Skip to main content
PMC home page
Molecular Oncology logoLink to Molecular Oncology
. 2008 Sep 16;2(4):349–355. doi: 10.1016/j.molonc.2008.09.001

Circulating tumour cells as a predictive factor for response to systemic chemotherapy in patients with advanced colorectal cancer

Silke Lankiewicz 1,✉, Silke Zimmermann 1, Christiane Hollmann 2, Tina Hillemann 3, Tim F Greten 3
PMCID: PMC5527776  PMID: 19383356

Abstract

Circulating tumour cells (CTC) can be traced in patients with different types of cancer. The aim of this study was to detect CTC in patients with advanced colorectal cancer and whether CTC are still detectable after systemic chemotherapy. Blood from 34 patients with advanced colorectal cancer was analysed for the presence of CTC before chemotherapy was given and after 3months. Eleven patients demonstrated a tumour remission after chemotherapy. In 6 cases CTC were detectable before but not after initiation of chemotherapy. Ten patients demonstrated a progression. In 5 cases CTC were detected before and after chemotherapy. Our data suggest that the detection of CTC will help to identify patients responding to chemotherapy or with a risk of a therapy failure.

Keywords: CTC, Circulating tumour cells, Colorectal cancer, EGFR, EGFR variants

1. Introduction

The presence of circulating tumour cells (CTC) in the peripheral blood of patients with colorectal cancer (CRC) has already been noted (Cohen et al., 2006; Molnar et al., 2003; Zieglschmid et al., 2007) and their clinical relevance has been described extensively as an independent prognostic marker for disease‐free survival (Guller et al., 2002; Koch et al., 2006; Thorban et al., 2006). CTC could be used as surrogate markers to monitor drug effects and clinical status (Elshimali and Grody, 2006). If a patient responds to an administered therapy, CTC should be no longer detectable in peripheral blood. Therefore, patients with CTC might be potential candidates for relapse and therapy failure.

Besides chemotherapeutic agents like 5‐fluorouracil (5‐FU), folinic acid (FA), oxaliplatin and irinotecan, targeted therapies including therapeutic antibodies are administered in combination or in chemotherapeutic resistant patients. Bevacizumab, panitumumab and cetuximab are already approved and the latter is used in daily practice with metastatic CRC patients as a target antibody for epidermal growth factor receptor (EGFR) (Pfeiffer et al., 2007). EGFR, a transmembrane receptor tyrosine kinase is activated by binding of the natural ligand epidermal growth factor (EGF) or transforming growth factor α (TGFα). The therapeutic antibodies cetuximab and panitumumab bind to EGFR with high affinity and therefore prevent the binding of EGF or TGFα. This results in reduced receptor tyrosine kinase activity and in reduced cell proliferation, cell survival and cell invasion.

In most studies patients with metastasised CRC have an extended time to tumour progression if they were treated with antibody based therapies independent of the EGFR status of the primary tumour (Meropol, 2005; Pfeiffer et al., 2007; Zhang et al., 2006). EGFR expression analysis by immunohistochemical staining of tumour sections correlates only in some cases with tumour response to EGFR targeted therapy and is therefore of limited help for the identification of patients possibly responding to EGFR antibody therapy (Chung et al., 2005; Cunningham et al., 2004; Nygren et al., 2005; Vallböhmer et al., 2005). Genetic alterations of the extracellular domain of the EGF receptor or different EGFR expression pattern in the primary tumour and metastasis or CTC can both lead to treatment failure despite immunohistochemically detected EGFR expression in tumour biopsies (Bralet et al., 2005; Italiano et al., 2005; Scartozzi et al., 2004).

This pilot study was performed to determine the predictive value of CTC. Blood obtained from CRC patients was examined by immunomagnetic enrichment with subsequent RT‐PCR techniques for the circulation of tumour cells before and after therapy. Peripheral blood from patients with chronic inflammatory bowel disease was used as a control group to demonstrate the specificity of CTC detection on patients with colorectal cancer. We hypothesized that successful chemotherapy should lead to a decreased number of CTC, which will then lead to a negative PCR result. PCR results were compared with clinical responses. Another aim of the study was to determine the expression of EGFR variants on CTC to identify additional patients who might not profit from EGFR antibody targeted therapies because of the deletion of extracellular binding sites.

2. Patients and methods

2.1. Patients and study design

A total number of 34 CRC patients (20 males, 14 females) with advanced disease were enrolled before and 3months after chemotherapeutic treatment at the Department of Gastroenterology, Hepatology and Endocrinology of the Hannover Medical School, Germany. Peripheral blood from 64 patients with Crohn's disease (13 males, 19 females) or ulcerative colitis (19 males, 13 females) was also tested to evaluate the specificity of the test used. Informed consent was obtained from all patients prior to obtaining blood samples; the Ethics Committee of the Hannover Medical School approved the study protocol. The following parameters were recorded for all patients: age, sex, diagnosis, serum carcinoembryonic antigen (CEA) and the presence of CTC. Additionally the following parameters were recorded for the CRC patients: TNM classification of the primary tumour, status of disease clinically validated by computer tomography before and 3months after treatment classified according to WHO criteria.

2.2. Tumour cell enrichment and multiplex RT‐PCR

Peripheral blood (2×5ml) from each patient was collected in EDTA tubes (Sarstedt AG & Co, Nümbrecht, Germany) and processed within 4h for the enrichment of CTC and subsequent expression analyses. For the detection of CTC the AdnaTest ColonCancerSelect and AdnaTest ColonCancerDetect (AdnaGen AG, Langenhagen, Germany) were employed according to the manufacturer's protocol. The combination of immunomagnetic tumour cell enrichment and the analysis of tumour‐associated transcripts EGFR, CEA and GA733‐2 (gastrointestinal tumour‐associated antigen 733‐2) by multiplex RT‐PCR were previously described (Zieglschmid et al., 2005). Actin was amplified as an internal PCR control. PCR products were analysed with DNA 1000 assays using an Agilent 2100 Bioanalyzer (Analysis Software 2100 expert, version B.02.03.SI307, Agilent Technologies, Böblingen, Germany). A threshold of <0.1ng/μl was defined as negative. The cDNA was also used for the detection of different extracellular EGFR variants.

2.3. PCR amplification of extracellular EGFR variants from CTC

The PCR for the detection of extracellular EGFR variants in CTC was previously described (Lankiewicz et al., in press). In brief, the PCR was performed under the following conditions: Two primer pairs (EGFR P1 5′‐AAACTGCACCTCCATCAGTG‐3′/EGFR P2 5′‐ATTCGTTGGACAGCCTTCAAG‐3′ and EGFR P3 5′‐GTCCAGTATTGATCGGGAGAGC‐3′/EGFR P4 5′‐GAGCCGTGA TCTGTCACCAC‐3′) were designed to span exon 9 to exon 16 and exon 1 to exon 8, respectively; 1.0μM of each primer and 25μl of HotStarTaq Mix (Qiagen GmbH, Hilden, Germany) were used. The PCR program was set for 15min at 95°C, followed by 45 cycles of 94°C for 30s, 60°C (for P1/P2) or 63°C (for P3/P4) for 30s and 72°C for 1min (for P1/P2) or 2min (for P3/P4), followed by a final step of 72°C for 5min. The analyses of the PCR fragments were performed with DNA 1000 (for fragments detected with P1/P2) or DNA 7500 assays (for fragments detected with P3/P4) and an Agilent 2100 Bioanalyzer (Analysis Software 2100 expert, version B.02.03.SI307, Agilent Technologies, Böblingen, Germany) according to the manufacturer's instructions.

2.4. Determination of serum CEA

CEA levels were determined using standard assays (Modular Analytics <E 170>, Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's instructions. The results were evaluated using a threshold of >3mg/l defined as positive.

3. Results and discussion

3.1. Detection of CTC and determination of CEA serum levels in CRC patients and patients with inflammatory bowel diseases

Two blood samples were taken from patients with advanced colorectal cancer, one before the start of chemotherapy and one after 3months. CTC were analysed in both samples and CEA levels were determined. CTC were detected in 20/34 (59%) patients prior to chemotherapy (Table 1); 28/34 patients (82%) showed positive CEA serum levels; 17/20 patients (85%) with detectable CTC also showed elevated CEA serum; 14/34 patients (41%) were negative for CTC prior to therapy, elevated CEA values were detected in 11 of these patients (79%); 5/34 patients dropped out.

Table 1.

Comparison of CTC with clinical outcome after therapy of colorectal cancer patients

Patient‐ID Therapy Clinical validation CTC Serum CEA
Prior to therapy Post therapy Prior to therapy Post therapy
2 5‐FU/FA/CTP 11/bevacizumab PD − − + +
9 5‐FU/FA/CTP 11/bevacizumab PD + + + +
11 5‐FU/FA/oxaliplatin PD + + + +
16 5‐FU/FA/oxaliplatin PD − − + +
18 5‐FU/FA/CPT 11 PD + + + +
20 5‐FU/FA PD + − + +
23 5‐FU/FA/mitomycin‐C PD + + + +
27 5‐FU/FA/oxaliplatin PD − − + +
32 5‐FU/FA/oxaliplatin/cetuximab PD + + + +
33 5‐FU/FA/CPT 11 PD − − + +
5 5‐FU/FA/oxaliplatin SD + − − +
10 5‐FU/FA/CPT 11/cetuximab SD − − + +
13 5‐FU/FA/oxaliplatin SD − + + +
17 Capecitabin/CPT 11 SD + − + +
19 5‐FU/FA/CPT 11/cetuximab SD + + + +
28 5‐FU/FA/oxaliplatin SD − − − −
29 5‐FU/FA/oxaliplatin SD − − + +
31 5‐FU/FA/oxaliplatin/bevacizumab SD − − + +
4 5‐FU/FA/oxaliplatin/bevacizumab R + + + +
7 5‐FU/FA/oxaliplatin R + − − −
12 5‐FU/FA/CTP 11 R + − + +
14 5‐FU/FA/oxaliplatin/bevacizumab R + − + +
15 5‐FU/FA/oxaliplatin/bevacizumab R + − + +
21 5‐FU/FA/oxaliplatin/bevacizumab R + + + +
22 5‐FU/FA/oxaliplatin/bevacizumab R + − + +
24 5‐FU/FA R − − − −
25 5‐FU/FA/oxaliplatin/bevacizumab R − − + +
26 5‐FU/FA/oxaliplatin R − − + −
30 5‐FU/FA/CPT 11/cetuximab R + − + −
Open in a new tab

5‐FU, 5‐flourouracil; FA, folinic acid; CTP 11, irinotecan‐HCl; PD, progression; SD, stable disease; R, remission; +, positive; −, negative.

After 3months of chemotherapy CTC were still detected in 9/29 patients (31%); 24/29 patients showed elevated CEA serum levels (83%) and 5/29 patients were negative for CEA serum levels (17%). CEA levels were increased in all patients in which CTC were still detectable after 3months of chemotherapy. No CTC were detectable in 20/29 patients after chemotherapeutic treatment. In some patients, CTC seem to decrease under therapy in contrast to CEA serum levels which remain unaffected. Therefore, CTC may be more suitable for monitoring a therapy response.

To determine the specificity of the assay used we also analysed peripheral blood from patients with chronic inflammatory bowel disease. Therefore, peripheral blood from patients with Crohn's disease (n=32) and ulcerative colitis (n=32) was analysed. CTC were detected in 7/32 patients with Crohn's disease as well as 8/32 patients with ulcerative colitis. None of these patients developed colorectal cancer 30months after the assay was performed. No correlation between the detection of CTC and disease activity was observed. However, since inflammatory bowel diseases are regarded as possible pre‐cancerous the potentiality to evolve a tumour remains. All patients with Crohn's disease and ulcerative colitis were negative for CEA serum levels (data not shown). This is in concordance with the expression of CEA on the mRNA level. Expression of CEA could be detected in only one patient with Crohn's disease. The specificity for the isolation and analyses of CTC in blood from healthy donors was >98% as described in Zieglschmid et al. (2007).

3.2. Detection of CTC in patients with advanced CRC before and after therapy

Blood samples of 34 patients with advanced CRC were analysed before therapy, 5 patients dropped out. Therefore, complete results of 29 patients were available (Table 1).

After therapy, 10/29 patients (34%) showed radiological tumour progression. CTC could be detected prior to and post therapy in 5/10 patients (50%) as shown in Figure 1 suggesting that detection of CTC might correlate with the progressive tumour burden. Only in 1/10 patients (10%) did the status change from CTC‐positive prior to therapy to CTC‐negative post chemotherapy. One possible explanation might be a change in the expression profile of the CTC in response to a therapy as described later. In 4/10 patients (40%) CTC could not be detected either before or after chemotherapy. In these patients it was not possible to make a statement about the response to therapy.

Figure 1.

Figure 1

Open in a new tab

Detection of CTC in CRC patients before and post therapy compared to clinical outcome. The analysis includes 29 patients. CTC were detected with AdnaTest ColonCancer and clinical outcome was determined with computer tomography. PD, progressive disease; SD, stable disease; R, remission; +, positive; −, negative.

Radiological remission was shown in 11/29 patients (38%). CTC were detected in peripheral blood from 6/11 patients (55%) prior to the start of chemotherapy but no CTC were detected in peripheral blood after chemotherapy indicating that the deletion of CTC might be a surrogate marker for response to chemotherapy. Only 2/11 (18%) patients were positive for CTC before beginning chemotherapy as well as 3months after therapy. No CTC were isolated in 3/11 (27%) patients before and after initiation of chemotherapy.

Radiologically stable disease was shown in 8/29 (28%) patients. Different results were obtained in this group of patients. No CTC were detected in 4/8 patients (50%) before and 3months after chemotherapeutic treatment, whereas CTC were still detectable after treatment in one patient. No CTC were found after treatment in 2/8 patients (25%), while no CTC were detectable in one patient before and after chemotherapy treatment.

The clinical relevance of CTC in the peripheral blood of patients with CRC (Cohen et al., 2006; Zieglschmid et al., 2007) and their usefulness as surrogate markers to monitor drug effects in metastasised breast cancer patients is an intense matter of debate (Hayes et al., 2006). Our data suggest that the analysis of CTC could be used as a surrogate marker to monitor tumour responses in patients with advanced colorectal cancer. In our study CTC were detected in peripheral blood from the majority of blood samples (59%) obtained prior to therapy. This number decreased to 31% in patients after treatment with chemotherapy. Similar results were obtained in patients with advanced breast cancer using the CellSearch system (Budd et al., 2006; Cristofanilli et al., 2005; Hayes et al., 2006). In contrast to the assay for the isolation and enumeration of CTC described in these studies we isolated CTC, analysed expression of tumour‐associated transcripts by PCR and used this assay to investigate the efficacy of chemotherapies in advanced CRC patients.

3.3. Expression profiling of CTC in patients with advanced CRC before and post therapy

The expression profile of circulating tumour cells isolated from 20 different patients with colorectal cancer was studied in more detail. Before chemotherapy was started the tumour‐associated transcript CEA was expressed in 100% (20/20), EGFR in 10% (2/20) and GA733‐2 in 35% (7/20) of all samples analysed (Figure 2). Patients treated with chemotherapy showed a decrease in CEA expression in 7/9 cases (78%), whereas the expression of EGFR and GA733‐2 increased in 3/9 (33%) and 5/9 (56%) cases respectively. Further studies are needed to validate these findings and to verify whether the change in expression pattern is caused by the chemotherapeutic treatment. Interestingly, changing tumour cell expression patterns were also observed when we analysed CTC from patients with colorectal cancer before and after surgery of the primary tumour as well as from patients with advanced disease (Zieglschmid et al., 2007). At the time of the first diagnosis CTC from patients with colorectal cancer showed high EGFR expression and a low detection rate of CEA. On the other hand, CTC from patients with advanced disease revealed dominant CEA expression and low expression of EGFR. Contrary to the assumption that changes in the expression pattern of CTC could be caused by chemotherapeutic treatment, a different explanation might be a phenomenon called epithelial‐mesenchymal transition (EMT) which occurs during the development of metastases. Before invading the blood circulation, tumour cells have to detach from the epithelial cell structure. One way to achieve that is that the tumour cell or the CTC respectively changes its expression profile to a more mesenchymal phenotype. This procedure is often related to a down regulation of epithelial cell markers e.g. E‐cadherin and an up regulation of mesenchymal cell markers e.g. N‐cadherin (Kang and Massague, 2004). As soon as the target organ is reached the CTC reverses the expression profile via mesenchymal–epithelial transition (MET) and evades the circulation. Since EGFR is a tumour‐associated epithelial cell marker it may be another protein that underlies such changes in expression.

Figure 2.

Figure 2

Open in a new tab

Expression profile of CTC positive CRC patients before and after therapy. The analysis includes CTC positive patients determined with AdnaTest ColonCancer.

3.4. Detection of extracellular EGFR variants in CRC patients and patients with inflammatory bowel diseases

In our previous study we demonstrated a specificity of 100% for the detection of EGFR variants on CTC isolated from blood (Lankiewicz et al., in press).

We now extended our studies and tested peripheral blood obtained from patients with chronic inflammatory bowel disease, since it could be possible that inflammation associated circulating epithelial cells can be detected by the assay used in this study. cDNA from blood of patients with Crohn's disease (n=32), ulcerative colitis (n=32) and CRC patients before (n=34) and after therapy (n=29) was analysed for EGFR variants by RT‐PCR with two primer pairs to detect different extracellular isotypes (Table 2). Three patients with Crohn's disease and one patient with ulcerative colitis expressed the EGFR variant EX12_14del. A typical analysis is shown in Figure 3. None of these patients developed colon cancer within a period of 30months. However, since inflammatory bowel diseases are regarded as possible pre‐cancerous the potentialfor a tumour to evolve remains.

Table 2.

Detection of EGFR variants

EGFR variants Crohn's disease (n=32) (%) Ulcerative colitis (n=32) (%) Colorectal carcinoma before therapy (n=34) (%) Colorectal carcinoma after therapy (n=29) (%)
EX12_14del 3 (9) 1 (3) 3 (9) –
EX12_15del – – 1 (3) –
Open in a new tab

Figure 3.

Figure 3

Open in a new tab

Detection of EGFR variants in CRC patients, patients with Crohn's disease and ulcerative colitis. Amplified cDNA fragments of EGFR wild‐type and different variants were analyzed by capillary electrophoresis with the Bioanalyzer 2100 and the DNA 1000 assay (Agilent Technologies, Böblingen, Germany). For positive control cDNA of a colorectal cancer cell line (T84) was used (Lankiewicz et al., in press). L, ladder; bp, base pairs; PCR−, negative control of the PCR; C+, positive control of the PCR; CD, Crohn's disease; UC, ulcerative colitis; CRC, colorectal cancer patients, the numbers represent the patients’ ID; a, after therapy; b, before therapy; wt, wild‐type. Patient CRC 3b dropped out before completing therapy.

Before initiation of chemotherapy circulating tumour cells from three patients with colorectal cancer expressed the EGFR variant EX12_14del and one of these patients also expressed the variant EX12_15del. After therapy no expression of EGFR variants could be detected in 2 patients (Figure 3). The third patient dropped out. The remaining 2 patients had radiologically stable disease, which was confirmed by the lack of CTC detection (Table 1). Potentially, CTC with an expression of EGFR variants were eliminated by the administered therapies. For CRC patients it seems that the predominant mutation concerning EGFR is variant EX12_14del. This is in contrast to advanced breast cancer patients in whom the predominant mutation seems to be EX12_15del (Lankiewicz, 2006; Lankiewicz and Fehm, 2007). Further variants of the extracellular domain, especially EX2_7del (EGFR vIII), could not be detected either in patients with inflammatory bowel diseases or in CRC patients. This is in agreement with previous studies where no EGFR EX2_7del could be found in CRC patients (Azuma et al., 2006; Spindler et al., 2006).

The expression of EGFR variants in CRC patients seems to be tumour specific (Cunningham et al., 2005) as it is also described for glioblastoma, breast cancer, prostate cancer and NSCLC (Frederick et al., 2000; Ge et al., 2002; Ji et al., 2006; Moscatello et al., 1995; Olapade‐Olaopa et al., 2000; Wikstrand et al., 1995). Variants have never been detected in the blood of healthy donors before but results of further experiments examining tumour entities like breast or lung cancer may be shown if the present results can be confirmed in general.

In summary, our results indicate that the detection of CTC in patients with advanced CRC could become a new tool to predict response to chemotherapy, and moreover, might provide an early opportunity to change therapy concepts. Since our findings are related to a relatively small group of patients, further studies with larger numbers of advanced CRC patients would be helpful to confirm the present data. One study might focus on the patients' treatment and how specific medication might have an influence on CTC and their expression pattern. Another study's objective could be to analyse the outcome of EGFR targeted therapies regarding EGFR variants on a larger scale.

Acknowledgements

We thank Jenny Mannel and Dr Veit Zieglschmid for technical assistance. This study was supported by a grant from AdnaGen AG. At the time of investigation, Dr Silke Lankiewicz, Dr Silke Zimmermann and Dr Christiane Hollmann were full time employees of AdnaGen AG.

Lankiewicz Silke, Zimmermann Silke, Hollmann Christiane, Hillemann Tina, Greten Tim F., (2008), Circulating tumour cells as a predictive factor for response to systemic chemotherapy in patients with advanced colorectal cancer, Molecular Oncology, 2, doi: 10.1016/j.molonc.2008.09.001.

References

  1. Azuma, M. , Danenberg, K.D. , Iqbal, S. , El-Khoueiry, A. , Zhang, W. , Yang, D. , Koizumi, W. , Saigenji, K. , Danenberg, P.V. , Lenz, H.J. , 2006. Epidermal growth factor receptor and epidermal growth factor receptor variant III gene expression in metastatic colorectal cancer. Clin. Colorectal Cancer 6, 214–218. [DOI] [PubMed] [Google Scholar]
  2. Bralet, M.P. , Paule, B. , Adam, R. , Guettier, C. , 2005. Loss of epidermal growth factor receptor expression in lymph node and liver metastases of colon carcinoma. J. Clin. Oncol. 23, 5844–5845. [DOI] [PubMed] [Google Scholar]
  3. Budd, G.T. , Cristofanilli, M. , Ellis, M.J. , Stopeck, A. , Borden, E. , Miller, M.C. , Matera, J. , Repollet, M. , Doyle, G.V. , Terstappen, L.W. , 2006. Circulating tumor cells versus imaging – predicting overall survival in metastatic breast cancer. Clin. Cancer Res. 12, 6403–6409. [DOI] [PubMed] [Google Scholar]
  4. Chung, K.Y. , Shia, J. , Kemeny, N.E. , Shah, M. , Schwartz, G.K. , Tse, A. , Hamilton, A. , Pan, D. , Schrag, D. , Schwartz, L. , 2005. Cetuximab shows activity in colorectal cancer patients with tumors that do not express the epidermal growth factor receptor by immunohistochemistry. J. Clin. Oncol. 23, 1803–1810. [DOI] [PubMed] [Google Scholar]
  5. Cohen, S.J. , Alpaugh, R.K. , Gross, S. , O'Hara, S.M. , Smirnov, D.A. , Terstappen, L.W. , Allard, W.J. , Bilbee, M. , Cheng, J.D. , Hoffman, J.P. , 2006. Isolation and characterization of circulating tumor cells in patients with metastatic colorectal cancer. Clin. Colorectal Cancer 6, 125–132. [DOI] [PubMed] [Google Scholar]
  6. Cristofanilli, M. , Hayes, D.F. , Budd, G.T. , Ellis, M.J. , Stopeck, A. , Reuben, J.M. , Doyle, G.V. , Matera, J. , Allard, W.J. , Miller, M.C. , 2005. Circulating tumor cells: a novel prognostic factor for newly diagnosed metastatic breast cancer. J. Clin. Oncol. 23, 1420–1430. [DOI] [PubMed] [Google Scholar]
  7. Cunningham, D. , Humblet, Y. , Siena, S. , Khayat, D. , Bleiberg, H. , Santoro, A. , Bets, D. , Mueser, M. , Harstrick, A. , Verslype, C. , 2004. Cetuximab monotherapy and cetuximab plus irinotecan in irinotecan-refractory metastatic colorectal cancer. N. Engl. J. Med. 351, 337–345. [DOI] [PubMed] [Google Scholar]
  8. Cunningham, M.P. , Essapen, S. , Thomas, H. , Green, M. , Lovell, D.P. , Topham, C. , Marks, C. , Modjtahedi, H. , 2005. Coexpression, prognostic significance and predictive value of EGFR, EGFRvIII and phosphorylated EGFR in colorectal cancer. Int. J. Oncol. 27, 317–325. [PubMed] [Google Scholar]
  9. Elshimali, Y.I. , Grody, W.W. , 2006. The clinical significance of circulating tumor cells in the peripheral blood. Diagn. Mol. Pathol. 15, 187–194. [DOI] [PubMed] [Google Scholar]
  10. Frederick, L. , Wang, X.Y. , Eley, G. , James, C.D. , 2000. Diversity and frequency of epidermal growth factor receptor mutations in human glioblastomas. Cancer Res. 60, 1383–1387. [PubMed] [Google Scholar]
  11. Ge, H. , Gong, X. , Tang, C.K. , 2002. Evidence of high incidence of EGFRvIII expression and coexpression with EGFR in human invasive breast cancer by laser capture microdissection and immunohistochemical analysis. Int. J. Cancer 98, 357–361. [DOI] [PubMed] [Google Scholar]
  12. Guller, U. , Zajac, P. , Schnider, A. , Bosch, B. , Vorburger, S. , Zuber, M. , Spagnoli, G.C. , Oertli, D. , Maurer, R. , Metzger, U. , 2002. Disseminated single tumor cells as detected by real-time quantitative polymerase chain reaction represent a prognostic factor in patients undergoing surgery for colorectal cancer. Ann. Surg. 236, 768–775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hayes, D.F. , Cristofanilli, M. , Budd, G.T. , Ellis, M.J. , Stopeck, A. , Miller, M.C. , Matera, J. , Allard, W.J. , Doyle, G.V. , Terstappen, L.W. , 2006. Circulating tumor cells at each follow-up time point during therapy of metastatic breast cancer patients predict progression-free and overall survival. Clin. Cancer Res. 12, 4218–4224. [DOI] [PubMed] [Google Scholar]
  14. Italiano, A. , Saint-Paul, M.C. , Caroli-Bosc, F.X. , Francois, E. , Bourgeon, A. , Benchimol, D. , Gugenheim, J. , Michiels, J.F. , 2005. Epidermal growth factor receptor (EGFR) status in primary colorectal tumors correlates with EGFR expression in related metastatic sites: biological and clinical implications. Ann. Oncol. 16, 1503–1507. [DOI] [PubMed] [Google Scholar]
  15. Ji, H. , Zhao, X. , Yuza, Y. , Shimamura, T. , Li, D. , Protopopov, A. , Jung, B.L. , McNamara, K. , Xia, H. , Glatt, K.A. , 2006. Epidermal growth factor receptor variant III mutations in lung tumorigenesis and sensitivity to tyrosine kinase inhibitors. Proc. Natl. Acad. Sci. USA 103, 7817–7822. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kang, Y. , Massague, J. , 2004. Epithelial-mesenchymal transitions: twist in development and metastasis. Cell 118, 277–279. [DOI] [PubMed] [Google Scholar]
  17. Koch, M. , Kienle, P. , Kastrati, D. , Antolovic, D. , Schmidt, J. , Herfarth, C. , von Knebel Doeberitz, M. , Weitz, J. , 2006. Prognostic impact of hematogenous tumor cell dissemination in patients with stage II colorectal cancer. Int. J. Cancer 118, 3072–3077. [DOI] [PubMed] [Google Scholar]
  18. Lankiewicz, S., 2006. Novel tumor marker. EP1930345 [patent online]. Available from URL: http://v3.espacenet.com/origdoc?DB=EPODOC&;IDX=EP1930345&F=0&QPN=EP1930345.
  19. Lankiewicz, S., Fehm, T., 2007. Expression of epidermal growth factor receptor (EGFR) and N-terminal variants on circulating tumor cells in metastasized breast cancer patients, in: Proceedings of the 6th International Symposium on Minimal Residual Cancer. Hamburg, Germany, 70 (#036).
  20. Lankiewicz, S., Rother, E., Zimmermann, S., Hollmann, C., Korangy, F., Greten, T.F., in press. Tumour-associated transcripts and EGFR deletion variants in colorectal cancer in primary tumour, metastases and circulating tumour cells. Cell. Oncol. (in press). [DOI] [PMC free article] [PubMed]
  21. Meropol, N.J. , 2005. Epidermal growth factor receptor inhibitors in colorectal cancer: it's time to get back on target. J. Clin. Oncol. 23, 1791–1793. [DOI] [PubMed] [Google Scholar]
  22. Molnar, B. , Sipos, F. , Galamb, O. , Tulassay, Z. , 2003. Molecular detection of circulating cancer cells. Role in diagnosis, prognosis and follow-up of colon cancer patients. Dig. Dis. 21, 320–325. [DOI] [PubMed] [Google Scholar]
  23. Moscatello, D.K. , Holgado-Madruga, M. , Godwin, A.K. , Ramirez, G. , Gunn, G. , Zoltick, P.W. , Biegel, J.A. , Hayes, R.L. , Wong, A.J. , 1995. Frequent expression of a mutant epidermal growth factor receptor in multiple human tumors. Cancer Res. 55, 5536–5539. [PubMed] [Google Scholar]
  24. Nygren, P. , Sorbye, H. , Osterlund, P. , Pfeiffer, P. , 2005. Targeted drugs in metastatic colorectal cancer with special emphasis on guidelines for the use of bevacizumab and cetuximab: an Acta Oncologica expert report. Acta Oncol. 44, 203–217. [DOI] [PubMed] [Google Scholar]
  25. Olapade-Olaopa, E.O. , Moscatello, D.K. , MacKay, E.H. , Horsburgh, T. , Sandhu, D.P. , Terry, T.R. , Wong, A.J. , Habib, F.K. , 2000. Evidence for the differential expression of a variant EGF receptor protein in human prostate cancer. Br. J. Cancer 82, 186–194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Pfeiffer, P. , Qvortrup, C. , Eriksen, J.G. , 2007. Current role of antibody therapy in patients with metastatic colorectal cancer. Oncogene 26, 3661–3678. [DOI] [PubMed] [Google Scholar]
  27. Scartozzi, M. , Bearzi, I. , Berardi, R. , Mandolesi, A. , Fabris, G. , Cascinu, S. , 2004. Epidermal growth factor receptor (EGFR) status in primary colorectal tumors does not correlate with EGFR expression in related metastatic sites: implications for treatment with EGFR-targeted monoclonal antibodies. J. Clin. Oncol. 22, 4720–4726. [DOI] [PubMed] [Google Scholar]
  28. Spindler, K.L. , Olsen, D.A. , Nielsen, J.N. , Brandslund, I. , Poulsen, H.S. , Villingshoj, M. , Jakobsen, A. , 2006. Lack of the type III epidermal growth factor receptor mutation in colorectal cancer. Anticancer Res. 26, 4889–4893. [PubMed] [Google Scholar]
  29. Thorban, S. , Rosenberg, R. , Maak, M. , Friederichs, J. , Gertler, R. , Siewert, J.R. , 2006. Impact of disseminated tumor cells in gastrointestinal cancer. Expert Rev. Mol. Diagn. 6, 333–343. [DOI] [PubMed] [Google Scholar]
  30. Vallböhmer, D. , Zhang, W. , Gordon, M. , Yang, D.Y. , Yun, J. , Press, O.A. , Rhodes, K.E. , Sherrod, A.E. , Iqbal, S. , Danenberg, K.D. , 2005. Molecular determinants of cetuximab efficacy. J. Clin. Oncol. 23, 3536–3544. [DOI] [PubMed] [Google Scholar]
  31. Wikstrand, C.J. , Hale, L.P. , Batra, S.K. , Hill, M.L. , Humphrey, P.A. , Kurpad, S.N. , McLendon, R.E. , Moscatello, D. , Pegram, C.N. , Reist, C.J. , 1995. Monoclonal antibodies against EGFRvIII are tumor specific and react with breast and lung carcinomas and malignant gliomas. Cancer Res. 55, 3140–3148. [PubMed] [Google Scholar]
  32. Zhang, W. , Gordon, M. , Lenz, H.J. , 2006. Novel approaches to treatment of advanced colorectal cancer with anti-EGFR monoclonal antibodies. Ann. Med. 38, 545–551. [DOI] [PubMed] [Google Scholar]
  33. Zieglschmid, V. , Hollmann, C. , Gutierrez, B. , Albert, W. , Strothoff, D. , Gross, E. , Böcher, O. , 2005. Combination of immunomagnetic enrichment with multiplex RT-PCR analysis for the detection of disseminated tumor cells. Anticancer Res. 25, 1803–1810. [PubMed] [Google Scholar]
  34. Zieglschmid, V. , Hollmann, C. , Mannel, J. , Albert, W. , Jaeschke-Melli, S. , Eckstein, B. , Hillemann, T. , Greten, T.F. , Gross, E. , Böcher, O. , 2007. Tumor-associated gene expression in disseminated tumor cells correlates with disease progression and tumor stage in colorectal cancer. Anticancer Res. 27, 1823–1832. [PubMed] [Google Scholar]

Articles from Molecular Oncology are provided here courtesy of Wiley

RESOURCES