Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2017 Jun 21;174(15):2501–2511. doi: 10.1111/bph.13860

Stimulation of autophagy prevents intestinal mucosal inflammation and ameliorates murine colitis

Dulce C Macias‐Ceja 1, Jesús Cosín‐Roger 2, Dolores Ortiz‐Masiá 2,3, Pedro Salvador 2, Carlos Hernández 1,2, Juan V Esplugues 1,2, Sara Calatayud 2, María D Barrachina 2,✉
PMCID: PMC5513861  PMID: 28500644

Abstract

Background and Purpose

Defective autophagy contributes to the pathogenesis of inflammatory disorders such as inflammatory bowel disease and there are interactions between autophagy and inflammation. Here we have analysed the effects of autophagy stimulators on murine colitis.

Experimental Approach

Mice were treated with intrarectal administration of 2,4,6‐trinitrobenzenesulfonic acid (TNBS) (3.5 mg·20 g−1) and body weight was measured daily. Histological damage was scored 2 or 4 days after treatment. Some mice received trehalose (3% in drinking water 3 weeks before TNBS administration) or a daily administration of rapamycin (1.25 mg·kg−1, i.p.), betanin (1 g·kg−1, i.p.) or betanin + 3‐methyladenine (3MA) (10 mg·kg−1, i.p.). Protein levels of p‐mTOR, p62, LC3, BCL10, NFκB, IκBα and p‐IκBα in mucosa were determined by Western blots and mRNA expression of TNFα, IL1β, IL6, IL10, COX2, CCR7, CD11c, inducible NOS and CD86 by qRT‐PCR.

Key Results

Impaired autophagy associated with body weight loss and intestinal damage was detected in the mucosa of TNBS‐treated mice. Administration of trehalose, rapamycin or betanin prevented the impaired autophagic flux induced by TNBS and decreased mucosal protein levels of BCL10, p‐IκBα and NFκB‐p65 and the expression of pro‐inflammatory cytokines and M1 macrophage markers. Blockade of autophagosome formation by treatment with 3MA, prevented the reduction in protein levels of p62, BCL10, p‐IκBα and NFκB‐p65 induced by betanin in TNBS‐treated mice and weakened the protective effects of betanin on murine colitis.

Conclusions and Implications

Pharmacological stimulation of mucosal autophagy reduced intestinal inflammation and improved murine colitis.

Abbreviations

3MA

3‐methyladenine

IBD

inflammatory bowel disease

TBS‐T

Tris buffered saline with Tween

TNBS

2,4,6‐trinitrobenzenesulfonic acid

Tables of Links

TARGETS
Enzymes
mTOR
LIGANDS
Rapamycin
Betanin
Open in a new tab

These Tables list key protein targets and ligands in this article that are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Southan et al., 2016), and are permanently archived in the Concise Guide to PHARMACOLOGY 2015/16 (Alexander et al., 2015).

Introduction

Inflammatory bowel disease (IBD) is a relapsing chronic disorder of the gastrointestinal tract characterized by disruption of epithelial barrier function and chronic inflammation of the mucosa (Maloy and Powrie, 2011). Current pharmacological treatment, rather than providing a cure, is limited to increasing the duration of clinical remission periods and slowing down the destructive and progressive course of the disease. This has emphasized the need for a better understanding of the etiology and pathogenesis of IBD. Recent genome‐wide association studies have revealed that polymorphisms in genes regulating autophagy constitute risk factors for IBD. (Fritz et al., 2011; Khor et al., 2011; Lees et al., 2011; Hooper et al., 2017).

Autophagy is an intracellular degradation pathway that regulates the turnover of cellular proteins and organelles and plays an essential role in cellular homeostasis. It is also induced in stress situations such as starvation, hypoxia and reticular stress that results in accumulation of damaged cytosolic components (Klionsky et al., 2016). This process starts with the formation of the phagophore which engulfs a portion of the cytoplasm that contains the cargo to be degraded and closes off to form the autophagosome which is fused with the lysosomes and cargo, and it is degraded by the lysosomal hydrolases. In the intestine, autophagy has been reported to mediate critical functions in innate and adaptive immunity, such as antigen presentation by dendritic cells, cytokine secretion by macrophages and antimicrobial peptide secretion by Paneth cells (Baxt and Xavier, 2015). In the last few years, evidence has emerged for crosstalk between autophagy and inflammation (Crisan et al., 2011; Nakahira et al., 2011; Lapaquette et al., 2015; Netea‐Maier et al., 2016). Autophagy modulates the inflammatory response through several mechanisms, including the selective degradation of both pro‐inflammatory complexes, such as the NF‐κB essential modulator complex (NEMO) or BCL10 (Shibata et al., 2012; Chang et al., 2013) or inflammasome stimuli, such as mitochondrial ROS or mitochondrial DNA (Saitoh et al., 2008; Nakahira et al., 2011). On the other hand, autophagy is induced during inflammation by the activation of toll‐like receptors and NOD‐like receptors, by damage‐associated molecular patterns and by several pro‐inflammatory cytokines with the main aim of controlling infection as part of the host response to microbial invasion. However, high levels of these cytokines or ROS, generated in response to damage, can actually disrupt the signalling needed to control autophagy (Dodson et al., 2013).

We have recently demonstrated that autophagic flux is impaired in the damaged mucosa of IBD patients, compared with non‐damaged mucosa which suggests that, in addition to genetic components, inflammation is regulating this process (Ortiz‐Masia et al., 2014). We aim to analyse here the role that stimulation of mucosal autophagy plays in 2,4,6‐trinitrobenzenesulfonic acid (TNBS)‐induced colitis and the mechanisms involved in the regulation of this process. We have used rapamycin, an mTOR‐dependent stimulator of autophagy (Ravikumar et al., 2004) and trehalose, an mTOR‐independent activator of autophagy (Sarkar et al., 2007). In addition, we have also analysed the effects of betanin, a natural pigment that belongs to the betalain group of highly bioavailable antioxidants which has recently been shown to attenuate oxidative stress (Tan et al., 2015) and to modulate autophagy in human breast cancer lines (Nowacki et al., 2015). Our results show that, in mice, activation of mucosal autophagy ameliorates colitis through the inhibition of inflammation.

Methods

Animals

All animal care and experimental protocols were approved by the institutional animal care and use committees of the University of Valencia and in compliance with the European Animal Research Laws (European Communities Council Directives 2010/63/EU, 90/219/EEC, Regulation (EC) No. 1946/2003) and Generalitat Valenciana (articulo 31, real Decreto 53/2013). Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010; McGrath and Lilley, 2015). Male and females Balb/cJ mice (9–12 weeks old, 20–25 g weight, Jackson Labs.) were housed in stainless steel cages in a room kept at 22 ± 1 °C with a 12 h light, 12 h dark cycle and had free access to food and water. Care conditions were adapted to facilitate access of the animals to food and water ad libitum during the experiments.

Induction of colitis and pharmacological treatment

Colitis was induced in Balb/cJ mice with intrarectal administration of 100 μL of TNBS (3.5 mg·20 g−1 Sigma Aldrich, Madrid, Spain) dissolved in 40% aqueous ethanol. TNBS‐induced colitis represents a standardized model that closely resembles the histopathological lesions that develop in Crohn's disease in humans (Antoniou et al., 2016). Mice were anaesthetised (isoflurane 2%) and a 16G catheter introduced 3 cm from the anus, as previously described (Cosin‐Roger et al., 2016). Vehicle‐treated mice received NaCl (0.9% in 40% ethanol). Body weight was monitored daily and mice were killed by cervical dislocation, 2 or 4 days after TNBS administration. The length of the colon was measured, and colon tissue was frozen for protein and RNA extraction. One group of mice received trehalose (3% in drinking water 3 weeks before TNBS administration until the end of the experiment; Li et al., 2015; Acros Organics, Madrid, Spain). Other groups received rapamycin (1.25 mg·kg−1, i.p.; Puighermanal et al., 2009 kindly provided by Pfizer (Wayne, PA, USA)) or betanin (1 g·kg−1, i.p.; this dose was chosen from a previous dose–response curve, Sigma Aldrich, Madrid, Spain) once daily from the day of TNBS administration until the end of the experiment. Another group of mice, in addition to betanin, received an inhibitor of autophagosome formation, 3‐methyladenine (3MA, 10 mg·kg−1, i.p., daily, Sigma Aldrich, Madrid, Spain), from 2 days before TNBS until the end of the experiment. In all cases, animals were randomly distributed to the different treatment groups.

Histological studies

Histological analysis was performed on colon samples fixed and embedded in paraffin, sectioned (5 μm) and stained with haematoxylin. Histological damage was measured on a scale 0 to 10 taking into account the degree of inflammation, the presence of erosion, ulceration or necrosis and the depth and surface extension of lesions, as previously described (Ameho et al., 1997).

Immunohistochemistry

The colon tissue was fixed, embedded in paraffin, and sectioned (5 μm) as previously described (Hernandez et al., 2009). After deparaffinization and rehydration, paraffin sections were rinsed in TBS‐T (composition; 20 mM Tris HCl pH 7.2, 150 mM NaCl and 0.1% Tween 20) and incubated at 95°C for 20 min in citrate buffer (pH 6) for antigen de‐masking. Then, sections were treated for 15 min with 3% H2O2 in H2O miliQ to quench endogenous peroxidase and washed in TBS‐T. After blocking with 5% normal goat serum, sections were incubated with rabbit p62 (SQSTMI) primary antibody (1:1000; PM045; MBL, International Corporation, Madrid, Spain) overnight at 4°C in a humidified chamber. Stained sections were then washed in TBS‐T, incubated with HRP‐conjugated goat‐α‐rabbit secondary antibody (1:200; 31 460; Thermo Scientific, Rockford, IL) for 1 h at room temperature and were rinsed in TBS‐T. Positive cells were visualized by treatment with diaminobenzidine (DAB; Sigma Chemical Co, Madrid, Spain). Samples were counterstained with haematoxylin, and the specificity of the immunostaining was confirmed by the absence of signal when primary antibodies were omitted. Images were obtained using a light microscope (1X81 Olympus) and cellR software v2.8.

Protein extraction and Western blots

Equal amounts of protein from colonic tissues were loaded onto SDS‐PAGE gels (Zhang et al., 2015). After electrophoresis and transference, membranes were blocked with 5% non‐fat dry milk in TBS‐T or BSA (for phosphorylated antibodies) and incubated overnight at 4°C with different primary antibodies (Table 1). Subsequently, membranes were incubated with a secondary antibody anti‐mouse IgG (Thermo Scientific, Rockford, IL, 1: 2500) or anti‐rabbit IgG (Thermo Scientific, 1: 5000). Protein bands were detected by LAS‐300 (Fujifilm, Barcelona, Spain) after treatment with SuperSignal West Pico Chemiluminescent substrate (Thermo Scientific) and quantified by means of densitometry with the software Image Gauge Version 4.0 (Fujifilm). Results were normalized to β‐actin for total and cytoplasm proteins or nucleolin for nuclear proteins to control for unwanted sources of variation (Impellizzeri et al., 2015).

Table 1.

Primary antibodies used in Western blots

Antibody Dilution
Autophagy
p‐mTOR (Ser 2448) (Santa Cruz Biotechnology) 1:1000
p62 (Santa Cruz Biotechnology) 1:1000
LC3 (Sigma‐Aldrich) 1:2000
Inflammation
BCl‐10 (Santa Cruz Biotechnology) 1:1000
IκBα (Santa Cruz Biotechnology) 1:1000
p‐IκBα (Cell Signaling) 1:1000
NF‐κB (Invitrogen, Novex by Life Technologies) 1:250
β‐actin (Sigma‐Aldrich) 1:5000
Nucleolin (Sigma‐Aldrich) 1:1500
Open in a new tab

RNA extraction and qPCR analysis

RNA extraction was performed using Tripure Isolation reagent (Roche, Barcelona, Spain). Briefly, tissues were homogenized by Ultraturrax and RNA was separated with Clorophorm, precipitated with isopropanol, washed with ethanol 70% and re‐suspended in water. RNA of the cells was isolated with the extraction kit (Illustra RNAspin Mini, GE HealthCare Life Science, Barcelona, Spain). After quantification with Nanodrop, 1 μg of RNA was used in order to perform the RT‐PCR with the Prime Script RT reagent Kit (Takara Biothecnology, Dalian, China). Quantitative PCR was performed with the Prime Script Reagent Kit Perfect Real Time (Takara Biotechnology, Saint‐Germain‐en‐Laye, France) in a thermo cycler Light Cycler (Roche Diagnostics, Mannheim, Germany). To control for unwanted sources of variation, results were expressed as fold increase calculated according as: change in expression (fold) = 2−Δ(ΔCT) where ΔCT = CT (target) − CT (housekeeping), and Δ(ΔCT) = ΔCT (treated) − ΔCT (control). β‐actin was used as the housekeeping gene (Ortiz‐Masia et al., 2012). Specific primers were designed according to the sequences present in Table 2.

Table 2.

Specific oligonucleotides used in quantitative PCR

Gene Sense Antisense
Inflammation
TNF‐α CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG
COX‐2 CCCGGACTGGATTCTATGGTG TTCGCAGGAAGGGGATGTTG
Cytokines
IL‐1β GAAATGCCACCTTTTGACAGTG CTGGATGCTCTCATCAGGACA
IL‐6 GAGTCCTTCAGAGAGATACAGAAAC TGGTCTTGGTCCTTAGCCAC
IL‐10 GGACAACATACTGCTAACCGAC CCTGGGGCATCACTTCTACC
M1 markers
CCR7 CTCTCCACCGCCTTTCCTG ACCTTTCCCCTACCTTTTTATTCCC
CD11C TCTTCTGCTGTTGGGGTTTG CAGTTGCCTGTGTGATAGCC
Inducible NOS CGCTTGGGTCTTGTTCACTC GGTCATCTTGTATTGTTGGGCTG
CD86 GCACGGACTTGAACAACCAG CCTTTGTAAATGGGCACGGC
β‐actin GCCAACCGTGAAAAGATGACC GAGGCATACAGGGACAGCAC
Open in a new tab

Data and statistical analysis

The data and statistical analysis, which were evaluated by a person blinded to the experimental conditions, comply with the recommendations on experimental design and analysis in pharmacology (Curtis et al., 2015). Data were expressed as mean ± SEM and group means were compared by one way‐ANOVA (in all cases, F achieved P < 0.05 and there was no significant variance inhomogeneity) with a Newman–Keuls post hoc correction for multiple comparisons or a t‐test when appropriate (Graph‐Pad Sotware 6.0). A P value <0.05 was considered to be statistically significant. For the analysis of the body weight changes during the entire experimental period we used two‐way ANOVA followed by Newman–Keuls multiple comparison test, setting as variables the treatment and the time.

Results

Autophagy is impaired in colon tissue of TNBS‐treated mice

We used an experimental mouse model of IBD, based on the intrarectal administration of TNBS. Administration of this sensitizing agent to mice induced a loss of body weight, an increase in the histological damage score and a decrease in colon length that peaked 2 days after treatment. Subsequently, mice began to recover and, at 4 days after TNBS, the body weight had returned to normal, i.e., that shown before TNBS administration (Figure 1A). The recovery of mucosal integrity was slower and 4 days after TNBS, the histological damage score was still higher than that observed in vehicle‐treated animals (Figure 1B). Analysis of protein levels of autophagic markers in the colon tissue of TNBS‐treated mice revealed lower levels of LC3II (the microtubule‐associated protein 1A/1B–light chain 3 that is recruited to autophagosomal membranes) and increased levels of p62 (an autophagosome cargo protein that targets other proteins that bind to it for selective autophagy), compared with those observed in the colon tissue of vehicle‐treated mice, 2 or 4 days after TNBS (Figure 1C–E). These changes were observed in parallel with high levels of phosphorylated mTOR (p‐mTOR), the main negative regulator of autophagy, 2 days after TNBS (Figure 1C) thus showing impaired autophagy in colon tissue of TNBS‐treated mice. This observation was reinforced by immuhistochemical studies performed in colon tissue that revealed increased immunostaining for p62 in the mucosa of TNBS‐treated mice compared with vehicle. As shown in Figure 1F, p62 expression was mainly located in epithelial cells at the apical side of the gland and infiltrated cells in the lamina propria.

Figure 1.

Figure 1

Open in a new tab

Betanin, rapamycin and trehalose stimulates mucosal autophagy and amilorates TNBS‐induced colitis. Mice were treated intrarectally with TNBS (3.5 mg·20 g−1) or vehicle and were killed 2 or 4 days after treatment. Groups of mice received a single administration of betanin (1 g·kg−1, i.p.,) or rapamycin (1.25 mg·kg−1, i.p), from the day of TNBS administration until the end of the experiment. Another group received trehalose (3% in drinking water), for 3 weeks before TNBS administration until the end of the experiment. Graphs show (A) body weight as a percentage of starting weight (to control for unwanted sources of variation), measured daily after TNBS administration (n = 10); (B) representative images and graphs showing histological score, analysed 2 and 4 days after treatment (n = 5); Effects of betanin (C), rapamycin (D) or trehalose (E) on p‐mTOR, p62, LC3 and β‐actin protein levels in the mucosa of vehicle or TNBS‐treated mice, as shown by representative Western blots and graphs (n = 5). (F) Representative images showing p62 immunostaining in the mucosa of mice receiving different treatments. Data shown are means ± SEM. *P < 0.05, significantly different from vehicle‐treated group; # P < 0.05, significantly different from the TNBS‐treated group.

Trehalose, rapamycin and betanin increase autophagy in murine colon tissue and ameliorate colitis

Administration of trehalose, rapamycin or betanin to TNBS‐treated mice significantly prevented the loss of body weight detected on day 2 and significantly reduced the histological damage score, 2 and 4 days after TNBS administration (Figure 1A, B). In all cases, the colon of TNBS‐treated mice that had been treated with these drugs exhibited a significant diminution in p62 protein levels, as analysed by both Western blot (Figure 1C–E) and immunohistochemistry (Figure 1F). Furthermore, a significant increase in LC3II expression was observed, 2 and 4 days after TNBS compared with levels detected in vehicle‐TNBS‐treated mice, which suggest that trehalose, rapamycin and betanin prevented the impaired autophagy induced by TNBS in the colon. In vehicle‐treated mice, these treatments did not significantly modify the body weight and histological score but treatment with rapamycin or trehalose induced a slight decrease of p62 protein levels and increased LC3II protein levels, suggesting a stimulatory effect on basal autophagy (Figure 1D, E).

Stimulators of autophagy decrease the expression of pro‐inflammatory cytokines and M1 markers in colon tissue of TNBS‐treated mice

Real time PCR demonstrated that local mRNA levels of M1 macrophage‐associated markers (CD11c, CD86, CCR7) and pro‐inflammatory cytokines (TNFα, COX‐2, IL‐1β, inducible NOS and IL‐6) were significantly higher in the colon tissue of TNBS‐treated mice than those observed in the colon tissue of vehicle‐treated mice, 2 and 4 days after treatment (Figure 2). Some of these genes (CCR7, CD11c, CD86, COX‐2 and IL6) peaked 2 days after TNBS and treatment with betanin significantly reduced their expression. Four days after TNBS, the expression of all these genes was significantly attenuated in mice that had received trehalose, rapamycin or betanin while the expression of the anti‐inflammatory cytokine IL‐10 was significantly increased. These treatments did not significantly modify levels of these genes in vehicle‐treated mice.

Figure 2.

Figure 2

Open in a new tab

Betanin, rapamycin and trehalose decrease the expression of pro‐inflammatory cytokines and M1 markers in colon tissue of TNBS‐treated mice. Mice were treated with TNBS (3.5 mg·20 g−1) or vehicle and were killed 2 or 4 days after treatment. Groups of mice received a single administration of betanin (1 g·kg−1, i.p.) or rapamycin (1.25 mg·kg−1, i.p.) from the day of TNBS administration until the end of the experiment; another group received trehalose (3% in drinking water) for 3 weeks before TNBS administration until the end of the experiment. Graphs show relative mRNA expression levels of pro‐inflammatory cytokines, M1 markers and IL‐10 in the colonic tissue compared with the housekeeping gene β‐actin. Data shown are fold induction compared with vehicle‐treated mice. Bars in graphs represent mean ± SEM of five animals per experimental group. *P < 0.05, significantly different from vehicle‐treated group; # P < 0.05, significantly different from the TNBS‐treated group.

Stimulators of autophagy decrease NF‐κB signalling in the colon of TNBS‐treated mice

To understand how autophagy stimulators modulate intestinal inflammation, we analysed the NF‐κB signalling pathway in the mucosa. Increased mucosal protein levels of cytosolic BCL10 (a pro‐inflammatory complex), p‐IκBα and nuclear NF‐κB were detected in TNBS‐treated mice, compared with vehicle‐treated mice, 2 and 4 days after treatment (Figure 3). In TNBS‐treated mice that received betanin, rapamycin or trehalose, protein levels of cytosolic BCL10 and p‐IκBα and nuclear NF‐κB were significantly lower than those detected in vehicle‐TNBS‐treated mice. These drugs did not significantly modify protein levels of BCL10, p‐IκBα and NF‐κB in vehicle‐treated mice (Figure 3).

Figure 3.

Figure 3

Open in a new tab

Autophagy stimulators reduce protein levels of cytosolic BCL10 and nuclear NFκBp65 in colon tissue of TNBS‐treated mice. Colitis was induced in mice by intrarectal TNBS, as described and mice were killed 2 or 4 days after TNBS. Treatment groups received rapamycin (1.25 mg·kg−1, i.p.) or betanin (1 g·kg−1, i.p.) or trehalose (3% in drinking water), as described. Representative Western blots and graphs showing BCL10, p‐IκBα, IκBα, NFκB, β‐actin and nucleolin protein levels in the mucosa of vehicle or TNBS‐treated mice receiving different treatments. Data shown are means ± SEM of five animals per experimental group. *P < 0.05, significantly different from vehicle‐treated group; # P < 0.05, significantly different from the TNBS‐treated group.

Stimulation of mucosal autophagy mediates the protective effects of betanin on colitis

To demonstrate that activation of autophagy is involved in the protective effects of betanin in our model of colitis, we treated mice with 3MA, an inhibitor of the formation of autophagosomes. The protective effects induced by betanin in terms of the loss of body weight (Figure 4A) and histological damage score (Figure 4B), 2 days after TNBS, were significantly blocked by treatment with 3MA suggesting that autophagy mediates the protective effects of betanin. In mice receiving only TNBS, the administration of 3MA did not significantly modify the loss of body weight and histological damage score 2 days after TNBS (Figure 4A, B). Of interest, the administration of 3MA to TNBS‐treated mice prevented the reduction in p‐mTOR, p62, BCL10, p‐IκBα and NF‐κB protein levels induced by betanin (Figure 4C) 2 days after TNBS, suggesting that the blockade of autophagy prevented the anti‐inflammatory effects induced by betanin. No significant changes in the body weight of mice receiving the different treatments were detected 4 days after TNBS administration (Figure 4D). At this time, both vehicle‐ or betanin‐treated mice that had received 3MA exhibited higher protein levels of both p62 and BCL10 than those in mice that had not received 3MA (Figure 4D).

Figure 4.

Figure 4

Open in a new tab

Inhibition of autophagy prevents the protective effects of betanin in TNBS‐induced colitis. Mice with TNBS‐induced colitis received a single dose of betanin (1 g·kg−1, i.p.) or saline, 2 or 4 days before the end of the experiment. One group also received a single dose of 3MA (10 mg·kg−1, i.p.) or saline. Graphs show (A) body weight as a percentage of starting weight, measured 2 days after TNBS administration (n = 10), (B) histological score (n = 5) and representative photographs of the mucosa 2 days after treatment; (C) representative Western blots and graphs showing p‐mTOR, p62, BCL10, IκBα, p‐IκBα, NFκB, β‐actin and nucleolin protein levels, 2 days after TNBS administration. (D) Body weight as a percentage of starting weight (n = 5) and representative Western blots and graphs showing p62, BCL10, and β‐actin protein levels, 4 days after TNBS administration. Data shown are means ± SEM. # P < 0.05, significantly different from the TNBS‐treated group; $ P < 0.05, significantly different from the TNBS/3MA‐treated group; & P < 0.05, significantly different from the TNBS/3MA/betanin‐treated group.

Discussion

There is growing evidence for defective autophagy in the pathogenesis of IBD. Our results demonstrate that pharmacological activation of mucosal autophagy ameliorates murine colitis through the inhibition of inflammation.

The TNBS model of murine colitis used in the present study is characterized by intense inflammation, disruption of epithelial cells by extensive ulcerations and marked loss of body weight. Our data reveal an impaired autophagic flux associated with phosphorylation of mTOR in the intestinal mucosa of TNBS‐treated mice, extending previous observations showing a defective autophagy in the mucosa of both IBD patients and DSS‐treated mice (Ortiz‐Masia et al., 2014). Of interest, systemic administration of three different compounds that share the ability to activate intestinal mucosal autophagy, accelerated the recovery of mice, as shown by the analysis of body weight and histological damage score. This protective effect was achieved with the classic mTOR inhibitor rapamycin (Ravikumar et al., 2004), the mTOR‐independent autophagic inducer, trehalose (Sarkar et al., 2007) and the natural pigment betanin which, according to our data, induced an mTOR‐dependent activation of autophagy in the colonic mucosa. Although other mechanisms cannot be ruled out, these results strongly suggest that stimulation of autophagy ameliorates murine colitis which was confirmed by the loss of the protective action of betanin, when mucosal autophagic flux was blocked with 3MA. Previous studies have shown the protective effects of autophagy stimulators in neurodegenerative diseases (Sarkar, 2013), spinal cord injury (Wang et al., 2014) and liver damage (Zhu et al., 2015) and the present study demonstrates, for the first time, a protective role for autophagy stimulation in murine colitis.

Several mechanisms such as defects in mucus secretion (Tsuboi et al., 2015) or activation of the inflammmasome in myeloid cells (Lee et al., 2016) have been associated with an increased susceptibility to colitis in mice with a defective autophagy. However, little is known about the mechanisms that mediate amelioration of colitis through autophagy stimulation. The selective degradation of pro‐inflammatory complexes, inflammasome structures and damaged mitochondria have all been used to explain how autophagy may prevent inflammation (Nakahira et al., 2011; Lapaquette et al., 2015; Netea‐Maier et al., 2016). Our results show, in the mucosa of TNBS‐treated mice, that autophagy is impaired and associated with high protein levels of cytosolic BCL10, a pro‐inflammatory complex known to regulate the constitutive activation of NFκB through canonical (phosphorylation of Iκ‐Bα) and non‐canonical (phosphorylation of NIK) pathways (Bonizzi and Karin, 2004; Zhou et al., 2004; Wu and Ashwell, 2008). The high protein levels of BCL10 have been detected in parallel with a significant increase in the ratio pIκ‐Bα/Iκ‐Bα, demonstrating the activation of the canonical pathway of NFκB in the mucosa of TNBS‐treated mice. Consistent with this, a critical role of BCL10 in NF‐κB activation was reported in a murine model of inflammation induced by carrageenan (Bhattacharyya et al., 2013). Of interest, our data show that the administration of betanin, rapamycin or trehalose to TNBS‐treated mice induced a significant decrease in protein levels of both BCL10 and p62. Previous studies have shown degradation of BCL10 by autophagy, in a process that required the expression of p62 (Paul et al., 2012). Accordingly, we found that inhibition of autophagosome formation with 3MA prevented the decrease in both BCL10 and p62 proteins, induced by betanin, strongly suggesting the degradation of BCL10 by autophagy. It seems likely that the reduced levels of BCL10 detected in mice treated with autophagy stimulators are responsible for the detected reduction in Iκ‐Bα phosphorylation and nuclear translocation of NF‐κB, although a direct degradation of NFκB p65‐IκB complexes by autophagy cannot be ruled out (Chang et al., 2013). As a whole, our results suggest that inhibition of mucosal autophagy by TNBS was associated with BCL10 accumulation, phosphorylation of IκB and nuclear translocation of NF‐κB with the consequent increase in the expression of pro‐inflammatory cytokines and M1 markers. Pharmacological activation of mucosal autophagy would favour BCL10 degradation and prevent TNBS‐induced inflammation (Figure 5).

Figure 5.

Figure 5

Open in a new tab

Diagram showing the proposed pathways activated by betanin, rapamycin and trehalose in the mucosa of TNBS‐treated mice. TNBS induced an mTOR‐dependent inhibition of autophagy with the consequent accumulation of the pro‐inflammatory complex, BCL10, and the final activation of the canonical NFκB pathway. Stimulation of autophagy by mTOR‐dependent (rapamycin or betanin) or mTOR‐independent pathways (trehalose) favours BCL10 degradation.

In conclusion, the present study shows a murine model of colitis characterized by severe intestinal damage associated with mucosal inflammation and blockade of autophagic flux. Pharmacological stimulation of mucosal autophagy attenuated inflammation by degradation of pro‐inflammatory complexes and ameliorated murine colitis. Our results suggest that stimulators of autophagy would be of interest in the clinical management of human IBD in those patients in whom autophagy is not genetically impaired.

Author contributions

D.M., J.C., S.C., J.V.E. and M.D.B. conceived and designed the experiments; D.M., J.C., D.O., S.C., C.H. and P.S. performed the experiments and analysed the data; and D.M., S.C., C.H., M.D.B. wrote the manuscript.

Conflict of interest

The authors declare no conflicts of interest.

Declaration of transparency and scientific rigour

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research recommended by funding agencies, publishers and other organisations engaged with supporting research.

Acknowledgements

The authors would like to thank Dora Martí for her excellent technical assistance during this study and Brian Normanly for his English language editing. This work was supported by Ministerio de Economía y Competitividad and the European Regional Development fund of the European Union (ERDF) [SAF2013‐43441‐P], Ministerio de Economia, Industria y Competitividad and the European Regional Development fund of the European Union (ERDF) (SAF2016‐80072P), CIBERehd and Generalitat Valenciana [PROMETEOII/2014/035, UGP‐14‐164]. Dulce C. Macias‐Ceja is the recipient of a fellowship from FISABIO and University of Colima, Colima, Mexico. Jesús Cosín is supported by FPU fellowship from Ministerio de Educacion, Cultura y Deporte. Pedro Salvador is supported by FPI fellowship from Ministerio de Economía y Competitividad. Carlos Hernandez acknowledges support from the “Ramon y Cajal” programme of Spain.

Macias‐Ceja, D. C. , Cosín‐Roger, J. , Ortiz‐Masiá, D. , Salvador, P. , Hernández, C. , Esplugues, J. V. , Calatayud, S. , and Barrachina, M. D. (2017) Stimulation of autophagy prevents intestinal mucosal inflammation and ameliorates murine colitis. British Journal of Pharmacology, 174: 2501–2511. doi: 10.1111/bph.13860.

References

  1. Alexander SP, Fabbro D, Kelly E, Marrion N, Peters JA, Benson HE et al. (2015). The concise guide to PHARMACOLOGY 2015/16: Enzymes. Br J Pharmacol 172: 6024–6109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ameho CK, Adjei AA, Harrison EK, Takeshita K, Morioka T, Arakaki Y et al. (1997). Prophylactic effect of dietary glutamine supplementation on interleukin 8 and tumour necrosis factor alpha production in trinitrobenzene sulphonic acid induced colitis. Gut 41: 487–493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Antoniou E, Margonis GA, Angelou A, Pikouli A, Argiri P, Karavokyros I et al. (2016). The TNBS‐induced colitis animal model: an overview. Ann Med Surg (Lond) 11: 9–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Baxt LA, Xavier RJ (2015). Role of autophagy in the maintenance of intestinal homeostasis. Gastroenterology 149: 553–562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bhattacharyya S, Xue L, Devkota S, Chang E, Morris S, Tobacman JK (2013). Carrageenan‐induced colonic inflammation is reduced in Bcl10 null mice and increased in IL‐10‐deficient mice. Mediators Inflamm 2013: 397642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bonizzi G, Karin M (2004). The two NF‐kappaB activation pathways and their role in innate and adaptive immunity. Trends Immunol 25: 280–288. [DOI] [PubMed] [Google Scholar]
  7. Chang CP, Su YC, Hu CW, Lei HY (2013). TLR2‐dependent selective autophagy regulates NF‐kappaB lysosomal degradation in hepatoma‐derived M2 macrophage differentiation. Cell Death Differ 20: 515–523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cosin‐Roger J, Ortiz‐Masia D, Calatayud S, Hernandez C, Esplugues JV, Barrachina MD (2016). The activation of Wnt signaling by a STAT6‐dependent macrophage phenotype promotes mucosal repair in murine IBD. Mucosal Immunol 9: 986–998. [DOI] [PubMed] [Google Scholar]
  9. Crisan TO, Plantinga TS, van de Veerdonk FL, Farcas MF, Stoffels M, Kullberg BJ et al. (2011). Inflammasome‐independent modulation of cytokine response by autophagy in human cells. PLoS One 6: e18666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Curtis MJ, Bond RA, Spina D, Ahluwalia A, Alexander SP, Giembycz MA et al. (2015). Experimental design and analysis and their reporting: new guidance for publication in BJP. Br J Pharmacol 172: 3461–3471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dodson M, Darley‐Usmar V, Zhang J (2013). Cellular metabolic and autophagic pathways: traffic control by redox signaling. Free Radic Biol Med 63: 207–221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fritz T, Niederreiter L, Adolph T, Blumberg RS, Kaser A (2011). Crohn's disease: NOD2, autophagy and ER stress converge. Gut 60: 1580–1588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hernandez C, Santamatilde E, McCreath KJ, Cervera AM, Diez I, Ortiz‐Masia D et al. (2009). Induction of trefoil factor (TFF)1, TFF2 and TFF3 by hypoxia is mediated by hypoxia inducible factor‐1: implications for gastric mucosal healing. Br J Pharmacol 156: 262–272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hooper KM, Barlow PG, Stevens C, Henderson P (2017). Inflammatory bowel disease drugs: a focus on autophagy. J Crohns Colitis 11: 118–127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Impellizzeri D, Bruschetta G, Di Paola R, Ahmad A, Campolo M, Cuzzocrea S et al. (2015). The anti‐inflammatory and antioxidant effects of bergamot juice extract (BJe) in an experimental model of inflammatory bowel disease. Clin Nutr 34: 1146–1154. [DOI] [PubMed] [Google Scholar]
  16. Khor B, Gardet A, Xavier RJ (2011). Genetics and pathogenesis of inflammatory bowel disease. Nature 474: 307–317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kilkenny C, Browne W, Cuthill IC, Emerson M, Altman DG (2010). Animal research: Reporting in vivo experiments: the ARRIVE guidelines. Br J Pharmacol 160: 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Acevedo Arozena A et al. (2016). Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 12: 1–222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lapaquette P, Guzzo J, Bretillon L, Bringer MA (2015). Cellular and molecular connections between autophagy and inflammation. Mediators Inflamm 2015: 398483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lee HY, Kim J, Quan W, Lee JC, Kim MS, Kim SH et al. (2016). Autophagy deficiency in myeloid cells increases susceptibility to obesity‐induced diabetes and experimental colitis. Autophagy 12: 1390–1403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lees CW, Barrett JC, Parkes M, Satsangi J (2011). New IBD genetics: common pathways with other diseases. Gut 60: 1739–1753. [DOI] [PubMed] [Google Scholar]
  22. Li Y, Guo Y, Wang X, Yu X, Duan W, Hong K et al. (2015). Trehalose decreases mutant SOD1 expression and alleviates motor deficiency in early but not end‐stage amyotrophic lateral sclerosis in a SOD1‐G93A mouse model. Neuroscience 298: 12–25. [DOI] [PubMed] [Google Scholar]
  23. Maloy KJ, Powrie F (2011). Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature 474: 298–306. [DOI] [PubMed] [Google Scholar]
  24. McGrath JC, Lilley E (2015). Implementing guidelines on reporting research using animals (ARRIVE etc.): new requirements for publication in BJP. Br J Pharmacol 172: 3189–3193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nakahira K, Haspel JA, Rathinam VA, Lee SJ, Dolinay T, Lam HC et al. (2011). Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol 12: 222–230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Netea‐Maier RT, Plantinga TS, van de Veerdonk FL, Smit JW, Netea MG (2016). Modulation of inflammation by autophagy: consequences for human disease. Autophagy 12: 245–260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nowacki L, Vigneron P, Rotellini L, Cazzola H, Merlier F, Prost E et al. (2015). Betanin‐enriched red beetroot (Beta vulgaris L.) extract induces apoptosis and autophagic cell death in MCF‐7 cells. Phytother Res 29: 1964–1973. [DOI] [PubMed] [Google Scholar]
  28. Ortiz‐Masia D, Cosin‐Roger J, Calatayud S, Hernandez C, Alos R, Hinojosa J et al. (2014). Hypoxic macrophages impair autophagy in epithelial cells through Wnt1: relevance in IBD. Mucosal Immunol 7: 929–938. [DOI] [PubMed] [Google Scholar]
  29. Ortiz‐Masia D, Diez I, Calatayud S, Hernandez C, Cosin‐Roger J, Hinojosa J et al. (2012). Induction of CD36 and thrombospondin‐1 in macrophages by hypoxia‐inducible factor 1 and its relevance in the inflammatory process. PLoS One 7: e48535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Paul S, Kashyap AK, Jia W, He YW, Schaefer BC (2012). Selective autophagy of the adaptor protein Bcl10 modulates T cell receptor activation of NF‐kappaB. Immunity 36: 947–958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Puighermanal E, Marsicano G, Busquets‐Garcia A, Lutz B, Maldonado R, Ozaita A (2009). Cannabinoid modulation of hippocampal long‐term memory is mediated by mTOR signaling. Nat Neurosci 12: 1152–1158. [DOI] [PubMed] [Google Scholar]
  32. Ravikumar B, Vacher C, Berger Z, Davies JE, Luo S, Oroz LG et al. (2004). Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease. Nat Genet 36: 585–595. [DOI] [PubMed] [Google Scholar]
  33. Saitoh T, Fujita N, Jang MH, Uematsu S, Yang BG, Satoh T et al. (2008). Loss of the autophagy protein Atg16L1 enhances endotoxin‐induced IL‐1beta production. Nature 456: 264–268. [DOI] [PubMed] [Google Scholar]
  34. Sarkar S (2013). Regulation of autophagy by mTOR‐dependent and mTOR‐independent pathways: autophagy dysfunction in neurodegenerative diseases and therapeutic application of autophagy enhancers. Biochem Soc Trans 41: 1103–1130. [DOI] [PubMed] [Google Scholar]
  35. Sarkar S, Davies JE, Huang Z, Tunnacliffe A, Rubinsztein DC (2007). Trehalose, a novel mTOR‐independent autophagy enhancer, accelerates the clearance of mutant huntingtin and alpha‐synuclein. J Biol Chem 282: 5641–5652. [DOI] [PubMed] [Google Scholar]
  36. Shibata Y, Oyama M, Kozuka‐Hata H, Han X, Tanaka Y, Gohda J et al. (2012). p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO. Nat Commun 3: 1061. [DOI] [PubMed] [Google Scholar]
  37. Southan C, Sharman JL, Benson HE, Faccenda E, Pawson AJ, Alexander SPH et al. (2016). The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. Nucleic Acids Res 44 (Database Issue): D1054–D1068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tan D, Wang Y, Bai B, Yang X, Han J (2015). Betanin attenuates oxidative stress and inflammatory reaction in kidney of paraquat‐treated rat. Food Chem Toxicol 78: 141–146. [DOI] [PubMed] [Google Scholar]
  39. Tsuboi K, Nishitani M, Takakura A, Imai Y, Komatsu M, Kawashima H (2015). Autophagy protects against colitis by the maintenance of normal gut microflora and secretion of mucus. J Biol Chem 290: 20511–20526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wang ZY, Lin JH, Muharram A, Liu WG (2014). Beclin‐1‐mediated autophagy protects spinal cord neurons against mechanical injury‐induced apoptosis. Apoptosis 19: 933–945. [DOI] [PubMed] [Google Scholar]
  41. Wu CJ, Ashwell JD (2008). NEMO recognition of ubiquitinated Bcl10 is required for T cell receptor‐mediated NF‐kappaB activation. Proc Natl Acad Sci U S A 105: 3023–3028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhang D, Wang L, Yan L, Miao X, Gong C, Xiao M et al. (2015). Vacuolar protein sorting 4B regulates apoptosis of intestinal epithelial cells via p38 MAPK in Crohn's disease. Exp Mol Pathol 98: 55–64. [DOI] [PubMed] [Google Scholar]
  43. Zhou H, Wertz I, O'Rourke K, Ultsch M, Seshagiri S, Eby M et al. (2004). Bcl10 activates the NF‐kappaB pathway through ubiquitination of NEMO. Nature 427: 167–171. [DOI] [PubMed] [Google Scholar]
  44. Zhu J, Lu T, Yue S, Shen X, Gao F, Busuttil RW et al. (2015). Rapamycin protection of livers from ischemia and reperfusion injury is dependent on both autophagy induction and mammalian target of rapamycin complex 2‐Akt activation. Transplantation 99: 48–55. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES