1.000 0.750 1.000 1.000
Hexoc 14 88–132 10 0.909 0.755 1.000 .902
Hexoc 21 98–148 12 1.000 0.715 1.000 .134
Hexagrammos agrammus (N = 33) Hexoc 6 108–128 11 0.921 0.883 0.868 .510
Hexoc 14 78–96 9 0.818 0.812 0.025 .063
Hexoc 21 100–132 17 0.879 0.909 0.889 .030
Hexagrammos otakii (N = 34) Hexoc 6 120–198 25 0.941 0.938 0.347 .349
Hexoc 14 100–138 15 0.853 0.877 0.927 .289
Hexoc 21 96–130 12 0.824 0.828 0.259 .338
Open in a new tab

H o and H e exhibited observed and expected heterozygosities, respectively. The results obtained for Hoc, Hoc/Hag, and Hoc/Hot individuals are shown in Table 4.

Figure 3.

Figure 3

Open in a new tab

Microsatellite DNA allele frequencies in parental species used to detect the maternal alleles of hemiclonal hybrids. (A–C) Represent hexoc 6, hexoc 14, and hexoc 21, respectively

Interestingly, 37 of the 38 Hoc/Hot hybrids shared the same alleles at hexoc 6 (116 bp) and hexoc 21 (148 bp), and all 18 of the Hoc/Hag hybrids in Branch I also shared these allele sets (Table 4). In 55 hybrids, hexoc 14 was either 122 bp or 124 bp in length; the one exception in Branch I, ID399, shared alleles at hexoc 14 and hexoc 21, but the alleles at hexoc 6 were unique. Because the 116‐bp allele at hexoc 6 in 37 Hoc/Hot hybrids was smaller than the size range observed in H. otakii (Fig. 3, Table 3), the shared allele in Branch I was likely hemiclonally inherited from the maternal ancestor, Hoc. The 148‐bp allele at hexoc 21 in all 56 hybrids in Branch I was larger than the size ranges observed in both Hot and Hag, implying that the common allele was also hemiclonally inherited from Hoc. The 122‐bp or 124‐bp alleles at hexoc 14 in 18 Hoc/Hag hybrids in Branch I were larger than the size range observed in Hag, implying that these alleles also appeared to be hemiclonally inherited from Hoc. The allele frequencies of the alleles (116 bp at hexoc 6, 122 bp or 124 bp at hexoc 14, and 148 bp at hexoc 21) that were shared among the hybrids were all less than 10% in Hoc (Table 3). In addition, the specific allele observed at hexoc 6 in ID399 probably varied from homologous alleles, as microsatellite DNA occasionally mutates during generation changes (Guichoux et al., 2011). Supposing that the 122‐bp and 124‐bp alleles at hexoc 14 were homologous and that they slipped during several generation changes, then the common homologous allele set at the three loci would occur at a frequency of less than 0.04%. Such a low rate suggested that all of the individuals in Branch I, that is, 18 Hoc/Hag and 38 Hoc/Hot, originated from the same hybridogen.

Table 4.

Identification (ID) number, haplotypes, and genotypes for 40 Hoc, 31 Hoc/Hag, and 38 Hoc/Hot fishes

3.2.

Open in a new tab

Regarding the other 13 Hoc/Hag hybrids, three individuals (ID233, ID782, and ID888; all hap 22) shared the same alleles at the three loci examined in this study; judging from the size ranges of the alleles in Hag and Hoc, the alleles were considered to have been hemiclonally inherited from Hoc. Similarly, two individuals (ID875 and ID877; both hap 23) shared the same maternal alleles. These five individuals shared the same allele at hexoc 6 and hexoc 21, even though both haplotypes had a different allele at hexoc 14. Only 1 bp of the 2,498 bp of mtDNA analyzed was found to differ between hap 22 and hap 23 (Table 2), implying that there was a high possibility that hap 22 and hap 23 originated from the same hybridogen.

Although ID278 (hap 7) and ID217 (hap 3‐2) shared alleles at every locus, the 112‐bp allele that was common to hexoc 21 was inherited from Hag, judging from the size range of the alleles in both parental species (Fig. 3, Table 4). Of the remaining 7 Hoc/Hag hybrids, none shared any alleles at the three loci with the other hybrids.

4. Discussion

4.1. Hoc/Hot born from host switch

Because both hybridogenetic hybrids (Hoc/Hot and Hoc/Hag) had Hoc mtDNA haplotypes, H. octogrammus (Hoc) is considered to be the maternal ancestor of these hybrids (Crow et al., 2007; Kimura et al., 2007). Although morphological (Shinohara, 1994) and molecular studies (Crow et al., 2004) have demonstrated that H. agrammus (Hag) and H. otakii (Hot) are the closest relatives (sister species), hybrids between these two species have rarely ever been observed in areas where these species are sympatrically distributed (Crow et al., 2007; Kimura & Munehara, 2010; Kimura & Munehara, 2011). Conversely, natural hybrids (Hoc/Hot and Hoc/Hag) between distant species have been shown to propagate by hemiclonal reproduction, with hybridization occurring after secondary contact (Kimura‐Kawaguchi et al., 2014). Because hybrids typically have low fitness and survivability, parental species typically avoid hybridization by reinforcing species recognition, as failure to do so would result in these species interbreeding and forming a single species (Coyne & Orr, 2004; Ellstrand et al., 2010). Hemiclonal reproduction is one mechanism that allows hybrids to survive while avoiding genetic recombination (Burt & Trivers, 2006). Because all of the hemiclonal hybrids are fertile females capable of breeding with males of the paternal species, the two natural hybrid populations can be considered to be independent of Hoc, Hot, and Hag (Kimura‐Kawaguchi et al., 2014). The hybrids produce haploid eggs containing only the Hoc genome (maternal ancestor), as the paternal genome is discarded and F1 hybrid‐type offspring are generated by fertilization with haploid sperm from either Hag or Hot (paternal ancestor); the entire paternal genome is displaced at every generation change. When a Hoc/Hag hybrid mates with a Hot male, the entire paternal genome of the descendants will change from Hag to Hot. The genome of the descendants will therefore constitute the hemiclonal Hoc genome and a normal Hot genome, to produce the Hoc/Hot hybrids.

Genealogical analysis using mtDNA revealed that Hoc/Hot hybrids formed a cluster with Hoc/Hag (Branch 1), which did not contain any Hoc individuals (Fig. 1). This branch (Branch I) was supported by high bootstrap values. In the microsatellite DNA analyses, the individuals in Branch I shared a common allele set consisting of three loci, indicating that the Hoc/Hot hybrids inherited an identical hemiclonal genome set from Hoc/Hag. The low levels of diversity observed in the mtDNA and microsatellite DNA analyses showed that Hoc/Hot hybrids originated by anomalous hybridization events between Hoc/Hag and Hot. Although it was previously considered that the occurrence of numerous hybrids was the result of rampant hybridization between Hoc and Hot (Crow et al., 2007), Hoc/Hot hybrids are unlikely to have appeared due to interspecific hybridization. Changes in the species of the sperm donor among hybrids employing (hemi)clonal reproduction are referred to as “host switching” (Choleva, Apostolou, Rab, & Janko, 2008). Host switching has been reported in other unisexual fish lineages (e.g., Squalius hybrids: Alves, Coelho, Collares‐Pereira, & Dowling, 1997; Poecilia hybrids: Niemeitz, Kreutzfeldt, Schartl, Pazefall, & Schlupp, 2002; Schlupp, Parzefall, & Schartl, 2002; Cobitis hybrids: Janko et al., 2005; Poeciliopsis hybrids: Cunha, Coelho, Carmona, & Doadrio, 2004; Mateos & Vrijenhoek, 2002, 2005; Sousa‐Santos, Collares‐Pereira, & Almada, 2006) and amphibians (e.g., Ambystoma hybrids: Hedges, Bogart, & Maxon, 1992; Spolsky, Phillips, & Uzzell, 1992; Pelophylax: Arano, Llorente, Herrero, & Sanchiz, 1995).

Why do hybrids change the species of the sperm donor? Host switching may arise when the primary hybrids require a sperm donor after the extinction of the parental species. However, Hexagrammos hybrids are widespread in the North Pacific Ocean, and both paternal species (Hag and Hot) coexist. Thus, while pre‐reproductive isolation between the paternal species of this genus is likely to have occurred due to subtle differences in habitat preference and parental care (Kimura & Munehara, 2010, 2011), breeding season and site preference are known to overlap among Hag, Hot, and Hoc (Munehara, Takenaka, & Takenaka, 2000). For example, Hoc and Hag inhabit shallow seaweed beds, while Hot inhabits deeper reefs and sandy bottomed environments where seaweeds are scarce (Kimura & Munehara, 2010, 2011). Hexagrammos species employ breeding territories and the polyandrous females visit the multiple males' territories where they spawn and produce adhesive egg masses that are then guarded by the males (Munehara, Kanamoto, & Miura, 2000; Munehara, Takenaka, et al., 2000). Females show a preference for large males that are good guardians (Kvarnemo & Simmons, 2013; Maan & Seehausen, 2011). Because Hot males with territories have larger bodies and larger egg masses than Hag males (Munehara, Kanamoto, et al., 2000), Hoc/Hag hybrids may prefer to mate with Hot males. While reproductive isolation is considered to be effective for maintaining species, some anomaly must have allowed Hoc/Hag hybrids to achieve host switching at some point in the evolutionary history of these species.

In Branch I, hap 1 was the most dominant haplotype and the difference between hap 1 and hap 2 was only one mutational step in 2,498 bp (Fig. 2). In addition, an identical mutation in hexoc 14 was found in both hap 1 and hap 2 of Hoc/Hag hybrids. These findings strongly suggest that host switching first occurred as hap 1 of Hoc/Hag became more widespread, and then hap 1 Hoc/Hot increased in number. Given that the direction of mate choice was from Hag to Hot by Hoc/Hag, and that Hoc/Hot only occurred in Branch I, the reverse host switch probably did not occur. Hoc/Hag and Hoc/Hot shared both hap 1 and hap 2. It is currently not clear whether host switching occurred in hap 2 again or not.

Thus, mtDNA and microsatellite DNA are considered to have mutated during generation changes. Assuming that the molecular clock of mtDNA in Hexagrammos is 1.5–2.5% per million years (Crow et al., 2004; Meyer, Kocher, Basasibwaki, & Wilson, 1990), host switching likely first occurred 17,000–27,000 years ago. Assuming a mutation rate for microsatellite DNA of 10−3–10−4 per single frameshift slippage (Guichoux et al., 2011), the first host switch occurred approximately 2,000–20,000 years ago (assuming a generation period of 2 years).

4.2. Diversification of Hoc/Hag from Hoc

There is a strong possibility that Hoc/Hag hybrids changed sperm donors to both Hot and Hoc, although the evidence is somewhat inconclusive. We consider that the genome of Hoc/Hag hybrids is constituted by both Hoc and Hag genomes, and this mode of host switching (i.e., Hoc/Hag crossing with Hoc instead of Hag) may be more likely than Hoc/Hag hybrids mating with Hot. When a Hoc/Hag hybrid mates with a male of the maternal species, Hoc, the offspring (backcrossed Hoc; BC‐Hoc) become Hoc (Fig. 4). BC‐Hoc has the same morphological characteristics as normal Hoc, but the two Hoc genomes differ somewhat with respect to the genetic material they contain. We reported previously that natural Hoc/Hag hybrids produced haploid eggs containing only the maternal genome, whereas artificial F1 hybrids (i.e., crosses between Hoc and Hag) produced haploid eggs containing a recombinant genome (Kimura‐Kawaguchi et al., 2014). The artificial F1 hybrids had the same genome composition as the natural hybrids, but the reproductive system differed between the two hybrids; that is, the Hoc genome of the natural hybrids carried genetic factors that facilitated hybridogenesis, which were not present in the normal Hoc genome. Although this mechanism has not yet been resolved at a cytological level, we found that BC‐Hoc individuals produced recombinant gametes (Kimura‐Kawaguchi et al., 2014; in preparation). In other words, when Hexagrammos species have homogeneous genomes, meiosis occurs normally in germ cells without any genome conflicts. Clonal or hemiclonal reproduction is thus one way in which the low survivability resulting from genome heterogeneity can be avoided in hybridizing organisms (Burt & Trivers, 2006; Jones & Pašakinskienė, 2005). However, hybridogenesis is very rare, occurring only when specific limitations imposed by genetic compatibility have been removed in conjunction with as yet unknown genetic factors. BC‐Hoc individuals can be discriminated from normal Hoc individuals, as the backcrosses possess genetic factors that are capable of inducing hybridogenesis. When fertile BC‐Hoc males mated with normal Hoc females, the progeny inherited the mtDNA haplotype of the normal Hoc. Consequently, a Hoc individual possessing specific genetic factors capable of inducing hybridogenesis (carrier) is considered to have altered the mtDNA haplotype. Moreover, when a carrier mates with a Hag male, a new hemiclone lineage will arise. Such hemiclone revival through host switching can increase the diversity of Hoc/Hag haplotypes, even if the mutation facilitating hybridogenesis may have occurred only once. Multiple haplotype revival through host switching from a single mutation in hybrids is another possible hypothesis for the observed mixing of Hoc/Hag haplotypes within the mtDNA genealogical tree.

Figure 4.

Figure 4

Open in a new tab

Results for hybridizations occurring among three Hexagrammos species and two hemiclonal hybrids. Uppercase letters superimposed on fish represent the genomes of each species, with asterisks indicating that the genome possesses the genetic factor responsible for inducing hybridogenesis. (A and B) Represent a normal backcross of hemiclonal hybrids. (C) Represents hybridization between Hoc and Hag. The F1 offspring (Hoc × Hag) produce gametes that have undergone recombination, but the descendants of the F1 offspring will disappear because genetic introgression among the parental species via two hybrid populations does not occur (Kimura‐Kawaguchi et al., 2014). (D) Represents host switching, which generated Hoc/Hot. The rectangle contains hybridization events that have not yet been observed. When a Hoc/Hag hybrid mates with a male of the maternal species, the offspring (backcrossed Hoc) become Hoc (carriers). After several generations, if these carriers mate with Hag, the offspring may produce a new hybridogenetic strain

High levels of mtDNA diversity were also found in P. monacha‐lucida (Quattro, Avise, & Vrijenhoek, 1991, 1992). In the Poeciliopsis complex, involvement of host switching through a third species (P. viriosa) appeared to generate new hemiclonal lineages (Mateos & Vrijenhoek, 2002). However, Schultz (1973) demonstrated that it was very difficult to reproduce such a clonal reproductive lineage by artificial hybridization between parental species. The intact genome of the maternal species is transferred into haploid eggs and the genome of the paternal species is eliminated. However, this means that at least two extraordinary steps must occur during oogenesis: elimination of the paternal genome and duplication of the maternal genome (Ogielska, 1994, 2009; Tunner & Heppich‐Tunner, 1991; Vinogradov, Borkin, Gunther, & Rosanov, 1990). Some of the genetic factors required for inducing hybridogenesis may be located at different loci and distributed on different chromosomes during recombination in BC‐Hoc. It is thus likely that only when a Hoc genome bearing the correct set of genetic factors hybridizes with a Hag genome, a new hemiclone lineage can possibly arise.

4.3. Improving longevity through host switching in hemiclones

In organisms that employ unisexual reproduction, individuals can produce offspring without any genetic contribution from males, and no male offspring are produced. As a result, once they arise, unisexual species are considered to be at an advantage when colonizing new habitats or when competing with sexually reproducing organisms (Avise, 2008). This theory is illustrated by the rapid expansion of Branch I in which hap 1 was dominant (17 of 31 Hoc/Hag and 37 of 38 Hoc/Hot). Within the context of the long‐term survival of a population or species, unisexual species must mitigate the risks posed by the accumulation of deleterious mutations (Kondrashov, 1988; Welch & Meselson 2000). In hybridogenesis, the genome derived from the paternal species is renewed every generation and genetic variation is maintained; in this respect, it is different from gynogenesis in which an entire genome set is inherited by offspring. In addition, gametes are produced through recombination in sexually reproducing organisms, but not in hemiclonal systems when homologous genomes are combined. This is another advantage of hybridogenesis. Deleterious mutations that have accumulated in a hemiclone can be dispersed by recombination in carriers. Such purging of deleterious mutations is possible when hybridogens coexist with maternal species. This episodic host switching ensures that the longevity of the hemiclone lineage is improved by increasing genetic variability, provided that the maternal species continues to inhabit the hybrid zone or occurs in adjacent habitats. When did the genetic factors inducing hybridogenesis come into existence? The paternal species Hot and Hag diverged sympatrically approximately 1.2–2.0 million years ago (Crow, Munehara, & Bernardi, 2010). The mutations producing these genetic factors may possibly have arisen before speciation.

Funding Information

This work was supported by Grants‐in‐Aid (Nos. 23380107, 26292098 and 15H02457) for Scientific Research from the Japan Society for the Promotion of Science, Japan.

Conflict of Interest

None declared.

Data Accessibility

Accession numbers (DDBJ) of the mtDNA sequences and the genotypes of microsatellite DNA data for specimens used in this study are shown in Table S1 and Table 4, respectively. Morphological data for specimens are provided in the supporting information for Kimura‐Kawaguchi et al. (2014).

Supporting information

 

Click here for additional data file. (45.2KB, xlsx)

Acknowledgments

We appreciate the critical advice offered by Dr. KD Crow. We also thank an anonymous consultant at Forte Inc. for proofreading the manuscript, Mr. K. Togashi for DNA sequencing of the outgroup fishes, the Usujiri Fishermen's cooperative for permission of fish collection, and the staff of the Usujiri Fisheries Station at Hokkaido University for their cooperation. This work was supported by Grants‐in‐Aid (No. 23380107, No. 26292098 and No. 15H02457) for Scientific Research from the Japan Society for the Promotion of Science, Japan.

References

  1. Alves, M. , Coelho, M. M. , Collares‐Pereira, M. J. , & Dowling, T. E. (1997). Maternal ancestry of the Rutilus alburnoides complex (Teleostei, Cyprinidae) as determined by analysis of cytochrome b sequence. Evolution, 51, 1584–1592. [DOI] [PubMed] [Google Scholar]
  2. Arano, B. , Llorente, G. A. , Herrero, P. , & Sanchiz, B. (1995). Current studies on Iberian water frogs. Zoologica Poloniae, 39, 365–375. [Google Scholar]
  3. Avise, J. C. (2008). Clonality: The genetics, ecology, and evolution of sexual abstinence in vertebrate animals. New York, NY and London, UK: Oxford University Press. [Google Scholar]
  4. Barton, N. H. , & Hewitt, G. M. (1989). Adaptation, speciation and hybrid zone. Nature, 341, 497–503. [DOI] [PubMed] [Google Scholar]
  5. Bell, G. (1982). The masterpiece of nature: The evolution and genetics of sexuality. London, UK and Canberra, Australia: Croom Helm. [Google Scholar]
  6. Bengtsson, B. O. (2009). Asex and evolution: A very large‐scale overview In Schön I., Martens K. & Dijk P. V. (Eds.), Lost sex the evolutionary biology of parthenogenesis (pp. 1–20). Dordrecht Heidelberg London, UK & New York, NY: Springer. [Google Scholar]
  7. Brykov, V. A. , & Podlesnykh, A. V. (2001). Comparison of mitochondrial DNA in two greenling species and their hybrids (CEM. Hexagrammidae: Pisces) from Peter the Great Bay (Sea of Japan). Genetika, 37, 1663–1666. [PubMed] [Google Scholar]
  8. Burt, A. , & Trivers, R. (2006). Genes in conflict: The biology of selfish genetic elements. Cambridge, UK: Belknap Press of Harvard University Press. [Google Scholar]
  9. Carmona, J. A. , Sanjur, O. I. , Doadrio, I. , Machordom, A. , & Vrijenhoek, R. C. (1997). Hybridogenetic reproduction and maternal ancestry of polyploid Iberian fish: The tropidophoxinellus alburnoides complex. Genetics, 146, 983–993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Choleva, L. , Apostolou, A. , Rab, P. , & Janko, K. (2008). Making it on their own: Sperm‐dependent hybrid fishes (Cobitis) switch the sexual hosts and expand beyond the ranges of their original sperm donors. Philosophical Transactions of the Royal Society B, 363, 2911–2919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Choleva, L. , Janko, K. , De Gelas, K. , Bohlen, J. , Šlechtová, V. , Rábová, M. , & Ráb, P . (2012). Synthesis of clonality and polyploidy in vertebrate animals by hybridization between two sexual species. Evolution, 66, 2191–2203. [DOI] [PubMed] [Google Scholar]
  12. Cimino, M. C. (1972). Meiosis in triploid all‐female fish (Poeciliopsis, Poeciliidae). Science, 175, 1484–1486. [DOI] [PubMed] [Google Scholar]
  13. Cimino, M. C. , & Schultz, R. J. (1970). Production of a diploid male offspring by a gynogenesis triploid fish of the genus Poeciliopsis . Copeia, 4, 760–763. [Google Scholar]
  14. Clement, M. , Posada, D. , & Cradell, K. (2000). TCS: A computer program to estimate gene genealogies. Molecular Ecology, 9, 1657–1659. [DOI] [PubMed] [Google Scholar]
  15. Coyne, J. A. , & Orr, H. A. (2004). Speciation. Sunderland, MA: Sinauer Associates Inc. [Google Scholar]
  16. Crow, K. D. , KAnamoto, Z. , & Bernardi, G. (2004). Molecular phylogeny of the Hexagrammid fishes using a multi‐locus approach. Molecular Phylogenetics and Evolution, 32, 986–997. [DOI] [PubMed] [Google Scholar]
  17. Crow, K. D. , Munehara, H. , & Bernardi, G. (2010). Sympatric speciation in a genus of marine reef fishes. Molecular Ecology, 19, 2089–2105. [DOI] [PubMed] [Google Scholar]
  18. Crow, K. D. , Munehara, H. , Kanamoto, Z. , Balanov, A. , Antonenko, D. , & Bernardi, G . (2007). Maintenance of species boundaries despite rampant hybridization between three species of reef fish (Hexagrammidae): Implications for the role of selection. Biological Journal of Linnean Society, 91, 135–147. [Google Scholar]
  19. Cunha, C. , Coelho, M. M. , Carmona, J. A. , & Doadrio, I. (2004). Phylogeographical insights into the origins of the Squalius alburnoides complex via multiple hybridization events. Molecular Ecology, 13, 2807–2817. [DOI] [PubMed] [Google Scholar]
  20. Dawley, R. M. (1989). An introduction to unisexual vertebrates In Dawley R. M. & Bogart J. P. (Eds.), Evolution and ecology of unisexual vertebrates (pp. 1–18). Albany, NY and New York, NY: New York State Museum. [Google Scholar]
  21. Ellstrand, N. C. , Briggs, D. , Kaus, A. , Lubinsky, P. , McDade, L. A. , Preston, K. , Prince, L. M. , Regan, H. M. , Rorive, V. , Ryder, O. A. , & Schierenbeck, K. A . (2010). Got hybridization? A multidisciplinary approach for informing science policy. BioScience, 60, 384–388. [Google Scholar]
  22. Felsenstein, J. (1985). Confidence‐limits on phylogenies: An approach using the bootstrap. Evolution, 39, 783–791. [DOI] [PubMed] [Google Scholar]
  23. Graf, J. D. & Pelaz, M. P. (1989). Evolutionary genetics of the Rana esculenta complex In Dawley R. M. & Bogart J. P. (Eds.), Evolution and ecology of unisexual vertebrates (pp. 289–301). New York, NY: New York State Museum. [Google Scholar]
  24. Guichoux, E. , Lagache, L. , Wagner, S. , Chaumeil, P. , Léger, P. , Lepais, O. , Lepoittevin, C. , Malausa, T. , Revardel, E. , Salin, F. , & Petit, R. J . (2011). Current trends in microsatellite genotyping. Molecular Ecology Resources, 11, 591–611. [DOI] [PubMed] [Google Scholar]
  25. Hedges, S. B. , Bogart, J. P. , & Maxon, L. R. (1992). Ancestry of unisexual salamanders. Nature, 356, 708–710. [DOI] [PubMed] [Google Scholar]
  26. Higgins, D. , Thompson, J. , & Gibson, T. (1994). CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Research, 22, 4673–4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hubbs, C. L. , & Hubbs, L. C. (1932). Apparent parthenogenesis in nature, in a form of fish of hybrid origin. Science, 76, 628–630. [DOI] [PubMed] [Google Scholar]
  28. Itono, M. , Morishima, K. , Fujimoto, T. , Bando, E. , Yamaha, E. , & Arai, K . (2006). Premeiotic endomitosis produces diploid eggs in the natural clone loach, Misgurnus anguillicaudatus (Teleostei: Cobitidae). Journal of Experimental Zoology Part A: Comparative Experimental Biology, 305, 513–523. [DOI] [PubMed] [Google Scholar]
  29. Janko, K. , Bohlen, J. , Lamatsch, D. , Flajšhans, M. , Epplen, J. T. , Ráb, P. , Kotlík, P. , & Šlechtová, V . (2007). The gynogenetic reproduction of diploid and triploid hybrid spined loaches (Cobitis: Teleostei), and their ability to establish successful clonal lineages on the evolution of polyploidy in asexual vertebrates. Genetica, 131, 185–194. [DOI] [PubMed] [Google Scholar]
  30. Janko, K. , Culling, M. A. , Ráb, P. , & Kotlík, P. (2005). Ice age cloning – comparison of the Quaternary evolutionary histories of sexual and clonal forms of spiny loaches (Cobitis; Teleostei) using the analysis of mitochondrial DNA variation. Molecular Ecology, 14, 2991–3004. [DOI] [PubMed] [Google Scholar]
  31. Jones, N. , & Pašakinskienė, I. (2005). Genome conflict in the Gramineae. New Phytologist, 165, 391–409. [DOI] [PubMed] [Google Scholar]
  32. Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111–120. [DOI] [PubMed] [Google Scholar]
  33. Kimura, R. M. , & Munehara, H. (2010). The disruption of habitat isolation among three Hexagrammos species by artificial habitat alternations that create mosaic‐habitat. Ecological Research, 25, 41–50. [Google Scholar]
  34. Kimura, R. M. , & Munehara, H. (2011). Spawning substrata are important for breeding habitat selection but do not determine premating reproductive isolation in three sympatric Hexagrammos species. Journal of Fish Biology, 78, 112–126. [DOI] [PubMed] [Google Scholar]
  35. Kimura, M. , Yanagimoto, T. , & Munehara, H. (2007). Maternal identification of hybrid eggs in Hexagrammos spp. by means of multiplex amplified product length polymorphism of mitochondrial DNA. Aquatic Biology, 1, 187–194. [Google Scholar]
  36. Kimura‐Kawaguchi, M. , Horita, M. , Abe, S. , Arai, K. , Kawata, M. , & Munehara, H . (2014). Identification of hemi‐clonal reproduction in three species of Hexagrammos marine reef fishes. Journal of Fish Biology, 85, 189–209. [DOI] [PubMed] [Google Scholar]
  37. Kondrashov, A. S. (1988). Deleterious mutations and the evolution of sexual reproduction. Nature, 336, 435–440. [DOI] [PubMed] [Google Scholar]
  38. Kvarnemo, C. , & Simmons, L. W. (2013). Polyandry as a mediator of sexual selection before and after mating. Philosophical Transactions of the Royal Society, 368, 2012–2042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lamatsch, D. K. , Nanda, I. , Schlupp, I. , Epplen, J. T. , & Schmid, M. (2004). Distribution and stability of supernumerary microchromosomes on natural populations of the Amazon molly, Poecilia formosa . Cytogenet Genome Resources, 106, 189–194. [DOI] [PubMed] [Google Scholar]
  40. Lamatsch, D. K. , & Stöck, M. (2009). The evolutionary biology of parthenogenesis In Schön I., Martens K. & Dijk P. V. (Eds.), Lost sex the evolutionary biology of parthenogenesis (pp. 399–432). Dordrecht Heidelberg London, UK and New York, NY: Springer. [Google Scholar]
  41. Lampert, M. P. , & Schartl, M. (2008). The origin and evolution of a unisexual hybrid: Poecilia formosa . Philosophical Transactions of the Royal Society B, 363, 2901–2909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Lehtonen, J. , Schmidt, D. J. , Heubel, K. , & Kokko, H. (2013). Evolutionary and ecological implications of sexual parasitism. Trends in Ecology & Evolution, 28, 297–306. [DOI] [PubMed] [Google Scholar]
  43. Loewe, L. , & Lamatsch, D. K. (2008). Quantifying the threat if extinction from Muller's ratchet in the diploid Amazon molly (Poecilia formosa). BMC Evolutional Biology, 8, 88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Lynch, M. , & Gabriel, W. (1990). Mutation load and the survival of small populations. Evolution, 44, 1725–1737. [DOI] [PubMed] [Google Scholar]
  45. Maan, M. E. , & Seehausen, O. (2011). Ecology, sexual selection and speciation. Ecology Letters, 14, 591–602. [DOI] [PubMed] [Google Scholar]
  46. Mateos, M. , & Vrijenhoek, R. C. (2002). Ancient versus reticulate origin of a hemiclonal lineage. Evolution, 56, 985–992. [DOI] [PubMed] [Google Scholar]
  47. Mateos, M. , & Vrijenhoek, R. C. (2005). Independent origin of allotriploidy in the fish genus Poeciliopsis . Journal of Heredity, 96, 1–8. [DOI] [PubMed] [Google Scholar]
  48. Maynard Smith, J. (1978). The evolution of sex. Cambridge, UK: Cambridge University Press. [Google Scholar]
  49. Maynard Smith, J. (1986). Contemplating life without sex. Nature, 324, 300–301. [DOI] [PubMed] [Google Scholar]
  50. Maynard Smith, J. (1992). Age and the unisexual lineage. Nature, 356, 661–662. [Google Scholar]
  51. Meyer, A. , Kocher, T. D. , Basasibwaki, B. , & Wilson, A. C. (1990). Monophyletic origin of Lake Victoria cichlid fishes suggested by mitochondrial‐DNA sequences. Nature, 347, 550–553. [DOI] [PubMed] [Google Scholar]
  52. Meyer, M. M. , Salzburger, W. , & Schartl, M. (2006). Hybrid origin of swordtail species (Teleostei: Xiphophorus clemenciae) driven by sexual selection. Molecular Ecology, 15, 721–730. [DOI] [PubMed] [Google Scholar]
  53. Munehara, H. , Kanamoto, Z. , & Miura, T. (2000). Spawning behavior and interspecific breeding in three Japanese greenlings (Hexagrammidae). Ichthyological Research, 47, 287–292. [Google Scholar]
  54. Munehara, H. , Takenaka, A. , & Takenaka, O. (2000). Microsatellite markers and multiple paternity in a paternal care fish, Hexagrammos otakii . Journal of Ethology, 18, 101–104. [Google Scholar]
  55. Nakabo, T. (2000). Fishes of Japan with pictorial keys to the species (2nd ed.). Tokyo, Japan: Tokai University Press. [Google Scholar]
  56. Neiman, M. , & Koskella, B. (2009). Sex and the red queen In Schön I., Martens K. & Dijk P. V. (Eds.), Lost sex the evolutionary biology of parthenogenesis (pp. 132–159). Dordrecht Heidelberg London, UK and New York, NY: Springer. [Google Scholar]
  57. Niemeitz, A. , Kreutzfeldt, R. , Schartl, M. , Pazefall, J. , & Schlupp, I. (2002). Male mating behavior of a molly, Poecilia latipunctata: A third host for the sperm‐Dependent Amazon molly, Poecilia formosa . Acta Ethology, 5, 45–49. [Google Scholar]
  58. Ogielska, M. (1994). Nucleus‐like bodies in gonial cells of Rana esculenta (Amphibia, Anura) Tadpoles—A putative way of chromosome elimination. Zoologica Poloniae, 39, 461–474. [Google Scholar]
  59. Ogielska, M. (2009). Development and reproduction of amphibian species, hybrids, and polyploids In Ogielska M. (Ed.), Reproduction of amphibians (pp. 343–410). Enfield, Jersey, Plymouth: Science Publishers. [Google Scholar]
  60. Ohno, S. (1970). Evolution by gene duplication. New York, NY: Springer Verlag. [Google Scholar]
  61. Quattro, J. M. , Avise, J. C. , & Vrijenhoek, R. C. (1991). Molecular evidence for multiple origins of hybridogenetic fish clones (Poeciliidae: Poeciliopsis). Genetica, 127, 391–398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Quattro, J. M. , Avise, J. C. , & Vrijenhoek, R. C. (1992). An ancient clonal lineage in the fish genus Poeciliopsis (Atheriniformes: Poeciliidae). Proceedings of the National Academy of Sciences the United States of America, 89, 348–352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Rice, W. R. , & Friberg, U. (2009). A graphical approach to lineage selection between In Schön I., Martens K. & Dijk P. V. (Eds.), Lost sex the evolutionary biology of parthenogenesis (pp. 75–98). Dordrecht Heidelberg London, UK and New York, NY: Springer. [Google Scholar]
  64. Saitou, N. , & Nei, M. (1987). The neighbor‐joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4, 406–425. [DOI] [PubMed] [Google Scholar]
  65. Scali, V. (2009). Metasexual stick insects: Model pathways to losing sex and bringing it back In Schön I., Martens K. & Dijk P. V. (Eds.), Lost sex the evolutionary biology of parthenogenesis (pp. 317–346). Dordrecht Heidelberg London, UK and New York, NY: Springer. [Google Scholar]
  66. Schartl, M. , Nanda, I. , Schlupp, I. , Wilde, B. , Epplen, J. T. , Schmid, M. , & Parzefall, J . (1995). Incorporation of subgenomic amounts of DNA as compensation for mutational load in a gynogenetic fish. Nature, 373, 68–71. [Google Scholar]
  67. Schartl, M. , Wilde, B. , Schlupp, I. , & Parzefall, J. (1995). Evolutionary origin of a parthenoform, the Amazon molly Pecilia formosa, on the basis of a molecular genealogy. Evolution, 49, 827–835. [DOI] [PubMed] [Google Scholar]
  68. Schlupp, I. , Parzefall, J. , & Schartl, M. (2002). Biogeography of the Amazon molly, Poecilia formosa . Journal of Biogeography, 29, 1–6. [Google Scholar]
  69. Schmidt, D. J. , Bond, N. R. , Adams, M. , & Hughes, J. M. (2011). Cytonuclear evidence for hybridogenetic reproduction in natural populations of the Australian carp gudgeon (Hypseleotris: Eleotridae). Molecular Ecology, 20, 3367–3380. [DOI] [PubMed] [Google Scholar]
  70. Schultz, R. J. (1969). Hybridization, unisexually, and polyploidy in the teleost Poeciliopsis (Poeciliidae) and other vertebrates. American Naturalist, 103, 605–619. [Google Scholar]
  71. Schultz, R. J. (1973). Unisexual fish: Laboratory synthesis of a “species”. Science, 179, 180–181. [DOI] [PubMed] [Google Scholar]
  72. Shinohara, G. (1994). Comparative morphology and phylogeny of the suborder Hexagrammoidei and related taxa (Pisces: Scorpaeniformes). Memoirs of the Faculty of Fisheries Hokkaido University, 41, 1–97. [Google Scholar]
  73. Sousa‐Santos, C. , Collares‐Pereira, M. J. , & Almada, V. C. (2006). Evidence of extensive mitochondrial introgression with nearly complete substitution of the typical Squalius pyrenaicus‐like mtDNA of the Squalius alburnoides complex (Cyprinidae) in an independent Iberian drainage. Journal of Fish Biology, 68(B), 292–301. [Google Scholar]
  74. Spolsky, C. , Phillips, C. A. , & Uzzell, T. (1992). Gynogenetic reproduction in hybrid mole salamanders (genus Ambystoma). Evolution, 46, 1935–1944. [DOI] [PubMed] [Google Scholar]
  75. Stamatakis, A. (2006). RAxML‐VI‐HPC: Maximum likelihood‐based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690. [DOI] [PubMed] [Google Scholar]
  76. Stöck, M. , Lampert, K. P. , Möller, D. , Schlupp, I. , & Schartl, M. (2010). Monophyletic origin of multiple clonal lineages in an asexual fish (Poecilia formosa). Molecular Ecology, 19, 5204–5215. [DOI] [PubMed] [Google Scholar]
  77. Tamura, K. , Stecher, G. , Peterson, D. , Filipski, A. , & Kumar, S. (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30, 2725–2729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Tanabe, A. S. (2011). Kakusan4 and Aminosan: Two programs for comparing nonpartitioned, proportional and separate models for combined molecular phylogenetic analyses of multilocus sequence data. Molecular Ecology Resources, 11, 914–921. [DOI] [PubMed] [Google Scholar]
  79. Tunner, H. G. , & Heppich‐Tunner, S. (1991). Genome exclusion and two strategies of chromosome duplication in oogenesis of a hybrid frog. Naturwissenschaften, 78, 32–34. [Google Scholar]
  80. Uzzell, T. M. , & Berger, L. (1975). Electrophoretic phenotypes of Rana lessonae, Rana ridibunda, and their hybridogenetic associate Rana esculenta . Proceedings of the National Academy of Sciences the United States of America, 127, 13–24. [Google Scholar]
  81. Vinogradov, A. E. , Borkin, L. J. , Gunther, R. , & Rosanov, J. M. (1990). Genome elimination in diploid and triploid Rana esculentus males: Cytological evidence from DNA flow cytometry. Genome, 33, 619–627. [DOI] [PubMed] [Google Scholar]
  82. Volff, J. N. (2005). Genome evolution and biodiversity in teleost fish. Heredity, 94, 280–294. [DOI] [PubMed] [Google Scholar]
  83. Vrijenhoek, R. C. (1994). Unisexual fish: Model systems for studying ecology and evolution. Annual Review of Ecology and Systematics, 25, 71–96. [Google Scholar]
  84. Vrijenhoek, R. C. , Angus, R. A. , & Schultz, R. J. (1977). Variation and heterozygosity in sexually vs. clonally reproducing populations of Poeciliopsis . Evolution, 31, 767–781. [DOI] [PubMed] [Google Scholar]
  85. Vrijenhoek, R. C. , Dawley, R. M. , Cole, C. J. , & Bogart, J. B. (1989). A list of the known unisexual vertebrates In Dawley R. M. & Bogart J. B. (Eds.), Evolution and ecology of unisexual vertebrates (pp. 19–23). Albany, NY and New York, NY: New York State Museum. [Google Scholar]
  86. Ward, R. D. , Zemlak, T. S. , Innes, B. H. , Last, P. R. , & Hebert, P. D. N. (2005). DNA barcoding Australia's fish species. Philosophical Transactions of the Royal Society, 360, 1847–1857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Welch, D. M. , & Meselson, M. (2000). Evidence for the evolution of Bdelloid rotifers without sexual reproduction or genetic exchange. Science, 288, 1211–1215. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 

Click here for additional data file. (45.2KB, xlsx)

Data Availability Statement

Accession numbers (DDBJ) of the mtDNA sequences and the genotypes of microsatellite DNA data for specimens used in this study are shown in Table S1 and Table 4, respectively. Morphological data for specimens are provided in the supporting information for Kimura‐Kawaguchi et al. (2014).

Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES