ABSTRACT
Aspergillus niger and its related species, known as Aspergillus section Nigri, are ubiquitously distributed across the globe and are often isolated from clinical specimens. In Japan, Aspergillus section Nigri is second most often isolated from clinical specimens following Aspergillus fumigatus. We determined the species of Aspergillus section Nigri isolated in Japan by DNA sequencing of partial β-tubulin genes and investigated drug susceptibility by the CLSI M38-A2 method. The collection contained 20 Aspergillus niger, 59 Aspergillus welwitschiae, and 39 Aspergillus tubingensis strains. Drug susceptibility testing revealed 30 to 55% of A. niger, 6.8 to 18.6% of A. welwitschiae, and 79.5 to 89.7% of A. tubingensis isolates to be less susceptible (so-called resistant) to itraconazole (ITC) and/or voriconazole (VRC) according to the epidemiologic cutoff values (ECVs) proposed for A. niger previously. MIC distributions of ITC or VRC showed no remarkable differences between clinical and environmental isolates. When the cyp51A sequences were compared between susceptible and resistant strains, 18 amino acid mutations were specific for resistant isolates of A. niger and A. tubingensis; however, none of them were confirmed to be associated with azole resistance. Three nonrelated A. welwitschiae isolates possessed a partial deletion in cyp51A, likely attributable to being more susceptible to azoles than other isolates. One of five ITC-resistant A. tubingensis isolates showed higher expression of cyp51A than did susceptible strains. Our results show that cyp51A point mutations may have no association with azole resistance but that in some cases the overexpression of cyp51A may lead to the azole resistance in these species.
KEYWORDS: Aspergillus section Nigri, gene expression, antifungal resistance, azole, cyp51A gene
INTRODUCTION
Aspergillus niger and its related species, known as Aspergillus section Nigri, are included in the black aspergilli, which are unevenly distributed across the globe and are often isolated from clinical specimens. While A. niger is a representative species, the section Nigri contains Aspergillus tubingensis, Aspergillus welwitschiae, Aspergillus acidus, and Aspergillus brasiliensis (1). Their morphological structures of conidiophores are too similar to allow discrimination, and the strains with morphological characteristics of black aspergilli had therefore been, as a whole, classified as A. niger (2). In this decade, molecular genetic tools have been developed to make identification of the taxonomy of this section possible by DNA sequencing of calmodulin and β-tubulin genes (3). Along with advances in genetic identification, classification of some black aspergillus species was corrected based on genetic classification. For instance, a greater part of the species that was formerly called Aspergillus awamori was classified into A. welwitschiae (4). Recent epidemiological analyses have uncovered the distribution of each species of section Nigri among clinical isolates (5). According to the reports, the view that A. niger and A. tubingensis are the most prevalent species is largely supported. Importantly, several reports on the antifungal drug susceptibility of strains of Aspergillus section Nigri have revealed that strains showing higher MICs of itraconazole were often isolated from A. niger and A. tubingensis in a clinical setting as well as from the environment (6–9). This is suggestive of an intrinsic resistance to itraconazole by these species.
Azole resistance mechanisms were intensively studied in Aspergillus fumigatus, the major causative pathogen for aspergillosis. Most of the mutations that confer azole resistance have been found in the cyp51A gene, encoding a target protein of azoles. The other mechanism involves upregulation of efflux pump Cdr1B, while azole-resistant isolates with unknown mechanisms have sometimes been recovered from patients (5, 10–15). In contrast to A. fumigatus, drug resistance mechanisms have not been well investigated in Aspergillus section Nigri. The first study of the molecular mechanism underlying azole resistance to the strains of section Nigri was reported by Howard et al. (7). In their study, cyp51A genes in A. niger and A. tubingensis strains that were less susceptible to itraconazole were sequenced, and several amino acid substitutions were found in the CYP51A protein of the strains. However, the underlying resistance mechanisms have not yet been fully explored.
In Japan, Aspergillus section Nigri is the species second most often isolated from clinical specimens, following A. fumigatus (16, 17). Despite such significance, detailed species classification and drug susceptibility testing for the Japanese strains have yet to be reported. The aim of our study was to reveal the prevalence of the species of Aspergillus section Nigri isolated in Japan and to investigate drug susceptibility and the azole resistance mechanism. Our results showed a trend of A. tubingensis strains being less susceptible to azole drugs than A. niger and A. welwitschiae. Furthermore, a partial deletion in the cyp51A locus that appears to inactivate the gene was identified in some A. welwitschiae strains, providing evidence that genetic heterogeneity affecting drug susceptibility was intrinsically present in the strains of Aspergillus section Nigri.
RESULTS
Species identification.
Our strain collection includes 80 clinical and 38 environmental Aspergillus section Nigri strains isolated in Japan. Taxa of these strains were determined using the combined sequences of β-tubulin genes. A total of 20 A. niger (16.9%), 59 A. welwitschiae (50%), and 39 A. tubingensis (33.1%) strains were identified in the collection.
In vitro susceptibility.
All 118 isolates in the collection and three reference strains (A. niger CBS 513.88, A. welwitschiae CBS 557.65, and A. tubingensis CBS 134.48) were investigated by drug susceptibility testing and compared regarding the distribution of MICs among the three species or among clinical and environmental isolate groups (Table 1). Whereas the clinical isolates showed higher MICs of flucytosine (5FC) than environmental isolates in all species, no obvious differences between the two groups were found in the MICs of amphotericin B (AMB), itraconazole (ITC), and voriconazole (VRC). All isolates showed micafungin (MCFG) minimum effective concentrations (MECs) of ≤0.015 mg/liter (data not shown), which is consistent with previous studies (18). In A. tubingensis, MICs of ITC and VRC were higher than those for A. niger and A. welwitschiae. The epidemiologic cutoff values (ECVs) for A. niger were previously proposed by Espinel-Ingroff et al. (19, 20) as 2 mg/liter of ITC, 2 mg/liter of VRC, and 2 mg/liter of AMB. When ECVs were applied for other section Nigri species for which ECVs had not been determined, 79.5% and 89.7% of A. tubingensis strains showed ITC and VRC MICs above the ECVs (2 mg/liter), respectively, while the rates for A. niger and A. welwitschiae were 30.0% and 6.8% (ITC) and 55.0% and 18.6% (VRC), respectively.
TABLE 1.
MIC distributions of antifungal drugs for Aspergillus section Nigri using CLSI M38-A2 method
| Antifungal agent and species | No. of isolates |
||||||||
|---|---|---|---|---|---|---|---|---|---|
| Total (clinical) | With MIC (mg/liter)a: |
||||||||
| 0.12 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | >8 | ||
| ITC | |||||||||
| A. niger | 20 (14) | 0 | 1 (1) | 0 | 8 (8) | 5 (4) | 4 (1) | 2 (0) | 0 |
| A. welwitschiae | 59 (46) | 0 | 3 (3) | 1 (1) | 30 (25) | 21 (15) | 3 (2) | 1 (0) | 0 |
| A. tubingensis | 39 (20) | 0 | 0 | 0 | 1 (0) | 7 (4) | 13 (8) | 6 (4) | 12 (4) |
| VRC | |||||||||
| A. niger | 20 (14) | 0 | 0 | 1 (1) | 1 (1) | 7 (7) | 9 (4) | 2 (1) | 0 |
| A. welwitschiae | 59 (46) | 0 | 0 | 3 (3) | 14 (11) | 31 (24) | 11 (8) | 0 | 0 |
| A. tubingensis | 39 (20) | 0 | 0 | 0 | 0 | 4 (2) | 18 (9) | 15 (9) | 2 (0) |
| AMB | |||||||||
| A. niger | 20 (14) | 0 | 2 (2) | 10 (7) | 8 (5) | 0 | 0 | 0 | 0 |
| A. welwitschiae | 59 (46) | 0 | 3 (1) | 19 (15) | 35 (28) | 2 (2) | 0 | 0 | 0 |
| A. tubingensis | 39 (20) | 0 | 4 (4) | 27 (12) | 7 (4) | 1 (0) | 0 | 0 | 0 |
| 5FC | |||||||||
| A. niger | 20 (14) | 0 | 0 | 0 | 3 (0) | 1 (0) | 3 (1) | 7 (7) | 6 (6) |
| A. welwitschiae | 59 (46) | 0 | 0 | 0 | 4 (0) | 6 (2) | 19 (17) | 26 (23) | 4 (4) |
| A. tubingensis | 39 (20) | 0 | 0 | 0 | 1 (0) | 10 (0) | 13 (11) | 12 (8) | 3 (1) |
Numbers of isolates above ECVs (2 mg/liter) are shown in bold.
Sequencing of cyp51A gene.
The entire cyp51A gene was sequenced in all isolates except for three A. welwitschiae isolates, in which only the partial sequence fragment was available. According to the sequences, the phylogenetic tree for CYP51A protein was drawn (Fig. 1A). It was found that the amino acid sequences of cyp51A for A. tubingensis were relatively divergent from those for A. niger and A. welwitschiae, whereas the sequences of some strains of A. niger and A. welwitschiae were indistinguishable from each other. This phylogenetic classification was largely consistent with the phylogenetic tree drawn by β-tubulin gene sequences (Fig. 1B). It was apparent that the A. tubingensis isolates less susceptible to ITC (n = 31) and/or VRC (n = 35) were evenly distributed in the phylogenetic tree (Fig. 1A, indicated by *).
FIG 1.
(A) Phylogenetic tree drawn by cyp51A gene sequences. _*, MIC of >2 mg/liter to ITC or VRC; _**, MIC of >2 mg/liter to both ITC and VRC. (B) Phylogenetic tree drawn by β-tubulin gene sequences.
Compared with the cyp51A sequence of the susceptible strains in each species (type strains of A. niger and A. welwitschiae and A. tubingensis IFM 54886), several amino acid substitutions were detected in each species. A summary of the substitutions is shown in Table 2. Among these, several mutations were found in both susceptible and resistant isolates. In A. niger, V104I and H382R were found only in ITC-resistant isolates, and I377V, S507I, and L511M were found in isolates resistant to both ITC and VRC. In A. tubingensis, A9V, L21F, A140V, P413S, and D505E were found only in ITC-resistant isolates, and S61F, A185G, T321A, N327S, V422I, L492M, L503F, and Q504P were found in isolates resistant to both ITC and VRC. There were no amino acid mutations that existed exclusively in resistant A. welwitschiae isolates. By Fisher's exact test, the association between the respective mutations in Cyp51A and azole resistance was assessed, and it was determined that none of the mutations was related to azole resistance.
TABLE 2.
Amino acid mutations in each species
| Species | IFM strain | MIC (mg/liter) of druga: |
Amino acid mutation(s)b | |
|---|---|---|---|---|
| ITC | VRC | |||
| A. niger | Compared with CBS 513.88 | 1 | 2 | |
| 56816 | 1 | 2 | T57A, Q228R, H506N | |
| 62144 | 1 | 2 | T57A, Q228R, S346R, H506N | |
| 62615 | 1 | 2 | T57A, Q228R, S346R, H506N | |
| 63604 | 2 | 1 | T57A, Q228R, S346R, H506N | |
| 48049 | 2 | 2 | Q228R | |
| 46897 | 1 | 4 | Q228R, I377V, H506N, S507I, L511M | |
| 63326 | 1 | 4 | T57A, Q228R, S346R, H506N | |
| 63603 | 2 | 4 | T57A, Q228R, S346R, H506N | |
| 57761 | 4 | 4 | Q228R | |
| 63884 | 4 | 4 | T57A, Q228R, S346R, H506N | |
| 63883 | 8 | 4 | Q228R, H506N, S507I, L511M | |
| 63885 | 8 | 4 | T57A, Q228R, H382R, H506N | |
| 63886 | 4 | 8 | V104I, Q228R, I377V, H506N, S507I, L511M | |
| A. tubingensis | Compared with IFM 54886 | 1 | 2 | |
| CBS 134.48 | 2 | 4 | T321A | |
| 59444 | 2 | 8 | S61F, A185G, T321A, N327S, V422I, L492M, I503F, Q504P | |
| 64119 | 2 | 8 | T321A | |
| 41397 | 4 | 4 | A140V, T321A, P413S, L492M, I503F, Q504P | |
| 54309 | 4 | 4 | A140V, T321A, P413S, L492M, I503F, Q504P | |
| 59443 | 4 | 4 | S61F, A185G, T321A, N327S, V422I, L492M, I503F, Q504P | |
| 57258 | 4 | >8 | A9V, T321A, I503F, Q504P, D505E | |
| 62856 | >8 | 8 | A9V, L21F, T321A, I503V | |
| 62857 | >8 | 8 | A9V, L21F, T321A, I503V | |
| 63890 | >8 | 8 | L21F, T321A, I503V | |
| 64124 | >8 | 4 | A140V, T321A, P413S, L492M, I503F, Q504P | |
| A. welwitschiae | Compared with CBS 557.65 | 2 | 2 | |
| 58047 | 0.5 | 0.5 | F343L, L511F | |
| 54680 | 1 | 1 | K477E | |
| 54683 | 1 | 1 | V383L | |
| 55341 | 1 | 1 | V383L | |
| 55449 | 1 | 1 | ||
| 55705 | 1 | 1 | ||
| 58160 | 1 | 1 | V383L | |
| 58312 | 1 | 1 | F343L, L511F | |
| 62662 | 1 | 1 | V383L | |
| 62919 | 1 | 1 | D474N, N506H | |
| 63253 | 1 | 1 | K477E | |
| 49719 | 1 | 2 | ||
| 54606 | 1 | 2 | V383L | |
| 54634 | 1 | 2 | V383L | |
| 55451 | 1 | 2 | K477E | |
| 55743 | 1 | 2 | F343L, L511F | |
| 56814 | 1 | 2 | V383L | |
| 62616 | 1 | 2 | F343L, L511F | |
| 62621 | 1 | 2 | V383L | |
| 63657 | 1 | 2 | V383L | |
| 54679 | 2 | 2 | K477E | |
| 57144 | 2 | 2 | F343L, L511F | |
| 62255 | 2 | 2 | V383L | |
| 62617 | 2 | 2 | V383L | |
| 63332 | 2 | 2 | D474N, N506H | |
| 63348 | 2 | 2 | F343L, L511F | |
| 63878 | 2 | 2 | V383L | |
| 63879 | 2 | 2 | V383L | |
| 63880 | 2 | 2 | D474N, N506H | |
| 63881 | 2 | 2 | L157I, G509E | |
| 63882 | 2 | 2 | L157I, G509E | |
| 62619 | 1 | 4 | V383L | |
| 64121 | 2 | 4 | V383L | |
| 60653 | 4 | 4 | V383L | |
| 63877 | 4 | 4 | V383L | |
| 63876 | 8 | 4 | V383L | |
MICs in bold indicate being above ECVs (2 mg/liter).
Amino acid mutations in bold are in isolates resistant to either ITC or VRC. Those in italic are in isolates resistant to both ITC and VRC.
The second half of the cyp51A gene of three A. welwitschiae isolates, IFM 57545, IFM 61537, and IFM 62618, could not be amplified with the primers designed from the sequences proximal to the cyp51A gene. According to the full-genome sequence data of A. welwitschiae IFM 62618, new primers (one located in the open reading frame [ORF] and the other approximately 6,500 bp downstream from the termination codon) were designed, and the rest of the regions of the cyp51A gene of IFM 57545 and IFM 61537 were sequenced. It was found that the three isolates lack 258 bp of the cyp51A gene and 6,458 bp of the 3′ flanking sequence (total of 6,716 bp) in a similar fashion. In addition to the partial sequence of cyp51A, the sequences of cyp51B, two orthologs for cdr1B, and partial calmodulin and β-tubulin genes were comparable among these isolates, which are also the same as the sequences of A. welwitschiae type strain CBS 557.65.
Expression level of cyp51A analyzed by real-time PCR.
To explore the involvement of cyp51A genes in the azole-resistant isolates, real-time quantitative reverse transcription-PCR (RT-PCR) was used to assess gene expression levels (Fig. 2). We investigated 8 strains for each species, among which IFM 63887, a resistant A. tubingensis strain, and IFM 62615, a sensitive A. niger strain, showed 2.1- to 5.7- and 2.6- to 10.1-fold-higher expression of cyp51A than the other strains. The increase was statistically significant (P < 0.05). The A. welwitschiae strains tested here showed similar expression levels of cyp51A. In the resistant A. tubingensis isolate with a higher cyp51A expression level, there were no tandem repeats in 1,000 bp upstream of cyp51A where the promoter region of cyp51A should exist.
FIG 2.
Expression analysis for cyp51A gene by real-time PCR. The expression levels of cyp51A genes in Aspergillus section Nigri isolates were assessed by real-time RT-PCR. The actin gene was used as an internal (normalization) control in each species. Sensitive strains are shown by gray bars, and resistant strains are shown by black bars. The MICs of ITC and VRC are shown below isolate labels. The type strain is shown by a hatched column. *, statistically significant difference (P < 0.05).
DISCUSSION
This study for the first time revealed the taxonomy and drug susceptibilities of a total of 118 Aspergillus section Nigri strains isolated in Japan. This set of isolates included three species, A. niger, A. welwitschiae, and A. tubingensis, of which A. welwitschiae had the largest number of isolates (50%) identified. A. welwitschiae is a species very close to A. niger, and thus, it may be misidentified as A. niger by internal transcribed spacer (ITS) region analysis (7). Since it was recently revealed that the neotype of Aspergillus awamori (CBS 557.65 = NRRL 4948) was identical to A. welwitschiae CBS 139.54 (4), the classification for A. awamori and A. welwitschiae was rearranged. Certain previous studies included analyses of A. awamori isolates, some of which should now be recognized as A. welwitschiae according to the present definition for species classification (4, 7–9).
MIC distributions of antifungals showed obvious differences between clinical isolates and environmental isolates for 5FC, where the clinical isolate group showed higher MICs than the environmental isolate group. As we hardly have a sufficient clinical history for each of the clinical isolates presented in this study, whether they had been exposed to drug therapy was uncertain. Even if some isolates had been exposed to antifungals, the result indicated that clinical isolates were not affected regarding drug susceptibility except for 5FC. MICs of ITC and VRC in isolates of A. tubingensis were higher than those in the two other species regardless of the source of the isolates. Our finding suggests that A. tubingensis isolates are intrinsically resistant to azoles, but this does not depend on exposure to azoles. Several reports from other countries, so far, have supported the idea of less susceptibility in A. tubingensis (6, 7, 9, 21). Considering the lowered azole susceptibilities in A. tubingensis, it must be further stressed that identification of the detailed species causing mycoses is important for appropriate drug therapy.
Drug resistance mechanisms such as mutations in cyp51A, increases in cyp51A expression, upregulation of efflux pumps, and other mechanisms were reported in A. fumigatus (10–15). The amino acid substitutions in cyp51A causing azole resistance have been reported in A. fumigatus, although no information on such mutations was available for other pathogenic Aspergillus species, including A. tubingensis (10, 11). Here, we tried to understand the relationship between drug resistance and cyp51A mutations in Aspergillus section Nigri. Although several mutations were found only in resistant isolates, none of them were confirmed to be associated with azole resistance. Moreover, there were still several resistant strains with no mutations in cyp51A. Howard et al. previously suggested that cyp51A mutations in section Nigri may not play an important role in azole resistance, as they do in A. fumigatus (7). In their report, the sequences of cyp51A were confirmed in 5 out of 8 A. tubingensis isolates, and differing amino acid residues were not found among these strains. Compared with their report, we found that amino acid sequences of cyp51A showed relative variations in A. tubingensis isolates in our collection. One explanation for such moderate variety in cyp51A sequences is the various origins of the isolates. Another possibility is that the Japanese A. tubingensis strains are originally highly diverse in the environment, resulting in the Cyp51A protein sequences evolving quickly.
In the three A. welwitschiae isolates, the cyp51A gene was found to be deleted compared with that of the other strains, including the type strain. Among these strains, there were no differences in the sequences of cyp51B, two homologous cdr1B genes, and partial calmodulin and β-tubulin genes. This suggested that the three isolates were genetically very close or almost identical. Notably, these isolates were recovered from different patients at different locations in different years, namely, one from Tokyo in 2014 and two from Chiba prefecture in 2008 and 2012. This allowed us to speculate that the strains with a partial Cyp51A protein were originally derived from one ancestor and then spread to some other parts of Japan. MIC testing revealed that these isolates were highly sensitive to azoles (ITC, 0.25 mg/liter; VRC, 0.5 to 1 mg/liter; fluconazole [FLC], 16 to 32 mg/liter; miconazole [MCZ], 0.06 to 0.12 mg/liter), and therefore, the possible relationship between a lack of part of cyp51A and the high sensitivity to azoles should be investigated in the future.
Beside the mutations in cyp51A, the gene expression level of cyp51A was investigated in Aspergillus section Nigri isolates. We found one azole-resistant A. tubingensis isolate in which cyp51A was overexpressed. To our knowledge, this is the first report of overexpression of the cyp51A gene in A. tubingensis. Tandem repeats in the promoter region of cyp51A cause upregulation of the cyp51A gene and become one of the most prevalent azole resistance mechanisms in A. fumigatus (see papers cited in reference 5). Thus, we tested the possibility that the overexpression of the cyp51A gene in A. tubingensis IFM 63887 was caused by tandem repeats. Our inspection of 1,000 bp upstream of the cyp51A gene showed that there were no tandem repeats in IFM 63887, suggesting that some other mechanism led to the overexpression of cyp51A. This is an interesting and important issue, and further study to explore the regulation of the cyp51A gene in A. tubingensis is required. Interestingly, one azole-sensitive A. niger isolate showed higher expression of cyp51A than the other isolates. This suggested that overexpression of the cyp51A gene does not necessarily lead to azole resistance in this fungus. It will be further studied in our group. As reported for A. fumigatus, upregulation of the drug efflux pump gene must be considered one of the other mechanisms for azole resistance in Aspergillus section Nigri. Further, the potential occurrence of azole resistance through exposure to azole drugs still remains to be investigated. Taking into consideration the fact that Aspergillus section Nigri is the second most frequent etiologic pathogen in Japan, further studies of drug resistance mechanisms are needed.
MATERIALS AND METHODS
Clinical and environmental isolates.
A total of 118 black aspergilli were investigated. The isolates were from the culture collection of the Medical Mycology Research Center, Chiba University, Japan, collected from throughout the country between August 1992 and October 2015. Eighty were clinical isolates, 38 were isolated from the environment, and 3 type strains were used as references.
Extraction of genomic DNA.
The mycelia were grown at 37°C for 18 h in 1 ml of YPG medium (1% yeast extract, 1% peptone, and 1% glucose) per well of 24-well plates with a conidial concentration of 2 × 104 CFU/ml. Genomic DNA was extracted from the mycelia by the benzyl chloride method (22).
Species identification.
All isolates were identified to the species level by DNA sequencing of partial β-tubulin genes. Partial sequencing of the β-tubulin genes was performed using the primer pair Bt2a and Bt2b (23). Samples were amplified using the following cycling parameters: one initial cycle of 10 min at 95°C followed by 35 cycles of 1 min at 95°C, 1 min at 59°C, and 1 min at 72°C and a single extension cycle of 10 min at 72°C for the β-tubulin gene. PCRs were performed in 25 μl containing 2 μl of DNA (2 pM), 2 μl of forward primer, 2 μl of reverse primer, 19 μl of H2O, and PuReTaq Ready-To-Go PCR beads (GE Healthcare UK, Little Chalfont, UK). The PCR products were sequenced using the BigDye Terminator cycle sequencing ready reaction kit (Applied Biosystems, Foster City, CA, USA) on an ABI Prism 3130ABI genetic analyzer (Applied Biosystems) according to the manufacturer's instructions.
In vitro susceptibility testing.
All MICs from the isolates were determined as described previously (24). Briefly, the test was performed in triplicate according to a method following the Clinical and Laboratory Standards Institute reference broth microdilution method, document M38-A2 (24), with partial modifications using the dried plate for antifungal susceptibility testing (Eiken Chemicals, Tokyo, Japan) (25). Paecilomyces variotii (ATCC MYA-3630), Candida parapsilosis (ATCC 22019), Candida krusei (ATCC 6258), and Aspergillus flavus (ATCC MYA-3631) were used as quality control or reference strains according the M38-A2 document.
Sequencing of cyp51A gene.
The entire cyp51A gene with approximately 100 bp of 5′ and 3′ flanking regions was amplified. The primers for A. niger and A. welwitschiae and for A. tubingensis were designed according to the genome sequences of A. niger CBS 513.88 and A. tubingensis F13880, respectively. PCR was performed using Kapa Taq Extra HotStart ReadyMix with dye (Kapa Biosystems, Wilmington, MA, USA) according to the manufacturer's instructions. For sequencing, the BigDye Terminator v3.1/1.1 cycle sequencing kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used with primers listed in Table 3.
TABLE 3.
Primer sequences for sequencing and real-time PCRa
| Expt | Primer name | Tm (°C) | Sequence (5′–3′) |
|---|---|---|---|
| cyp51A, A. niger/A. welwitschiae | AnAwcyp51A F1 | 61 | CGACAACAACCTAGTACTTCAATGTCTTGC |
| AnAwcyp51A F2 | 65 | CGTCCAGCTGATCGAAAAGGAAACTCTCG | |
| AnAwcyp51A F3 | 62 | GCAGTATCAGGACCTTGACAAGCTGC | |
| AnAwcyp51A R | 73 | CGAGAGTTTCCTTTTCGATCAGCTGGACG | |
| Awdel-cyp51A F | 66 | GCAACAGAAATGGAGTCTTCGAGCCGCTG | |
| Awdel-cyp51A R | 58 | CTGTATCTTTATCTACATACATCGCCG | |
| cyp51A, A. tubingensis | Atcyp51A F1 | 67 | ATGGCATATCTTGCTGTTGCAGGCGCCTAC |
| Atcyp51A F2 | 55 | GTCCGACGTTGTGTACGACTG | |
| Atcyp51A F3 | 56 | CAAGAACCCAGACGAGGAGAAG | |
| Atcyp51A R | 58 | TTAGTTCAAGGACCCCTTGGAGTTGTC | |
| A. welwitschiae gene sequencing | Awcyp51B F1 | 57 | GACCAATTCCGAGTCAATTTCATCG |
| Awcyp51B F2 | 65 | GCACTAGCCGCAATAGTCTCATCCCAACG | |
| Awcyp51B F3 | 57 | GGCGTTCCTTGATAATCTCCATATAAG | |
| Awcyp51B R | 64 | CTAGGAAGGTGCCTCTGCTTGAGTCACTC | |
| Awcdr1B1F | 64 | GTCGTCGTTCGTCGCCACGACAAATCC | |
| Awcdr1B1R1 | 59 | GAGAAGAGCCAGAAAGTCCACCAG | |
| Awcdr1B1R2 | 65 | GCACAACGAAATCTGCTCCCACACCGAG | |
| Awcdr1B1R3 | 61 | GCACTCTGAGACGCCTGGTAGATAG | |
| Awcdr1B1R4 | 63 | GTGGATATCGGTCTCGGCGTTGTAGATG | |
| Awcdr1B2F | 56 | GTCGCTTCTAGGCACTATAAATCC | |
| Awcdr1B2R1 | 59 | CAACTTTGTAAGGCATGTCACACAGC | |
| Awcdr1B2R2 | 63 | CTTGACGCGCTGGTTCTTCGATTGC | |
| Awcdr1B2R3 | 59 | CATATTTGGTCATCAGGTTCAGAGTTTTGC | |
| Awcdr1B2R4 | 58 | CCTGGTAATTCAATTCAGACTCCTTATCC | |
| A. tubingensis promoter | Atpro F1 | 64 | GGAAAGTCAGGATCCGAAGGAGCCAAGC |
| Atpro F2 | 60 | GTGAACTACATAGCAAGAAACAGGTATCGG | |
| Atpro F3 | 60 | GTTAGTTTTGGACACCCGGTCCAGGC | |
| Atpro R | 64 | CATCCTGGAAGCGACCGTAGGCAGG | |
| Real-time PCR, A. niger/A. welwitschiae | AnAwPCR-F | 69 | TGGCATTACTTGCTGTCGCAGGCGTCTACGC |
| AnAwPCR-R | 65 | GCTTCCCAAGAAGGGGATCCAATGGAAGACG | |
| AnAwActin-F | 68 | CTCGACTTCGAGCAGGAGATCCAGACCGC | |
| AnAwActin-R | 69 | GCCTCAGGAGCACGGAAACGCTCGTTGCC | |
| Real-time PCR, A. tubingensis | AtPCR-F | 70 | CTACGCTTTCGCAGCGTTGCTCGTTGCG |
| AtPCR-R | 60 | ACGGGTGGTTCTTTCTCGTTGCG | |
| AtActin-F | 56 | TCGTGACCTGACGGATTACCTC | |
| AtActin-R | 55 | CCTTCATGGAAGAAGGAGCAAG |
Abbreviations: F, forward strand; R, reverse strand; Tm, melting temperature (nearest neighbor method).
For the A. welwitschiae isolates lacking a partial region of the cyp51A gene, additional primers, Awdel-cyp51A-F and Awdel-cyp51A-R, shown in Table 3, were designed to clarify the missing region according to in-house draft genome sequences of A. welwitschiae CBS 557.65 (IFM 58123) and IFM 62618.
To confirm the presence or absence of tandem repeats in the promoter region of A. tubingensis cyp51A, four primers, Atpro F1 to F3 and Atpro R, were designed according to the genome sequences of A. tubingensis CBS 134.48 (available in AspGD [http://www.aspgd.org/]).
Phylogenetic tree.
The sequence alignments of β-tubulin or the cyp51A gene excluding the intron were aligned using the Clustal X2.1 program. Phylogenetic trees were produced from alignments in Clustal X2.1 by the neighbor-joining method. The reliability of each clade was determined by the bootstrap method with 1,000 replicates.
Real-time PCR of cyp51A.
Real-time quantitative reverse transcription-PCR (RT-PCR) was used to assess the levels of expression of the cyp51A genes in Aspergillus section Nigri strains. Eight isolates were investigated in each species. In A. niger and A. welwitschiae, four isolates sensitive to azoles and four isolates resistant to them were tested. In A. tubingensis, two isolates sensitive to azoles, 5 isolates resistant to them, and one type strain were tested. Approximately 1.0 × 106 conidia of each A. tubingensis isolate were injected into a 250-ml Erlenmeyer flask containing 50 ml of YPG medium and cultured at 37°C for 18 h at 120 rpm, and total RNA was extracted from the harvested mycelia with the FastRNA Pro Red kit (Qbiogene, Carlsbad, CA, USA) according to the manufacturer's instructions. RNase-free DNase treatment and cDNA synthesis were performed with ReverTra Ace RT-PCR master mix with genomic DNA (gDNA) remover (Toyobo, Osaka, Japan). All RT-PCRs were performed with the 7300 system (Life Technologies Corporation, Carlsbad, CA, USA) with SYBR green detection as described previously (26), Thunderbird SYBR quantitative PCR mix (Toyobo, Osaka, Japan), and primers. The primer sets used for the analyses are listed in Table 3. The actin gene was used as the normalization reference (internal control) for target gene expression level. Each isolate was tested in triplicate, and the same experiment was done twice.
Statistical analysis.
Fisher's exact test was used to determine if there were nonrandom associations between the respective mutations in Cyp51A and the azole resistance phenotype. A P value of <0.05 was considered significant. In gene expression analysis, the analysis of variance (ANOVA) method followed by the Bonferroni test was used to test whether the expression levels were statistically different. A P value of <0.05 was considered significant.
ACKNOWLEDGMENTS
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
All authors have no conflicts of interest to declare.
REFERENCES
- 1.Varga J, Frisvad JC, Kocsubé S, Brankovics B, Tóth B, Szigeti G, Samson RA. 2011. New and revisited species in Aspergillus section Nigri. Stud Mycol 69:1–17. doi: 10.3114/sim.2011.69.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Abarca ML, Accensi F, Cano J, Cabañes FJ. 2004. Taxonomy and significance of black aspergilli. Antonie van Leeuwenhoek 86:33–49. doi: 10.1023/B:ANTO.0000024907.85688.05. [DOI] [PubMed] [Google Scholar]
- 3.Samson RA, Noonim P, Meijer M, Houbraken J, Frisvad JC, Varga J. 2007. Diagnostic tools to identify black aspergilli. Stud Mycol 59:129–145. doi: 10.3114/sim.2007.59.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hong SB, Lee M, Kim DH, Varga J, Frisvad JC, Perrone G, Gomi K, Yamada O, Machida M, Houbraken J, Samson RA. 2013. Aspergillus luchuensis, an industrially important black Aspergillus in East Asia. PLoS One 8:e63769. doi: 10.1371/journal.pone.0063769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Hagiwara D, Watanabe A, Kamei K, Goldman GH. 2016. Epidemiological and genomic landscape of azole resistance mechanisms in Aspergillus fungi. Front Microbiol 7:e1382. doi: 10.3389/fmicb.2016.01382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Li Y, Wan Z, Liu W, Li R. 2015. Identification and susceptibility of Aspergillus section Nigri in China: prevalence of species and paradoxical growth in response to echinocandins. J Clin Microbiol 53:702–705. doi: 10.1128/JCM.03233-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Howard SJ, Harrison E, Bowyer P, Varga J, Denning DW. 2011. Cryptic species and azole resistance in the Aspergillus niger complex. Antimicrobial Agents Chemother 55:4802–4809. doi: 10.1128/AAC.00304-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Mirhendi H, Zarei F, Motamedi M, Nouripour-Sisakht S. 2016. Aspergillus tubingensis and Aspergillus niger as the dominant black Aspergillus, use of simple PCR-RFLP for preliminary differentiation. J Mycol Med 26:9–16. doi: 10.1016/j.mycmed.2015.12.004. [DOI] [PubMed] [Google Scholar]
- 9.Iatta R, Nuccio F, Immediato D, Mosca A, De Carlo C, Miragliotta G, Parisi A, Crescenzo G, Otranto D, Cafarchia C. 2016. Species distribution and in vitro azole susceptibility of Aspergillus section Nigri isolates from clinical and environmental settings. J Clin Microbiol 54:2365–2372. doi: 10.1128/JCM.01075-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Rodriguez-Tudela JL, Alcazar-Fuoli L, Mellado E, Alastruey-Izquierdo A, Monzon A, Cuenca-Estrella M. 2008. Epidemiological cutoffs and cross-resistance to azole drugs in Aspergillus fumigatus. Antimicrob Agents Chemother 52:2468–2472. doi: 10.1128/AAC.00156-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Balashov SV, Gardiner R, Park S, Perlin DS. 2005. Rapid, high-throughput, multiplex, real-time PCR for identification of mutations in the cyp51A gene of Aspergillus fumigatus that confer resistance to itraconazole. J Clin Microbiol 43:214–222. doi: 10.1128/JCM.43.1.214-222.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.da Silva Ferreira ME, Capellaro JL, dos Reis Marques E, Malavazi I, Perlin D, Park S, Anderson JB, Colombo AL, Arthington-Skaggs BA, Goldman MH, Goldman GH. 2004. In vitro evolution of itraconazole resistance in Aspergillus fumigatus involves multiple mechanisms of resistance. Antimicrob Agents Chemother 48:4405–4413. doi: 10.1128/AAC.48.11.4405-4413.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Blatzer M, Barker BM, Willger SD, Beckmann N, Blosser SJ, Cornish EJ, Mazurie A, Grahl N, Haas H, Cramer RA. 2011. SREBP coordinates iron and ergosterol homeostasis to mediate triazole drug and hypoxia responses in the human fungal pathogen Aspergillus fumigatus. PLoS Genet 7:e1002374. doi: 10.1371/journal.pgen.1002374. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Blosser SJ, Cramer RA. 2012. SREBP-dependent triazole susceptibility in Aspergillus fumigatus is mediated through direct transcriptional regulation of erg11A (cyp51A). Antimicrob Agents Chemother 56:248–257. doi: 10.1128/AAC.05027-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Buied A, Moore CB, Denning DW, Bowyer P. 2013. High-level expression of cyp51B in azole-resistant clinical Aspergillus fumigatus isolates. J Antimicrob Chemother 68:512–514. doi: 10.1093/jac/dks451. [DOI] [PubMed] [Google Scholar]
- 16.Ohara S, Tazawa Y, Tanai C, Tanaka Y, Noda H, Horiuchi H, Usui K. 2016. Clinical characteristics of patients with Aspergillus species isolation from respiratory samples: comparison of chronic pulmonary aspergillosis and colonization. Respir Investig 54:92–97. doi: 10.1016/j.resinv.2015.08.007. [DOI] [PubMed] [Google Scholar]
- 17.Tashiro T, Izumikawa K, Tashiro M, Takazono T, Morinaga Y, Yamamoto K, Imamura Y, Miyazaki T, Seki M, Kakeya H, Yamamoto Y, Yanagihara K, Yasuoka A, Kohno S. 2011. Diagnostic significance of Aspergillus species isolated from respiratory samples in an adult pneumology ward. Med Mycol 49:581–587. doi: 10.3109/13693786.2010.548084. [DOI] [PubMed] [Google Scholar]
- 18.Pfaller MA, Boyken L, Hollis RJ, Kroeger J, Messer SA, Tendolkar S, Diekema DJ. 2009. In vitro susceptibility of clinical isolates of Aspergillus spp. to anidulafungin, caspofungin, and micafungin: a head-to-head comparison using the CLSI M38-A2 broth microdilution method. J Clin Microbiol 47:3323–3325. doi: 10.1128/JCM.01155-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Espinel-Ingroff A, Diekema DJ, Fothergill A, Johnson E, Pelaez T, Pfaller MA, Rinaldi MG, Canton E, Turnidge J. 2010. Wild-type MIC distributions and epidemiological cutoff values for the triazoles and six Aspergillus spp. for the CLSI broth microdilution method (M38-A2 document). J Clin Microbiol 48:3251–3257. doi: 10.1128/JCM.00536-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Espinel-Ingroff A, Cuenca-Estrella M, Fothergill A, Fuller J, Ghannoum M, Johnson E, Pelaez T, Pfaller MA, Turnidge J. 2011. Wild-type MIC distributions and epidemiological cutoff values for amphotericin B and Aspergillus spp. for the CLSI broth microdilution method (M38-A2 document). Antimicrob Agents Chemother 55:5150–5154. doi: 10.1128/AAC.00686-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Gautier M, Normand AC, L'Ollivier C, Cassagne C, Reynaud-Gaubert M, Dubus JC, Brégeon F, Hendrickx M, Gomez C, Ranque S, Piarroux R. 2016. Aspergillus tubingensis: a major filamentous fungus found in the airways of patients with lung disease. Med Mycol 54:459–470. doi: 10.1093/mmy/myv118. [DOI] [PubMed] [Google Scholar]
- 22.Zhu H, Qu F, Zhu LH. 1993. Isolation of genomic DNAs from plants, fungi and bacteria using benzyl chloride. Nucleic Acids Res 21:5279–5280. doi: 10.1093/nar/21.22.5279. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 61:1323–1330. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Clinical and Laboratory Standards Institute. 2008. Reference method for broth dilution antifungal susceptibility testing of filamentous fungi; approved standard—2nd ed, CLSI document M38-A2. Clinical and Laboratory Standards Institute, Wayne, PA. [Google Scholar]
- 25.Kikuchi K, Watanabe A, Ito J, Oku Y, Wuren T, Taguchi H, Yarita K, Muraosa Y, Yahiro M, Yaguchi T, Kamei K. 2014. Antifungal susceptibility of Aspergillus fumigatus clinical isolates collected from various areas in Japan. J Infect Chemother 20:336–338. doi: 10.1016/j.jiac.2014.01.003. [DOI] [PubMed] [Google Scholar]
- 26.Hagiwara D, Takahashi-Nakaguchi A, Toyotome T, Yoshimi A, Abe K, Kamei K, Gonoi T, Kawamoto S. 2013. NikA/TcsC histidine kinase is involved in conidiation, hyphal morphology, and responses to osmotic stress and antifungal chemicals in Aspergillus fumigatus. PLoS One 8:e80881. doi: 10.1371/journal.pone.0080881. [DOI] [PMC free article] [PubMed] [Google Scholar]