Skip to main content
Molecular Oncology logoLink to Molecular Oncology
. 2012 Sep 11;7(1):85–100. doi: 10.1016/j.molonc.2012.08.002

Polymorphic variations in the FANCA gene in high‐risk non‐BRCA1/2 breast cancer individuals from the French Canadian population

Nadhir Litim 1,†, Yvan Labrie 1,†, Sylvie Desjardins 1, Geneviève Ouellette 1, Karine Plourde 1, Pascal Belleau 1; INHERIT BRCAs1,‡, Francine Durocher 1,✉
PMCID: PMC5528405  PMID: 23021409

Abstract

The majority of genes associated with breast cancer susceptibility, including BRCA1 and BRCA2 genes, are involved in DNA repair mechanisms. Moreover, among the genes recently associated with an increased susceptibility to breast cancer, four are Fanconi Anemia (FA) genes: FANCD1/BRCA2, FANCJ/BACH1/BRIP1, FANCN/PALB2 and FANCO/RAD51C. FANCA is implicated in DNA repair and has been shown to interact directly with BRCA1. It has been proposed that the formation of FANCA/G (dependent upon the phosphorylation of FANCA) and FANCB/L sub‐complexes altogether with FANCM, represent the initial step for DNA repair activation and subsequent formation of other sub‐complexes leading to ubiquitination of FANCD2 and FANCI. As only approximately 25% of inherited breast cancers are attributable to BRCA1/2 mutations, FANCA therefore becomes an attractive candidate for breast cancer susceptibility. We thus analyzed FANCA gene in 97 high‐risk French Canadian non‐BRCA1/2 breast cancer individuals by direct sequencing as well as in 95 healthy control individuals from the same population. Among a total of 85 sequence variants found in either or both series, 28 are coding variants and 19 of them are missense variations leading to amino acid change. Three of the amino acid changes, namely Thr561Met, Cys625Ser and particularly Ser1088Phe, which has been previously reported to be associated with FA, are predicted to be damaging by the SIFT and PolyPhen softwares. cDNA amplification revealed significant expression of 4 alternative splicing events (insertion of an intronic portion of intron 10, and the skipping of exons 11, 30 and 31). In silico analyzes of relevant genomic variants have been performed in order to identify potential variations involved in the expression of these spliced transcripts. Sequence variants in FANCA could therefore be potential spoilers of the Fanconi‐BRCA pathway and as a result, they could in turn have an impact in non‐BRCA1/2 breast cancer families.

Keywords: Breast cancer susceptibility, FANCA variants, Fanconi anemia, Alternative splicing

1. Introduction

Pathogenic germline mutations in BRCA1, BRCA2, TP53, ATM, CHEK2, BRIP1, PALB2 and RAD51C genes have been associated with an increased breast cancer risk and, together, are found in less than 25% of breast cancer families showing a clear pattern of inheritance (Stratton and Rahman, 2008; Wang, 2007; Moldovan and D'Andrea, 2009). Thus, it is clear that other susceptibility alleles remain to be identified to explain the increased susceptibility in the remnant high‐risk families. As the number and characteristics of such alleles are undetermined, a focussed candidate gene approach based on genes closely interacting with the known susceptibility genes (in particular BRCA1 and BRCA2) constitutes a study design of choice to identify rare moderate‐penetrance susceptibility alleles.

It is noteworthy that of the genes recently associated with an increased susceptibility to breast/ovarian cancer, four are Fanconi Anemia (FA) genes: FANCD1/BRCA2, FANCJ/BACH1/BRIP1, FANCN/PALB2, and FANCO/RAD51C (Somyajit et al., 2010; Cantor et al., 2001, 2004; Seal et al., 2006; Rahman et al., 2007; Erkko et al., 2007; Pang et al., 2011; Zheng et al., 2010; Meindl et al., 2010), therefore connecting FA proteins to homologous recombination repair (HR).

FANCA is the most frequently mutated gene in FA, representing 60–70% of the cases. FANCA is highly polymorphic, with over 350 unique mutations reported (Fanconi Mutation Database; http://www.rockefeller.edu/fanconi/mutate), including large genomic deletions mediated by the unusually high density of ALU repetitions found in its genomic sequence (Levran et al., 2005). For FANCA, an association of sequence alterations or altered expression have been suggested in some instances of ovarian cancer and leukemia (Thompson et al., 2005; Lensch et al., 2003; Tischkowitz et al., 2008). In addition, homozygous mutations of FANCA were also associated with esophageal cancer in Iranian population (Akbari et al., 2011).

FA proteins not only interact with each other but also work in a network of processes implicated in the maintenance of genome integrity during DNA replication and following some types of DNA damage. When activated, the FANCI/D2 complex associates with chromatin and colocalizes in DNA damage‐induced S‐phase foci with DNA repair response proteins such as BRCA1, FANCD1/BRCA2, FANCJ, RAD51, PCNA and NBS1 to form the complex II (Wang, 2007; Raschle et al., 2008; Knipscheer et al., 2009).

It has been proposed that the formation of FANCA/G (dependent upon the phosphorylation of FANCA) and FANCB/L subcomplexes altogether with FANCM, represents the initial step for DNA repair activation and for regulating the nuclear accumulation of FANCL, and therefore the subsequent formation of other subcomplexes and ubiquitination of FANCD2 and FANCI (Medhurst et al., 2006). It is worth mentioning that FANCA protein has been also shown to interact with ERCC4 (Sridharan et al., 2003), FANCC (Reuter et al., 2000), FANCF (de Winter et al., 2000), FANCE (Medhurst et al., 2001), BRCA1 (Folias et al., 2002) and SMARCA4 (Otsuki et al., 2001).

As a direct and constitutive interaction between FANCA and BRCA1 has been shown to occur in the cell (Folias et al., 2002), and the close connection between the FANC and BRCA1/2 proteins in DNA repair, we screened the proximal promoter, the coding sequence and intron–exon boundaries of the FANCA gene in a cohort of 97 BRCA1/2‐negative (BRCAX) breast cancer families from the French Canadian population as well as 95 healthy controls from the same origin for sequence variations or splicing variants that could modulate breast cancer risk.

2. Material and methods

2.1. Ascertainment of families and DNA purification

Recruitment of high‐risk French Canadian breast/ovarian families (i.e. families in which multiple cases of breast/ovarian cancer are present in close relatives – 3 cases in 1st or 4 cases in 2nd degree relatives – or with strong evidence of a familial component) was part of the major interdisciplinary research program INHERIT BRCAs further explained elsewhere, in which a major component was to identify and characterize BRCA1/2 mutations (Simard et al., 2007). A subset of 97 high‐risk French Canadian breast/ovarian cancer families was drawn from the initial study based on the absence of detectable BRCA1/2 mutation (so‐called BRCAX) and constituted the cohort used for another study specifically aiming at the identification of other susceptibility loci/genes to breast cancer. This latter study obtained ethics approvals from all participating institutions, and each participant, knowing their inconclusive BRCA1/2 test results signed a specific informed consent, had to be at least 18 years of age and mentally capable. One individual affected with breast cancer per family was selected for analysis, with a selection preference for the youngest subject available in the family. The ascertainment criteria of recruitment and BRCA1/2 status analysis have been described previously (Antoniou et al., 2006; Durocher et al., 2006). In all instances, diagnosis of breast cancer was confirmed by pathology reports.

A cohort of 95 healthy unrelated individuals from the French Canadian population was also included in the study. They were obtained from Dr Damian Labuda at the Centre de Cancérologie Charles Bruneau, Hôpital Ste‐Justine, Montreal, Canada. The individuals who provided these samples were recruited on a non‐nominative basis, in the framework of long‐term studies aiming the characterization of the genetic variability in human populations, approved by the Institutional Ethic Review Board. Blood samples were taken for each participant. Details of the clinical procedures and BRCA1/2 testing methodology are described elsewhere (Simard et al., 2007; Desjardins et al., 2008, 2009). Genomic DNA extraction of the 97 BRCAX breast cancer cases as well as 95 healthy individuals has been performed as previously described (Durocher et al., 2006).

Additional control genotyping data coming from the French Canadian population were extracted either from the CARTaGENE database (n = 140) or from the asthma familial collection of Saguenay–Lac‐Saint‐Jean (NorthEastern region of the province of Quebec in Canada) (n = 254 unrelated subjects with asthma frequency similar to general population, i.e. 10%). To assess whether the frequencies of the rare significant DNA variants (n = 4, namely c.‐1C/A (NA), c.894‐8A/G (rs1164881), c.1627‐32T/C (rs17226337) and c.3348 + 18A/G (rs1800347)) detected in our study might be caused by population stratification, these variant were genotyped in a second French Canadian cohort comprising 192 subjects selected at random from the CRCHUQ glaucoma DNA bank (Vincent Raymond).

2.2. RNA isolation from immortalized cell lines and cDNA synthesis

Lymphocytes were isolated and immortalized from 7 to 9 ml of blood samples using the Epstein–Barr Virus (EBV) in 15% RPMI media as previously described (Durocher et al., 2006). Total RNA was extracted from EBV‐transformed β‐lymphoblastoid cell lines and seven breast cancer cell lines obtained from the American Type Culture Collection (ATCC) including, two estrogen receptor (ER)‐negative breast cancer cell lines (BT‐20 and MDA ‐231), five ER + breast cancer cell lines (SUM‐40, CAMA‐1, MCF7, T47D and SKBR3) as well as the MCF‐10A human epithelial cell line which was used as control, using TRI REAGENT® (Molecular Research Center, inc., Cincinnati, OH, USA) according to the manufacturer's instructions. The purified RNA was stored at −80 °C until use. Following RNA extraction, reverse transcription of 5 μg of RNA was performed as previously described (Durocher et al., 2006).

2.3. PCR amplification, mutation analysis and variant characterization

The coding and 5′UTR (comprising the proximal promoter region) sequences, including intron‐exon boundaries of the FANCA gene (NM_000135.2) was amplified and sequenced using primers listed in Supplemental Table 1. Sequencing of all 43 exons was performed on breast cancer cases and control individuals using the Big Dye 3.1 chemistry and loaded on an ABI3730XL automated sequencer according to the manufacturer's instructions (Applied Biosystems, Foster City, USA). Analysis of sequence data was done using the Staden package. Allelic frequency was evaluated in both series by means of a Chi2 test. p‐values less than 0.05 were considered as significant. Protein and nucleotide sequence alignments with other species were performed using data extracted from the National Center for Biotechnology Information (NCBI) and UCSC databases.

2.4. In silico analyzes

The SIFT and PolyPhen web‐based softwares were used to predict the effect of amino acid substitution on protein structure (Ng and Henikoff, 2003; Sunyaev et al., 2001; Ramensky et al., 2002). Assessment of the putative deleterious effect of FANCA missense substitutions was also performed with the ALIGN‐GVGD algorithm (Tavtigian et al., 2006; Mathe et al., 2006) using a full‐length alignment of validated and predicted FANCA sequences (produced by aligning human FANCA exons to the genomic sequences) selected from the NCBI and Ensembl databases. The alignment was made using T‐Coffee (Notredame et al., 2000) and was followed by minor handmade adjustments.

The prediction of the effect of a given variant on exonic and intronic splicing modulators was assessed using the Human Splicing Finder (HSF) (Desmet et al., 2009) which contains all available matrices from auxiliary sequence prediction softwares such as ESEfinder 3.0 program (Cartegni et al., 2003; Smith et al., 2006) for binding sites of the 9G8, Tra2‐β and hnRNP A1 proteins. The putative impact of intronic variants on splice consensus sites was evaluated using Splice Site Prediction programs using Neural Networks (SSPNN) (Reese et al., 1997) with default parameters.

2.5. Alternative splicing analysis

Screening for evaluating alternative splicing events (ASEs) occurring in FANCA gene was performed by PCR amplification on cDNA on a subset of 10 breast cancer cases using the primers described below. Following screening of the whole cDNA sequence, targeted ASE amplification of cDNA regions covering exons 6–15 and 26–33 was performed on cDNA from BRCAX individuals and human cell lines using the following primers: Exons 6–15, Forward primer: 5′‐cattgtgagcctgcaagagctg‐3′ and Reverse primer: 5′‐cttcttgctgcagccatggtag‐3′; Exons 26–33, Forward primer: 5′‐agcctcctgacctgtaggacga‐3′ and Reverse primer: 5′‐gaagaactgctcgcatctggc‐3′.

2.5.1. QRT‐PCR assays

QRT‐PCR assays were performed on StepOnePlus™ Real‐Time PCR Systems. For all the assays, a reaction mixture was prepared in a final volume of 20 μl with Fast SYBR® Green Master Mix (Applied Biosystems) which included 500 nM of each primer for FANCA wild‐type and alternative transcript variants. cDNA samples were reverse‐transcribed from total RNA. To perform fluorescent‐based real‐time PCR, the amount of cDNA used for quantitation was 20 ng of total RNA coming from the immortalized cell lines of the carriers of the variants, as well as ten wild type individuals. The primer sequences were; FANCA wild‐type exon 10–11: forward primer: 5′ cacggttgatgtactgcagagaa 3′, reverse primer: 5′ actgaacactccgaaccagca 3′; FANCA deletion of the exon 11 splice transcript: forward primer: 5′ cacggttgatgtactgcagagaa 3′, reverse primer: 5′ ctgaacagcatcagatgcagc 3′; FANCA insertion of the intronic fragment 10A splice transcript forward primer: 5′ cacggttgatgtactgcagagaa 3′, reverse primer: 5′ tcctcctcacgcacgttatcg 3′; FANCA wild‐type exon 30–31: forward primer: 5′ tccgagaggtgttgaaagagg 3′, reverse primer: 5′ ggtcataactccttgagctttgg 3′; FANCA deletion of the exon 30 splice transcript forward primer: 5′ tccgagaggtgttgaaagagg 3′, reverse primer: 5′ ggtcataactccttgagcgttca 3′; FANCA deletion of the exon 31 splice transcript forward primer: 5′ tccgagaggtgttgaaagagg 3′, reverse primer: 5′ ggtcagctaccatctcctttgg 3′. Expression analyzes were then carried out using the ΔΔCt method.

2.5.2. Polysome analysis

12x107 cells were suspended in 3 volumes of RNAse‐free lysis buffer (250 mM sucrose solution, Cycloheximide 10 mg/ml, KCl 25 mM, MgCl2 5 mM, tris HCl 50 mM, DTT 2 mM) containing NP40 (0.5%), Roche protease tablet and phosphatase inhibitor 1×. The cells were homogenized in the solution and incubated 10 min on ice. The nuclei were pelleted by centrifugation at 750 g for 10 min at 4 °C. The supernatant was then centrifuged at 12,000 g for 10 min to pellet the mitochondria. The supernatant was loaded onto linear gradient of 15–45% sucrose (W/W) and centrifuged at 38,000 rpm for 2 h at 4 °C in Bekman SW‐41 Ti rotor. As a control, equivalent supernatants were prepared and centrifuged in sucrose gradient in buffers in which MgCl2 was replaced by 10 mM EDTA. The absorbance of the gradients at 260 nm was determined and the gradients were fractionated manually. RNA extraction: SDS was added to a final concentration of 2% and proteinase K to a final concentration of 100 μg/ml to each sucrose gradient fraction for 1 h at 37 °C. An equal volume of phenol:chloroform (1:1) was then added to each fraction. The sucrose gradient fractions were concentrated by two precipitations with ethanol and dissolved in DEPC water.

2.6. Electronic databases

ESE Finder: http://rulai.cshl.edu/cgi‐bin/tools/ESE3/esefinder.cgi

Human Splicing Finder (HSF): http://www.umd.be/HSF

Splice Site Prediction Program using Neural Networks (SSPNN): (http://www.fruitfly.org/seq_tools/splice.html)

UCSC Genome Bioinformatics: http://genome.ucsc.edu/

SIFT: http://blocks.fhcrc.org/sift/SIFT.html

PolyPhen: http://genetics.bwh.harvard.edu/pph/

3. Results

Sequencing of FANCA genomic and complementary DNA of 97 BRCAX breast cancer subjects from high risk French Canadian breast/ovarian cancer families and 95 healthy controls led to the identification of sequence variants and spliced isoforms. In silico approaches provided significant knowledge concerning the potential impact of these sequence variants into splicing of exonic regions of transcripts and consequently into the potential variations involved in the expression of these spliced transcripts. The impact of a given variant in non‐BRCA1/2 breast cancer families and the potential disruption of the Fanconi‐BRCA pathway could thus justify this screening strategy.

3.1. Variant characterization

In order to perform the mutational analysis of FANCA, all 43 exons and adjacent intronic sequences were sequenced in our case and control datasets. In the 97 BRCAX breast cancer patients (1 per family) and 95 healthy individuals studied, we identified 85 sequence variants (Table 1). Among the twenty‐eight exonic variants identified, ten were found only in cases, while 5 others are found exclusively in healthy individuals. A high proportion (10 out of 28) of the exonic sequence variants were not reported in public databases or relevant publications. The c.796A/G (Thr266Ala) and c.1501G/A (Gly501Ser) are the coding variants whose corresponding frequencies show a significant difference of MAF between cases and controls with p‐values of 0.048 and 0.003, respectively. These variants are over‐represented in controls and both non‐synonymous substitutions show a high MAF >20% (Table 1). It is important to mention that to further support the frequency of the variants identified in our cohort, additional genotype data from two independent cohorts, both from the French Canadian control populations, were obtained (n = 254 and n = 140, respectively), for a total of 24 sequence variants. In addition, the four variants displaying a significant p‐value were genotyped in an additional distinct cohort of 192 control individuals, also of French Canadian origin. We were able to extract information on a total of 28 SNPs displaying a reasonable frequency for a total of 586 new control individuals.

Table 1.

Sequence variations in FANCA gene and genotype frequencies in familial breast cancer cases and controls.

SNP SNP IDa (dbSNP ID) Location Amino acid change Series (N = ) Hom Het Rare hom MAFb p‐valuec Other cohorts
1 c.‐42‐100ins13 (rs36233534) Promoter ‐ Cases (95) 59 31 5 0.216 0.146
Controls (93) 48 38 7 0.280
2 c.‐42‐76 G/C (NA) Promoter ‐ Cases (95) 95 0 0 0 0.311
Controls (93) 92 1 0 0.005
3 c.‐1C/A (NA) 5' UTR ‐ Cases (96) 92 4 0 0.021 0.047
Controls (93) 93 0 0 0 0.009f
4 c.17 T/A (rs1800282) Exon 1 Val6Asp Cases (96) 84 12 0 0.063 0.888
Controls (93) 82 11 0 0.059
5 c.343 G/A (NA) Exon 4 Gly115Arg Cases (97) 96 1 0 0.005 0.326
Controls (93) 93 0 0 0
6 c.427‐59A/G (rs2074963) Intron 4 ‐ Cases (97) 89 8 0 0.041 0.296
Controls (93) 81 12 0 0.065 0.042d
7 c.694A/C (rs61757384) Exon 7 Arg232Arg Cases (96) 94 2 0 0.010 0.157
Controls (95) 95 0 0 0
8 c.695 G/A (NA) Exon 7 Arg232Lys Cases (96) 96 0 0 0 0.314
Controls (95) 94 1 0 0.005
9 c.710‐12A/G (rs1800286) Intron 7 ‐ Cases (96) 30 45 21 0.453 0.570
Controls (91) 32 42 17 0.418 0.417d, 0.389e
10 c.796A/G (rs7190823) Exon 9 Thr266Ala Cases (97) 51 38 8 0.278 0.048
Controls (94) 36 43 15 0.388 0.329d, 0.357e
11 c.894‐8A/G (rs1164881) Intron 10 ‐ Cases (97) 95 2 0 0.010 0.006
Controls (90) 79 11 0 0.061 0.059f
12 c.1083 + 120 G/A (rs17226159) Intron 12 ‐ Cases (96) 69 23 4 0.161 0.381
Controls (93) 72 20 1 0.118
13 c.1083 + 142 G/A (NA) Intron 12 ‐ Cases (96) 94 2 0 0.010 0.159
Controls (94) 94 0 0 0
14 c.1083 + 195C/T (NA) Intron 12 ‐ Cases (96) 93 3 0 0.016 0.317
Controls (94) 94 1 0 0.005
15 c.1083 + 222 G/C (rs6500453) Intron 12 ‐ Cases (96) 46 38 12 0.323 0.270
Controls (95) 38 42 15 0.379 0.425d
16 c.1084‐49 G/C (rs1800287) Intron 12 ‐ Cases (96) 50 38 8 0.281 0.094
Controls (95) 38 43 14 0.374 0.425d
17 c.1084‐30A/G (rs6500452) Intron 12 ‐ Cases (96) 60 32 4 0.208 0.070
Controls (95) 47 39 9 0.300 0.241d, 0.271e
18 c.1143 G/T (rs1800331) Exon 13 Thr381Thr Cases (97) 88 9 0 0.046 0.338
Controls (95) 82 13 0 0.068 0.042d
19 c.1225 + 12A/G (NA) Intron 13 ‐ Cases (97) 96 1 0 0.005 0.321
Controls (95) 95 0 0 0
20 c.1225 + 151C/T (rs6500451) Intron 13 ‐ Cases (96) 83 13 0 0.068 0.379
Controls (95) 86 9 0 0.047
21 c.1226‐80 T/C (rs6500450) Intron 13 ‐ Cases (96) 53 35 8 0.266 0.050
Controls (95) 39 41 15 0.374 0.458d
22 c.1226‐75C/G (NA) Intron 13 ‐ Cases (96) 96 0 0 0 0.313
Controls (95) 94 1 0 0.005
23 c.1226‐20A/G (rs1800330) Intron 13 ‐ Cases (97) 57 34 6 0.237 0.151
Controls (95) 46 39 10 0.311 0.383d
24 c.1235C/T (rs11646374) Exon 14 Ala412Val Cases (97) 88 9 0 0.046 0.457
Controls (95) 83 12 0 0.063 0.053d, 0.058e
25 c.1501 G/A (rs2239359) Exon 16 Gly501Ser Cases (97) 55 28 14 0.289 0.003
Controls (94) 33 42 19 0.426 0.362d
26 c.1627‐32 T/C (rs17226337) Intron 17 ‐ Cases (97) 93 4 0 0.021 0.049
Controls (92) 92 0 0 0 0.025f
27 c.1627‐31C/G (NA) Intron 17 ‐ Cases (97) 96 1 0 0.005 0.530
Controls (92) 90 2 0 0.011
28 c.1679C/T (NA) Exon 18 Thr561Met Cases (97) 94 3 0 0.015 0.086
Controls (94) 94 0 0 0
29 c.1715 + 82 T/C (rs1800335) Intron 18 ‐ Cases (97) 50 39 8 0.284 0.135
Controls (91) 37 40 14 0.374
30 c.1776 + 64 T/C (rs2302162) Intron 19 ‐ Cases (97) 88 9 0 0.046 0.660
Controls (89) 79 10 0 0.056
31 c.1826 + 15 T/C (rs1800337) Intron 20 ‐ Cases (97) 50 39 8 0.284 0.068
Controls (89) 34 40 15 0.393 0.425d
32 c.1826 + 29insGT (rs1799742) Intron 20 ‐ Cases (97) 88 9 0 0.046 0.365
Controls (89) 77 12 0 0.067
33 c.1830A/G (rs1800338) Exon 21 Ala610Ala Cases (91) 88 3 0 0.016 0.081
Controls (91) 91 0 0 0
34 c.1874 G/C (NA) Exon 21 Cys625Ser Cases (91) 91 0 0 0 0.316
Controls (91) 90 1 0 0.005
35 c.1927C/G (rs17232910) Exon 22 Pro643Ala Cases (97) 90 7 0 0.036 0.192
Controls (93) 81 12 0 0.065
36 c.2014 + 42 G/T (rs1800339) Intron 22 ‐ Cases (97) 89 8 0 0.041 0.208
Controls (93) 80 13 0 0.070 0.05d
37 c.2151 G/T (rs1131660) Exon 23 Met717Ile Cases (97) 87 10 0 0.052 0.128
Controls (90) 86 4 0 0.022
38 c.2151 + 8 T/C (rs1800340) Intron 23 ‐ Cases (97) 56 35 6 0.242 0.130
Controls (90) 42 38 10 0.322
39 c.2222 + 73A/G (rs1800341) Intron 24 ‐ Cases (93) 81 12 0 0.065 0.612
Controls (86) 77 9 0 0.052
40 c.2222 + 100A/G (rs886950) Intron 24 ‐ Cases (93) 48 38 7 0.280 0.143
Controls (86) 35 37 14 0.378 0.433d
41 c.2222 + 107 T/C (rs886951) Intron 24 ‐ Cases (93) 48 38 7 0.280 0.143
Controls (86) 35 37 14 0.378
42 c.2223‐113C/T (rs886952) Intron 24 ‐ Cases (94) 48 40 6 0.277 0.121
Controls (86) 34 37 15 0.390 0.425d
43 c.2316 + 67 G/A (rs62989960) Intron 25 ‐ Cases (94) 78 15 1 0.090 0.193
Controls (87) 78 9 0 0.052 0.025d
44 c.2426 G/A (rs7195066) Exon 26 Gly809Asp Cases (94) 52 36 6 0.255 0.209
Controls (87) 40 36 11 0.333 0.273d, 0.302e
45 c.2574C/G (rs17233141) Exon 27 Ser858Arg Cases (97) 97 0 0 0 0.078
Controls (95) 92 3 0 0.016
46 c.2589C/A (rs72807571) Exon 27 Gly863Gly Cases (97) 96 1 0 0.005 0.321
Controls (95) 95 0 0 0
47 c.2779‐7 T/C (rs17233253) Intron 28 ‐ Cases (96) 87 9 0 0.047 0.548
Controls (91) 80 11 0 0.060
48 c.2852 + 137 T/C (rs12933317) Intron 29 ‐ Cases (96) 87 9 0 0.047 0.531
Controls (90) 79 11 0 0.061
49 c.2852 + 314A/T (rs78904586) Intron 29 ‐ Cases (97) 79 16 1 0.094 0.284
Controls (80) 60 18 2 0.138
50 c.2859C/G (NA) Exon 30 Asp953Glu Cases (97) 97 0 0 0 0.311
Controls (95) 94 1 0 0.005
51 c.2901C/T (rs17226980) Exon 30 Ser967Ser Cases (97) 89 8 0 0,041 0.440
Controls (95) 84 11 0 0.058
52 c.3067‐23 G/A (rs17227057) Intron 31 ‐ Cases (96) 87 9 0 0.047 0.601
Controls (94) 83 11 0 0.059
53 c.3067‐4 T/C (rs17227064) Intron 31 ‐ Cases (96) 87 9 0 0.047 0.601
Controls (94) 83 11 0 0.059
54 c.3069 G/T (NA) Exon 32 Glu1023Asp Cases (96) 95 1 0 0.005 0.321
Controls (94) 94 0 0 0
55 c.3239 + 32indel19 (NA) Intron 32 ‐ Cases (96) 96 0 0 0 0.311
Controls (94) 93 1 0 0.005
56 c.3240‐42 G/A (rs1800345) Intron 32 ‐ Cases (97) 62 31 4 0.201 0.045
Controls (91) 45 36 10 0.308
57 c.3263C/T (rs17233497) Exon 33 Ser1088Phe Cases (97) 88 9 0 0.046 0.584
Controls (94) 83 11 0 0.059
58 c.3348 + 18A/G (rs1800347) Intron 33 ‐ Cases (97) 82 15 0 0.077 0.022
Controls (94) 89 4 1 0.032 0.04f
59 c.3348 + 25C/T (NA) Intron 33 ‐ Cases (97) 97 0 0 0 0.308
Controls (94) 93 1 0 0.005
60 c.3348 + 29C/T (rs1800348) Intron 33 ‐ Cases (97) 95 2 0 0.010 0.579
Controls (94) 93 1 0 0.005
61 c.3348 + 40 T/A (NA) Intron 33 ‐ Cases (97) 95 2 0 0.010 0.579
Controls (94) 93 1 0 0.005
62 c.3408 + 21C/G (NA) Intron 34 ‐ Cases (97) 96 1 0 0.005 0.324
Controls (94) 94 0 0 0
63 c.3408 + 45 G/A (rs1800355) Intron 34 ‐ Cases (96) 87 9 0 0.047 0.456
Controls (94) 82 12 0 0.064 0.042d
64 c.3427C/G (rs61753269) Exon 35 Leu1143Val Cases (96) 95 1 0 0.005 0.321
Controls (94) 94 0 0 0
65 c.3513 + 62C/T (rs1800356) Intron 35 ‐ Cases (96) 82 13 1 0.078 0.538
Controls (95) 84 10 1 0.063
66 c.3654A/G (rs1800358) Exon 37 Pro1218Pro Cases (97) 82 15 0 0.077 0.888
Controls (95) 81 14 0 0.074
67 c.3711C/G (NA) Exon 37 Val1237Val Cases (97) 97 0 0 0 0.311
Controls (95) 94 1 0 0.005
68 c.3765 + 37 G/A (rs34420680) Intron 37 ‐ Cases (97) 88 9 0 0.046 0.602
Controls (95) 84 11 0 0.058
69 c.3765 + 41 G/A (NA) Intron 37 ‐ Cases (97) 97 0 0 0 0.311
Controls (94) 94 1 0 0.005
70 c.3765 + 61A/G (NA) Intron 37 ‐ Cases (97) 97 0 0 0 0.311
Controls (94) 94 1 0 0.005
71 c.3807 G/C (rs11649210) Exon 38 Leu1269Leu Cases (96) 84 12 0 0.063 0.631
Controls (94) 80 14 0 0.074 0.042d
72 c.3828 + 81 G/T (rs11649162) Intron 38 ‐ Cases (96) 88 8 0 0.042 0.319
Controls (94) 82 12 0 0.064 0.042d
73 c.3828 + 251A/G (rs17227347) Intron 38 ‐ Cases (94) 88 6 0 0.032 0.148
Controls (94) 92 2 0 0.011
74 c.3828 + 295C/T (NA) Intron 38 ‐ Cases (95) 94 1 0 0.005 0.319
Controls (94) 94 0 0 0
75 c.3828 + 313 G/A (rs17233734) Intron 38 ‐ Cases (95) 95 0 0 0 0.313
Controls (94) 93 1 0 0.005
76 c.3829‐306 G/A (rs55927037) Intron 38 ‐ Cases (95) 94 0 0.005 0.994
Controls (94) 93 1 0 0.005
77 c.3829‐225C/T (rs11648689) Intron 38 ‐ Cases (95) 88 7 0 0.037 0.310
Controls (94) 83 11 0 0.059
78 c.3829‐107A/T (rs11644967) Intron 38 ‐ Cases (95) 83 12 0 0.063 0.673
Controls (95) 81 14 0 0.074 0.042d
79 c.3935‐16C/T (rs1061646) Intron 39 ‐ Cases (95) 59 32 4 0.211 0.082
Controls (91) 45 36 10 0.308
80 c.3981C/T (NA) Exon 40 His1327His Cases (97) 96 1 0 0.005 0.324
Controls (94) 94 0 0 0 0.4d
81 c.3982A/G (rs9282681) Exon 40 Thr1328Ala Cases (97) 89 8 0 0.041 0.747
Controls (94) 85 9 0 0.048 0.05d
82 c.4010 + 92 T/C (rs9282682) Intron 40 ‐ Cases (97) 83 14 0 0.072 0.953
Controls (92) 79 13 0 0.071
83 c.4055C/A (NA) Exon 41 Ala1352Asp Cases (97) 96 1 0 0.005 0.329
Controls (92) 92 0 0 0
84 c.4167 + 46C/T (NA) Intron 41 ‐ Cases (97) 94 3 0 0.015 0.093
Controls (90) 90 0 0 0
85 c.4260 + 29 T/C (rs1800359) Intron 42 ‐ Cases (97) 30 46 21 0.454 0.407
Controls (90) 33 38 19 0.422 0.431d, 0.4e

Exonic variants are displayed in bold characters.

a

SNP ID are indicated according to the nomenclature guidelines of the Human Genome Variation Society (RefSeq NM_000135.2 corresponding to transcript variant 1). The first base from the ATG codon is counted as +1. dbSNP ID is indicated according to build 129, NA indicating a SNP not found in the database.

b

MAF: Minor allele frequency.

c

p‐Value of the common homozygotes versus heterozygotes and rare homozygotes.

d

254 controls from the asthma familial collection of Saguenay‐Lac‐Saint‐Jean (NorthEastern region of the province of Quebec in Canada).

e

140 controls coming from French Canadian population (CARTaGENE).

f

192 controls from French Canadian population selected at random from the CRCHUQ glaucoma DNA bank (Vincent Raymond).

As indicated in Table 1, in all but one instance (rs17226337), the MAF observed in the other control cohorts are similar to those calculated in our initial cohort. This confirms that the frequency of the variants included in Table 1 is a reliable representation of the frequency observed in the French Canadian population not affected with breast cancer. As for the four SNPs displaying a p‐value <0.05, the c.1627‐32T/C (rs17226337) variant which was further genotyped in 192 individuals from the French Canadian population provided by Dr. Vincent Raymond, presents a MAF (0.025) similar to what is seen in the breast cancer series, suggesting that this variant is unlikely to have an effect on breast cancer risk in the French Canadian population.

Intronic analyzes were performed on sequences adjacent to the transcribed DNA portions and the resulting proximal variants are also presented in Table 1. Among these intronic variants, a significant difference in genotype frequencies was observed for a variant located in intron 10 (c.894‐8A/G) that was under‐represented in the case dataset (AA vs. AG + GG 0.151 95% CI 0.0133–0.702; p = 0.00634) and for another variant namely, c.3348 + 18A/G found in intron 33 which was over‐represented in cases (AA vs. AG + GG 3.256 95% CI 1.133–9.358; p = 0.02206). Borderline significance is estimated for the three following intronic variants: c.1226‐80T/C, c.1627‐32T/C and c.3240‐42G/A.

3.2. In silico and splicing analyzes

The two variants located in the proximal promoter region (less than 150 bp from the transcriptional start site) were also evaluated for their potential influence on transcription factor binding sites using the MatInspector program. The 13 bp duplication sequence (c.‐42‐87ins13) is associated with the appearance of four motifs that are not present on the reference sequence: a motif for the TATA box binding protein (TBP), an estrogen response element (ERE), a motif for the vertebrate steroidogenic factor SF1 and a second motif for the cAMP‐responsive element binding protein (CREB). Interestingly the c.‐42‐76G/C variant could potentially create a binding site for p53 and a motif for a chorion‐specific transcription factor with a GCM DNA binding domain (GCMF) (data not shown).

As shown in Table 2, the Thr561, Cys625, Glu1023, Leu1143 and Ala1352 amino acid show a high degree of conservation in lower species, suggesting that these amino acids are under strong functional constraint or may have a specific role on protein conformation, while the other residues leading to amino acid changes are not well conserved in distant species. Analysis of amino acid changes was performed in an attempt to predict the functional consequences of FANCA missense variants using the PolyPhen and SIFT softwares as well as the ALIGN‐GVGD algorithm implementing an extension of the Grantham difference. As displayed in Table 3, both the SIFT and PolyPhen softwares predicted the Thr561Met, Cys625Ser and Ser1088Phe changes to be damaging for protein conformation and function. Following analysis with the Align‐GVGD program, among the variants found in our case dataset, only 3 have a grade above C0. The Thr561Met variant, found in three cases, falls within the C65 grade which is the most likely deleterious grade. The Glu1023Asp variant (one case) has an intermediate probability to be damaging and the Ala1352Asp variant (one case) falls within the low probability class C15. As for the variants found in healthy control individuals, only the Cys625Ser rare variant is predicted to be deleterious (grade C65). Therefore, the Thr561Met and Cys625Ser amino acid changes are predicted to be damaging for protein function by all three programs and most of the changes leading to a potential deleterious effect identified by at least one of the programs used, are located in important domains or binding sites such as the BRCA1 binding site region (aa 1–589) or the Leucine zipper domain (aa 1069–1090).

Table 2.

Non‐synonymous sequence variants detected in human FANCA protein and residues found in orthologues.

SNPa SNP IDb Amino acid change Macaca mulatta Gallus gallus Mus musculus Canis lupus familiaris Loxodonta africana Monodelphis domestica Xenopus ropicalis
4 c.17 T/A Val6Asp N/A N/A Ala Thr Ala Ser N/A
5 c.343 G/A Gly115Arg N/A Lys Lys Gln Arg Gln N/A
8 c.695 G/A Arg232Lys N/A Gly Glu Gln Arg Gly N/A
10 c.796A/G Thr266Ala N/A Cys Ala Ala N/A Cys N/A
24 c.1235C/T Ala412Val N/A Ser Ala Thr Ala Ala N/A
25 c.1501 G/A Gly501Ser N/A Thr Ser Ser Glu Val Pro
28 c.1679C/T Thr561Met N/A Thr Thr Thr Thr Thr Thr
34 c.1874 G/C Cys625Ser N/A Cys Cys Cys Cys Cys N/A
35 c.1927C/G Pro643Ala N/A N/A Ala Ala Pro Thr N/A
37 c.2151 G/T Met717Ile N/A N/A Ala Gln Glu Lys N/A
44 c.2426 G/A Gly809Asp N/A N/A Ser Val Ala N/A N/A
45 c.2574C/G Ser858Arg N/A N/A Asn Ser Gly Asn N/A
46 c.2859C/G Asp953Glu N/A N/A Asp Asp Asp Tyr N/A
54 c.3069 G/T Glu1023Asp Glu Glu Glu Glu Glu Glu N/A
57 c.3263C/T Ser1088Phe Ser N/A Ser Ser Thr Ser N/A
64 c.3427C/G Leu1143Val Leu Leu Leu Ser Leu Leu Val
81 c.3982A/G Thr1328Ala Thr N/A Thr Ile Ile Ile Leu
83 c.4055C/A Ala1352Asp Ala N/A Ala Ala Ala Ala Asp

N/A: no corresponding residue found in this species.

a

According to Table 1.

b

According to the nomenclature of the Human Genome Variation Society.

Table 3.

Non‐synonymous amino acid changes identified in FANCA protein and prediction of the substitution on protein function using SIFT, PolyPhen and Align GVGD softwares.

SNPa Amino acid change Domain or binding sites (bs) SIFT PolyPhen Align GVGD
4 Val6Asp CENP‐E and BRCA1 bs Tolerated Possibly damaging Class C0
5 Gly115Arg CENP‐E and BRCA1 bs Tolerated Benign Class C0
8 Arg232Lys CENP‐E and BRCA1 bs Tolerated Benign Class C0
10 Thr266Ala CENP‐E and BRCA1 bs Tolerated Benign Class C0
24 Ala412Val BRCA1 bs Tolerated Benign Class C0
25 Gly501Ser BRCA1 bs Tolerated Possibly damaging Class C0
28 Thr561Met BRCA1 bs Not tolerated Probably damaging Class C65
34 Cys625Ser None Not tolerated Probably damaging Class C65
35 Pro643Ala None Tolerated Benign Class C0
37 Met717Ile None Tolerated Benign Class C0
44 Gly809Asp None Tolerated Benign Class C0
45 Ser858Arg None Tolerated Probably damaging Class C0
46 Asp953Glu None Tolerated Benign Class C0
54 Glu1023Asp None Tolerated Benign Class C15
57 Ser1088Phe Leucine zipper domain Not tolerated Possibly damaging Class C0
64 Leu1143Val BRG1 bs Tolerated Benign Class C0
81 Thr1328Ala BRG1 bs Tolerated Benign Class C0
83 Ala1352Asp BRG1 bs Not tolerated Benign Class C15
a

According to Table 1.

Analysis of FANCA cDNA was performed in breast cancer cases and highlighted the expression of four distinct alternative splicing events (ASEs) (Figure 1). These ASEs are observed in the FANCA genomic regions of exons 10–11 and 30–31 (BU616925, CN404731, AK301168, and BI908441). The first alternative spliced isoform (designed FANCAins10A) involved the insertion of 128 bp of intronic sequence located between exons 10 and 11 and is expected to result in a premature termination of FANCA open reading frame leading to a protein of 297 aa. The other ASE identified in this region, FANCAΔ11, involves the skipping of exon 11 (113 bp), which is also expected to produce a truncated protein of 299 aa. It should be noted that both proteins lack the major C‐terminal part of the protein which contains particularly a part of the BRCA1 binding site as well as the whole leucine zipper domain and BRG1 binding site region (Figure 1B). As for the exonic 30–31 region, the deletion of exon 30 (FANCAΔ30) is an in frame deletion of 129 bp, while the FANCAΔ31 involves the skipping of exon 31 (85 bp) and could potentially lead to a putative protein of 996 amino acids lacking the BRG1 binding site and the leucine zipper domain (Figure 1C).

Figure 1.

Figure 1

FANCA interaction domains, and FANCA splicing. (A) Schematic representation of FANCA interaction domains based on the literature. (B) FANCA exon structure and schematic representation of the putative proteins of the two splicing variants located in the genomic region of exons 9–12, that could be detected via cDNA analyzes: FANCAins10a and FANCAΔ11. (C) FANCA exon structure and schematic representation of the putative proteins of the two splicing variants located in the genomic region of exons 29–32, that could be detected via cDNA analyzes: FANCAΔ30 and FANCAΔ31.

Quantitative PCR amplification of the four ASEs described above (FANCAins10A, FANCAΔ11, FANCAΔ30 and FANCAΔ31), performed in eight human breast cancer cell lines (Figure 2) as well as in BRCAX individuals are displayed in Supplemental Figure 1. q‐PCR amplification using oligonucleotides specific to each spliced form in the cell lines shows modest expression of FANCAΔ11, FANCAΔ30 and FANCAΔ31 mRNA. However, the variant FANCAins10A exhibits a high mRNA expression level (Figure 2). Relative expression levels of FANCAins10A spliced form are highest in SUM140 cell line and lowest in BT‐20 and MDA‐231 but no significant variation is observed according to estrogen receptor or differentiation status.

Figure 2.

Figure 2

Expression levels of FANCA Δ11, ins10A, Δ30 and Δ31 spliced forms in cell lines as measured by quantitative real‐time PCR experiments. Relative expression levels of FANCA Δ11, ins10A, Δ30 and Δ31 spliced forms were calculated as E(ΔCt wild‐type allele –ΔCt splice form) in eight breast cancer cell lines where E is primer efficiency.

3.3. Polysome analysis of FANCA ASEs mRNAs

Given that we could not assume that the spliced forms described above were not subject to mRNA regulation through nonsense mediated decay (NMD), additional experiments have been performed. A series of cell lines from breast cancer patients, in which the alternative form of interest was observed, were treated with puromycin (half of the cells were treated and half were not), an agent known to inhibit NMD. RT‐PCR was performed on FANCAins10A, FANCAΔ11, FANCAΔ30 and FANCAΔ31 using specific oligonucleotides to each spliced form, and clearly these forms do not seem to be subject to NMD (data not shown). To further determine whether FANCA splicing variant mRNAs are efficiently translated, polysome profiles were performed in the breast cancer cell line T‐47D and mRNA levels were measured using splice variant‐specific qRT‐PCR primers. Efficiently translated transcripts are associated with polysomes, whereas those degraded by NMD are generally associated with monosomes because they are degraded during the pioneering round of translation, before loading of additional ribosomes. Figure 3 shows the resulting profile with Δ11, ins10A, Δ30 and Δ31 mRNA which are most abundant in polysome fractions 11 to 13 suggesting there are efficiently translated. These spliced mRNAs are thus not degraded by NMD and are associated with translating ribosomes, suggesting efficient production of Δ11, ins10A, Δ30 and Δ31 proteins in T‐47D cell line. Interestingly, ribosomal analysis shows that the variant carrying the insertion of the intronic fragment exhibit the highest level of mRNA which is in concordance with the results obtained with quantification of the variants in the different cell lines.

Figure 3.

Figure 3

Polysome analysis of FANCA ASEs mRNAs. Fractionation of monosomes and polysomes (with or without EDTA) as measured by A260. q‐RT PCR of FANCA Δ11, ins10A, Δ30 and Δ31 spliced forms was performed on T‐47D cells and relative expression values for each fraction were calculated by the equation R = (E)(Ctref−Ct), where Ctref is the average cycle threshold of all the fractions for that variant.

Following identification of ASEs expressed in BRCAX individuals and cancer cell lines, the putative impact of the relevant FANCA periexonic and exonic variants (i.e. located in the vicinity of the ASE genomic regions) on mRNA splicing was assessed by in silico methods using the HSF web program which allows the identification of enhancer and silencer splicing sites as well as branch point sequences (Table 4). The acceptor and donor motif sequences of exons 10, 10A and 11 have relatively good motif scores, all being over 0.80. Moreover the exon 10A possesses putative branch point sequences located 80 and 65 bp upstream of the beginning of exon 10A. The only relevant variant located in intron 10 in the proximity of the acceptor site sequence of exon 11, c.894‐8A/G, creates new sites for SF2/ASF (IgM‐BRCA1) binding as well as new enhancer EIE and silencer motif 2 binding sites. As for the region containing exons 30–31, the wild type acceptor and donor motif sequences of exons 30 and 31 demonstrate efficient splicing site scores. Two variants located in exon 30, c.2859C/G and c.2901C/T are predicted to have significant effect on binding capacity of several splicing factors. Particularly, c.2859C/G disrupts motifs for SC35, PESE octamer as well as for enhancer EIE and 9G8. This variant also creates silencer motifs 1 and 2. As for exon 31, the two relevant variants c.2982‐102G/C and c.2982‐73G/A, located in intron 30 upstream of exon 31, have been evaluated. The c.2982‐102G/C variant deletes several consensus motifs such as those for PESE octamer, enhancer EIE and 9G8 as well as silencer motifs 1 and IIE and hnRNP A1 protein (Table 4).

Table 4.

In silico analysis of FANCA genomic regions and variants potentially involved in the expression of FANCAins10a, FANCAΔ11, FANCAΔ30 and FANCAΔ31 spliced transcripts.

Exon or variant Location Motif Reference score (WT) Variant score Potential effect on exon inclusion
Region of exons 10–11
Exon 10 wt – Acceptor sitea 90.1 – Positive
Donor sitea 86.4 – Positive
Exon 10A – Acceptor sitea 81.3 – Positive
Donor sitea 86.9 – Positive
Exon 10A‐80 Branch point sitea 90.8 – Positive
Exon 10A‐65 Branch point sitea 90.7 – Positive
Exon 11 – Acceptor sitea 86.6 – Positive
Donor sitea 88.5 – Positive
c.894‐8A/G Intron 10 Potential donor sitea n.d. 66.6 Not determined
SF2/ASF (IgM‐BRCA1)a n.d. 73.1 Positive (exon 11)
Enhancer EIEb No value New site Positive (exon 11)
Silencer Motif 2c n.d. New site (72.3) Negative (exon 11)
Silencer IIEb No value Site broken Positive (exon 11)
Silencer IIEb No value New site Negative (exon 11)
Region of exons 30–31
Exon 30 – Acceptor sitea 83.3 – Positive
– Donor sitea 91.8 – Positive
c.2859 C/G Exon 30 Potential acceptor sitea n.d. 71 Not determined
SC35a 85 Site broken Negative (exon 30)
Enhancer PESE octamerd 35.8 Site broken Negative (exon 30)
Enhancer EIEb No value Site broken Negative (exon 30)
Enhancer 9G8a 59.5 Site broken Negative (exon 30)
Silencer Motif 1c n.d. New site (69.7) Negative (exon 30)
Silencer Motif 2c n.d. New site (60.2) Negative (exon 30)
c.2901 C/T Exon 30 SRp55a n.d. New site (76.1) Positive (exon 30)
Enhancer PESE octamerd 27.8 Site broken Negative (exon 30)
Silencer IIEb No value New site Negative (exon 30)
Exon 31 – Acceptor sitea 92.0 – Positive
Donor sitea 98.8 – Positive
c.2982‐102 G/C Intron 30 Branch point sitea 72.2 77.2 Positive (exon 31)
SRp40a n.d. New site (85.7) Positive (exon 31)
Enhancer PESE octamersd 41.1 Site broken Negative (exon 31)
Enhancer EIEb No value Site broken Negative (exon 31)
Enhancer 9G8a 59.5 Site broken Negative (exon 31)
Silencer Motif 3c – New site (70.0) Negative (exon 31)
Silencer Motif 1c 65.8 site broken Positive (exon 31)
Silencer IIEb No value Site broken Positive (exon 31)
Silencer hnRNP A1a 73.3 Site broken Positive (exon 31)
c.2982‐73 G/A Intron 30 Branch point sitea 75.7 71.8 Negative (exon 31)
SF2/ASF (IgM‐BRCA1) a 84.5 71.5 Negative (exon 31)
Enhancer PESE Octamerd n.d. New site (57.6) Positive (exon 31)
Enhancer EIEb No value New site Positive (exon 31)
Enhancer 9G8a 71.1 Site broken Negative (exon 31)
Silencer Motif 1c 74.5 Site broken Positive (exon 31)
Silencer Motif 2c 66.3 Site broken Positive (exon 31)
Silencer hnRNP A1a 78.6 Site broken Positive (exon 31)

n.d.: Not detected.

EIE: exon‐identity elements.

IIE: Intron‐identity elements.

a

Based on Human Splicing Finder matrices.

b

Zhang C et al., 2008, PNAS 105:5797.

c

Sironi M et al., 2004, Nucleic acids research 32:1783.

d

Zhang and Chasin 2004, Genes Dev 18:1241.

To investigate the potential association between the variants c.2901C/T (rs17226980), c.2982‐102G/C (rs12931267) and c.2982‐73G/A and the expression of the FANCAΔ30 and FANCAΔ31, real‐time PCR was performed using RNA samples from five heterozygotes for c.2901C/T, two heterozygotes for c.2982‐102G/C, one heterozygote for c.2982‐73G/A and ten wild‐type individuals (Supplemental Figure 1). The presence of the Δ30 and Δ31 spliced transcripts were detected in all individuals, including wild‐type individuals, supporting the fact that the expression of these variants are not associated with none of these polymorphisms. A similar experiment was performed to analyze the assessment between the c.894‐8A/G (rs1164881) variation and the expression of the FANCAΔ11 and FANCAins10A (data not shown) and no significant correlation was observed.

4. Discussion

Over the last decade, several evidences linked the two major breast cancer susceptibility genes BRCA1 and BRCA2 to an emerging network of proteins implicated in DNA repair, and whose bi‐allelic mutations cause Fanconi Anemia (Wang, 2007). Mono‐allelic mutations, like those found in BRCA1 and BRCA2/FANCD1, have been described for FANCJ, FANCN and FANCO in breast cancer susceptibility (Somyajit et al., 2010; Cantor et al., 2001, 2004; Seal et al., 2006; Rahman et al., 2007; Erkko et al., 2007; Pang et al., 2011; Zheng et al., 2010; Meindl et al., 2010), and a recent study conducted with 944 family members being part of the International Fanconi Anemia Registry revealed an increased risk of breast cancer among grandmothers carriers of FANCC mutations (Berwick et al., 2007). However, apart from these genes, the involvement of the other FANC genes in breast cancer susceptibility remains unclear. Indeed, epidemiological studies focusing on heterozygous mutation carriers have yielded conflicting results (Tischkowitz et al., 2008; Mathew, 2006). Using variant screening and discovery on both genomic and cDNA material of the FANCA gene in a cohort of 97 familial breast cancer cases without BRCA1 or BRCA2 mutations as well as among 95 healthy unrelated controls from the same population, we found that: 1) re‐sequencing did not identify any deleterious mutations, 2) some variants, and particularly the Gly501Ser non‐synonymous change, are associated with a protective effect against breast cancer risk in our cohort and, 3) the FANCA gene is subject to multiple alternative splicing events expression. Although extensive promoter screening was beyond the scope of the current study, two variants, including the unreported c.‐42‐76G/C, were found in the proximal region of the transcriptional starting site. The 13 bp duplication (c.‐42‐87ins13) has been previously associated with a protective effect in ovarian cancer (OR = 0.72; 95% CI, 0.53–0.99), while no significant effect was seen in breast cancer patients (Thompson et al., 2005). Both promoter variants identified in this study are of interest as even single base changes in promoter sequences can alter regulation of gene expression and contribute to tumorigenesis, particularly if this could affect transcription factor binding site for proteins such as TBP, estrogen receptor, SF1 and CREB as predicted for the c.‐42‐87ins13 variant (Hasselbach et al., 2005; Najafi and Jangravi, 2010; Zhu et al., 2001; Bond et al., 2004).

Interestingly, among the 85 sequence variants identified in our case and control datasets, the variant showing the most significant p‐value (p = 0.003) is the c.1501G/A (Gly501Ser) non‐synonymous change. This variant is over‐represented in our control dataset, which is suggestive of a protective effect of the A allele in our cohort. To date, the Gly501Ser variant of FANCA has been recently associated with an increased risk of cervical intraepithelial neoplasia grade 3 cancer, with a risk of 1.7 fold (95% CI 1.1–2.6 fold) for the GG genotype when compared to the AA genotype (Wang et al., 2009). Another significant over‐representation in the healthy individuals was observed for the c.894‐8A/G variation (p = 0.006). As predicted by in silico analysis, this variant creates a new potential donor site and affects binding site score for SF2/ASF, Enhancer EIE and few silencer proteins. Moreover this variant is located 8 nucleotides upstream of exon 11, which is skipped in the FANCAΔ11 mRNA. Therefore this variant could potentially be involved in the expression of this splicing event. As for the variant c.3348 + 18A/G showing a significant difference of frequency between both series (p = 0.022), it creates a new donor site (score = 72.1), a new motif 2 silencer site, and abolishes a EIE site. Among the variants showing a borderline significance, both c.‐1C/A and c.1627‐32T/C are observed in the case series only. Moreover these variants are carried by the same four individuals likely indicating that both variants are being part of the same allele. The unreported c.‐1C/A variation is located in a crucial consensus sequence involved in the initiation of translation. The C nucleotides at position −1 and −2 do not need to be conserved, but contribute to the overall strength (Kozak, 1986). The c.2574C/G variant (Ser858Arg), known as the Indian mutation and located in exon 27, has been previously reported as a disease‐causing mutation in Fanconi Anemia (Tamary et al., 2000; Wijker et al., 1999). However this Ser858Arg change is found exclusively in our control dataset, therefore suggesting that this variant at the heterozygous state is non‐pathogenic in breast cancer predisposition.

Both the Thr561Met and Cys625Ser changes located within or in the vicinity of the BRCA1 binding site are predicted to be deleterious by all three programs used. Although Thr561Met is found exclusively in three cases, both variants did not show any significant difference in MAF between both cohorts. The Cys625Ser variant has been identified and predicted as pathogenic in the Spanish FA population but this variant was not characterized regarding its effect on protein function (Castella et al., 2011).

Several splicing variants of FANCA gene have been identified and partially characterized in the last decade and result from the presence of specific genomic variants. For instance, the c.1567‐20A/G (intron 16), c.2278 + 83C/G (intron 28) and c.2222 + 166A/G (intron 24) are known to affect splicing of the FANCA protein (Savino et al., 2003; Bouchlaka et al., 2003). Several other spliced variants have been reported in the Japanese population (Tachibana et al., 1999; Yagasaki et al., 2004). The significant expression of four splicing variants have been detected in our BRCAX breast cancer individuals and all variants namely FANCAins10A (BU616925), FANCAΔ11 (CN404731), FANCAΔ30 (AK301168) and FANCAΔ31 (BI908441), have been reported in NCBI EST databases but have not been characterized. Of these, only the FANCAΔ30 splice variant results in an in‐frame deletion of 43 amino acids located outside known domains, therefore the significance of this deletion is unknown. FANCAins10A, FANCAΔ11 and FANCAΔ30 lead to truncated proteins lacking the BRG‐1 binding domain, while the FANCAins10A and FANCAΔ11 truncated proteins have also an excised BRCA‐binding domain. Moreover several putative nuclear export sequences located in the region of aa 518, 860 and 1013, are missing in these spliced proteins (Ferrer et al., 2005). Thus, this suggests that interactions with BRCA1 (Folias et al., 2002), the chromatin remodeling BRG1 protein (Otsuki et al., 2001) and with other known protein partners might be affected. No clear polymorphism/mutation seem to be involved in the expression of these spliced transcripts which are not significantly degraded by the NMD mechanism, and are most likely transcribed efficiently as strongly suggested by the polysomal experiments. However, we can not exclude deeper intronic variations affecting intronic splicing enhancers/silencers or creating new cryptic splice sites. Moreover, as reported for some genes related to specific diseases (Ricketts et al., 1987; Naylor et al., 1993; Dietz et al., 1993), the skipping of exons could maintain transcription and translation of a partially functional protein and thus moderate the disease phenotype.

Large intragenic and exonic deletions have been identified in FA patients of different populations such as Afrikaners, Spanish or other European populations (Wijker et al., 1999; Tachibana et al., 1999; Morgan et al., 1999; Tipping et al., 2001; Callén et al., 2004; Centra et al., 1998; Levran et al., 1998; Nakamura et al., 1999). Previous studies have shown that deletions account for 40% of FANCA mutations (Morgan et al., 1999). Indeed it is known that the majority of deletions occurred by recombination between two ALU repeats located in cis as reported for many other genes (Morgan et al., 1999; Centra et al., 1998; Levran et al., 1998). As demonstrated by Morgan et al (Morgan et al., 1999), recombination hotspots within the FANCA gene seem to be located in the genomic regions of introns 17 and 31, which reflect the similar regions of LD block recombination identified in our dataset (data not shown). Regarding the involvement of FANCA deletions in breast cancer susceptibility, a novel heterozygous deletion, removing the promoter and 12 exons of the FANCA gene, was recently identified in one Finnish breast cancer family (Solyum et al., 2011). However, as reported previously (Seal et al., 2003), MLPA analyzes did not identify any large genomic or exonic deletions within the FANCA gene in our French Canadian breast cancer patients.

5. Conclusion

This is the first comprehensive mutation screening of FANCA gene in the French Canadian population. Although no deleterious mutation was found, we identify 24 novel polymorphisms not reported in databases including 7 missense variations, as well as four alternative splicing events. It will also be interesting to determine whether inherited polymorphisms in FANCA gene resulting in more subtle defects in protein expression or function, can contribute to increased cancer risk or to variable tumor responses to conventional therapies.

Supporting information

The following are the supplementary data related to this article:

Supplementary data

Supplementary data

Acknowledgments

The authors would like to thank all individuals and families who participated in this study. We thank M. Tranchant, Dr. M. Dumont, and G. Leblanc of the Cancer Genomics Laboratory for sample management and mutation screening. We also thank M. Ouellet, C E Bénard and A.M. Moisan for skillful technical help, Dr. Fabienne Lesueur (IARC, Lyon) for the help with GV‐GD analysis and Dr. D. Labuda and C. Moreau at the Centre de Cancérologie Charles Bruneau of Ste‐Justine Hospital for help with control DNA samples. We also thank Catherine Laprise (UQAC) for providing genotyping information and Vincent Raymond (CRCHUQ) for providing DNA samples on additional controls from the French Canadian population. The authors also acknowledge the work of Professor Bartha Maria Knoppers and her colleagues regarding ELSI issues, as well as the ethics committees of all participating institutions.

Financial support: This work was supported by the Canadian Institutes of Health Research for the “CIHR Team in Familial Risks of Breast Cancer” program and by the Canadian Breast Cancer Research Alliance, the Fond de la Recherche en Santé du Québec (FRSQ)/Réseau de Médecine Génétique Appliquée (RMGA), the CURE Foundation and Fanconi Canada. N.L. and S.D. hold studentships from Fondation René Bussières and Fondation Desjardins (S.D.), and F.D. held a chercheur‐boursier from the Fonds de la Recherche en Santé du Québec (FRSQ).

Appendix A Supplementary data 1.

1.1.

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.molonc.2012.08.002.

Appendix B 1.

1.1.

Other members of INHERIT BRCAs involved in clinical aspects of this study:

Paul Bessette: Service de gynécologie, Centre Hospitalier Universitaire de Sherbrooke, Fleurimont, QC, J1H 5N4, Canada.

Jocelyne Chiquette: Clinique des maladies du sein Deschênes‐Fabia, Hôpital du Saint‐Sacrement, Québec, QC, G1S 4L8, Canada.

Rachel Laframboise: Service de médecine génétique, CHUQ, Pavillon CHUL, Québec, QC, G1V 4G2, Canada.

Jean Lépine: Centre Hospitalier régional de Rimouski, Rimouski, QC, G5L 5T1, Canada.

Bernard Lespérance, Roxane Pichette: Service d'hémato‐oncologie, Hôpital du Sacré‐Cœur, Montréal, QC, H4J 1C5, Canada.

Marie Plante: Service de gynécologie, CHUQ, L'Hôtel‐Dieu de Québec, Québec, QC, G1R 2J6, Canada.

Litim Nadhir, Labrie Yvan, Desjardins Sylvie, Ouellette Geneviève, Plourde Karine, Belleau Pascal, INHERIT BRCAs , Durocher Francine, (2013), Polymorphic variations in the FANCA gene in high‐risk non‐BRCA1/2 breast cancer individuals from the French Canadian population, Molecular Oncology, 7, doi: 10.1016/j.molonc.2012.08.002.

References

  1. Akbari, R. , Malekzadeh, R. , Lepage, P. , Roquis, D. , Sadjadi, A. , Aghcheli, K. , Yazdanbod, A. , Shakeri, R. , Bashiri, J. , Sotoudeh, M. , Pourshams, A. , Ghadirian, P. , Narod, S. , 2011. Mutations in Fanconi anemia genes and the risk of esophageal cancer. Hum. Genet.. 129, 573–582. [DOI] [PubMed] [Google Scholar]
  2. Antoniou, A.C. , Durocher, F. , Smith, P. , Simard, J. , Easton, D.F. , 2006. INHERIT BRCAs program members. BRCA1 and BRCA2 mutation predictions using the BOADICEA and BRCAPRO models and penetrance estimation in high-risk French-Canadian families. Breast Cancer Res.. 8, (1) R3 Epub 2005 Dec 12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Berwick, M. , Satagopan, J.M. , Ben-Porat, L. , Carlson, A. , Mah, K. , Henry, R. , Diotti, R. , Milton, K. , Pujara, K. , Landers, T. , Dev Batish, S. , Morales, J. , Schindler, D. , Hanenberg, H. , Hromas, R. , Levran, O. , Auerbach, A.D. , 2007. Genetic heterogeneity among Fanconi anemia heterozygotes and risk of cancer. Cancer Res.. 67, 9591–9596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bond, G.L. , Hu, W. , Bond, E.E. , Robins, H. , Lutzker, S.G. , Arva, N.C. , Bargonetti, J. , Bartel, F. , Taubert, H. , Wuerl, P. , Onel, K. , Yip, L. , Hwang, S.J. , Strong, L.C. , Lozano, G. , Levine, A.J. , 2004. A single nucleotide polymorphism in the MDM2 promoter attenuates the p53 tumor suppressor pathway and accelerates tumor formation in humans. Cell. 119, 591–602. [DOI] [PubMed] [Google Scholar]
  5. Bouchlaka, C. , Abdelhak, S. , Amouri, A. , Ben Abid, H. , Hadiji, S. , Frikha, M. , Ben Othman, T. , Amri, F. , Ayadi, H. , Hachicha, M. , Rebaï, A. , Saad, A. , Dellagi, K. , Tunisian Fanconi Anemia Study Group, 2003. Fanconi anemia in Tunisia: high prevalence of group A and identification of new FANCA mutations. J. Hum. Genet.. 48, 352–361. [DOI] [PubMed] [Google Scholar]
  6. Callén, E. , Tischkowitz, M.D. , Creus, A. , Marcos, R. , Bueren, J.A. , Casado, J.A. , Mathew, C.G. , Surrallés, J. , 2004. Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients. Cytogenet. Genome Res.. 104, 341–345. [DOI] [PubMed] [Google Scholar]
  7. Cantor, S.B. , Bell, D.W. , Ganesan, S. , Kass, E.M. , Drapkin, R. , Grossman, S. , Wahrer, D.C. , Sgroi, D.C. , Lane, W.S. , Haber, D.A. , Livingston, D.M. , 2001. BACH1, a novel helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell. 105, 149–160. [DOI] [PubMed] [Google Scholar]
  8. Cantor, S. , Drapkin, R. , Zhang, F. , Lin, Y. , Han, J. , Pamidi, S. , Livingston, D.M. , 2004. The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations. Proc. Natl. Acad. Sci. U. S. A.. 101, 2357–2362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cartegni, L. , Wang, J. , Zhu, Z. , Zhang, M.Q. , Krainer, A.R. , 2003. ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acids Res.. 31, 3568–3571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Castella, M. , Pujol, R. , Callén, E. , Trujillo, J.P. , Casado, J.A. , Gille, H. , Lach, F.P. , Auerbach, A.D. , Schindler, D. , Benítez, J. , Porto, B. , Ferro, T. , Muñoz, A. , Sevilla, J. , Madero, L. , Cela, E. , Beléndez, C. , de Heredia, C.D. , Olivé, T. , de Toledo, J.S. , Badell, I. , Torrent, M. , Estella, J. , Dasí, A. , Rodríguez-Villa, A. , Gómez, P. , Barbot, J. , Tapia, M. , Molinés, A. , Figuera, A. , Bueren, J.A. , Surrallés, J. , 2011. Origin, functional role, and clinical impact of Fanconi anemia FANCA mutations. Blood. 117, 3759–3769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Centra, M. , Memeo, E. , d'Apolito, M. , Savino, M. , Ianzano, L. , Notarangelo, A. , Liu, J. , Doggett, N.A. , Zelante, L. , Savoia, A. , 1998. Fine exon-intron structure of the Fanconi anemia group A (FAA) gene and characterization of two genomic deletions. Genomics. 51, 463–467. [DOI] [PubMed] [Google Scholar]
  12. De Winter, J.P. , van der Weel, L. , de Groot, J. , Stone, S. , Waisfisz, Q. , Arwert, F. , Scheper, R.J. , Kruyt, F.A. , Hoatlin, M.E. , Joenje, H. , 2000. The Fanconi anemia protein FANCF forms a nuclear complex with FANCA, FANCC and FANCG. Hum. Mol. Genet.. 9, 2665–2674. [DOI] [PubMed] [Google Scholar]
  13. Desjardins, S. , Beauparlant, C.J. , Labrie, Y. , Ouellette, G. , Simard, J. , BRCAs, I.N.H.E.R.I.T. , Durocher, F. , 2009. Variations in the Nijmegen Breakage Syndrome gene, NBN/NBS1, and the risk of breast cancer in high-risk non-BRCA1 and BRCA2 French Canadian breast cancer ovarian cancer families. BMC Cancer. 9, 181 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Desjardins, S. , Belleau, P. , Labrie, Y. , Ouellette, G. , Bessette, P. , Chiquette, J. , Laframboise, R. , Lépine, J. , Lespérance, B. , Pichette, R. , Plante, M. , BRCAs, I.N.H.E.R.I.T. , Durocher, F. , 2008. Genetic variants and haplotype analyses of the ZBRK1/ZNF350 gene in high-risk non BRCA1/2 French Canadian breast and ovarian cancer families. Int. J. Cancer. 122, 108–116. [DOI] [PubMed] [Google Scholar]
  15. Desmet, F.O. , Hamroun, D. , Lalande, M. , Collod-Béroud, G. , Claustres, M. , Béroud, C. , 2009. Human Splicing Finder: an online bioinformatics tool to predict splicing signals. Nucleic Acids Res.. 37, e67 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dietz, H.C. , Valle, D. , Francomano, C.A. , Kendzior, R.J. , Pyeritz, R.E. , Cutting, G.R. , 1993. The skipping of constitutive exons in vivo induced by nonsense mutations. Science. 259, 680–683. [DOI] [PubMed] [Google Scholar]
  17. Durocher, F. , Labrie, Y. , Soucy, P. , Sinilnikova, O. , Labuda, D. , Bessette, P. , Chiquette, J. , Laframboise, R. , Lépine, J. , Lespérance, B. , Ouellette, G. , Pichette, R. , Plante, M. , Tavtigian, S.V. , Simard, J. , 2006. Mutation analysis and characterization of ATR sequence variants in breast cancer cases from high-risk French Canadian breast/ovarian cancer families. BMC Cancer. 6, 230 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Erkko, H. , Xia, B. , Nikkila, J. , Schleutker, J. , Syrjakoski, K. , Mannermaa, A. , Kallioniemi, A. , Pylkas, K. , Karppinen, S.M. , Rapakko, K. , Miron, A. , Sheng, Q. , Li, G. , Mattila, H. , Bell, D.W. , Haber, D.A. , Grip, M. , Reiman, M. , Jukkola-Vuorinen, A. , Mustonen, A. , Kere, J. , Aaltonen, L.A. , Kosma, V.M. , Kataja, V. , Soini, Y. , Drapkin, R.I. , Livingston, D.M. , Winqvist, R. , 2007. A recurrent mutation in PALB2 in Finnish cancer families. Nature. 446, 316–319. [DOI] [PubMed] [Google Scholar]
  19. Ferrer, M. , Rodríguez, J.A. , Spierings, E.A. , de Winter, J.P. , Giaccone, G. , Kruyt, F.A. , 2005. Identification of multiple nuclear export sequences in Fanconi anemia group A protein that contribute to CRM1-dependent nuclear export. Hum. Mol. Genet.. 14, 1271–1281. [DOI] [PubMed] [Google Scholar]
  20. Folias, A. , Matkovic, M. , Bruun, D. , Reid, S. , Hejna, J. , Grompe, M. , D'Andrea, A. , Moses, R. , 2002. BRCA1 interacts directly with the Fanconi anemia protein FANCA. Hum. Mol. Genet.. 11, 2591–2597. [DOI] [PubMed] [Google Scholar]
  21. Hasselbach, L. , Haase, S. , Fischer, D. , Kolberg, H.C. , Stürzbecher, H.W. , 2005. Characterisation of the promoter region of the human DNA-repair gene Rad51. Eur. J. Gynaecol. Oncol.. 26, 589–598. [PubMed] [Google Scholar]
  22. Knipscheer, P. , Räschle, M. , Smogorzewska, A. , Enoiu, M. , Ho, T.V. , Schärer, O.D. , Elledge, S.J. , Walter, J.C. , 2009. The Fanconi anemia pathway promotes replication-dependent DNA interstrand cross-link repair. Science. 326, 1698–1701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kozak, M. , 1986. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell. 44, 283–292. [DOI] [PubMed] [Google Scholar]
  24. Lensch, M.W. , Tischkowitz, M. , Christianson, T.A. , Reifsteck, C.A. , Speckhart, S.A. , Jakobs, P.M. , O'Dwyer, M.E. , Olson, S.B. , Le Beau, M.M. , Hodgson, S.V. , Mathew, C.G. , Larson, R.A. , Bagby, G.C. , 2003. Acquired FANCA dysfunction and cytogenetic instability in adult acute myelogenous leukemia. Blood. 102, 7–16. [DOI] [PubMed] [Google Scholar]
  25. Levran, O. , Diotti, R. , Pujara, K. , Batish, S.D. , Hanenberg, H. , Auerbach, A.D. , 2005. Spectrum of sequence variations in the FANCA gene: an International Fanconi anemia Registry (IFAR) study. Hum. Mutat.. 25, 142–149. [DOI] [PubMed] [Google Scholar]
  26. Levran, O. , Doggett, N.A. , Auerbach, A.D. , 1998. Identification of Alu-mediated deletions in the Fanconi anemia gene FAA. Hum. Mutat.. 12, 145–152. [DOI] [PubMed] [Google Scholar]
  27. Mathe, E. , Olivier, M. , Kato, S. , Ishioka, C. , Hainaut, P. , Tavtigian, S.V. , 2006. Computational approaches for predicting the biological effect of p53 missense mutations: a comparison of three sequence analysis based methods. Nucleic Acids Res.. 34, 1317–1325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mathew, C.G. , 2006. Fanconi anemia genes and susceptibility to cancer. Oncogene. 25, 5875–5884. [DOI] [PubMed] [Google Scholar]
  29. Medhurst, A.L. , Huber, P.A. , Waisfisz, Q. , de Winter, J.P. , Mathew, C.G. , 2001. Direct interactions of the five known Fanconi anemia proteins suggest a common functional pathway. Hum. Mol. Genet.. 10, 423–429. [DOI] [PubMed] [Google Scholar]
  30. Medhurst, A.L. , Laghmani, el H. , Steltenpool, J. , Ferrer, M. , Fontaine, C. , de Groot, J. , Rooimans, M.A. , Scheper, R.J. , Meetei, A.R. , Wang, W. , Joenje, H. , de Winter, J.P. , 2006. Evidence for subcomplexes in the Fanconi anemia pathway. Blood. 108, 2072–2080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Meindl, A. , Hellebrand, H. , Wiek, C. , Erven, V. , Wappenschmidt, B. , Niederacher, D. , Freund, M. , Lichtner, P. , Hartmann, L. , Schaal, H. , Ramser, J. , Honisch, E. , Kubisch, C. , Wichmann, H.E. , Kast, K. , Deissler, H. , Engel, C. , Müller-Myhsok, B. , Neveling, K. , Kiechle, M. , Mathew, C.G. , Schindler, D. , Schmutzler, R.K. , Hanenberg, H. , 2010. Germline mutations in breast and ovarian cancer pedigrees establish RAD51C as a human cancer susceptibility gene. Nat. Genet.. 42, 410–414. [DOI] [PubMed] [Google Scholar]
  32. Moldovan, G.L. , D'Andrea, A.D. , 2009. How the fanconi anemia pathway guards the genome. Annu. Rev. Genet.. 43, 223–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Morgan, N.V. , Tipping, A.J. , Joenje, H. , Mathew, C.G. , 1999. High frequency of large intragenic deletions in the Fanconi anemia group A gene. Am. J. Hum. Genet.. 65, 1330–1341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Najafi, M. , Jangravi, Z. , 2010. Human PON promoters: from similarity to prediction of polymorphic positions within transcription factor elements. Mini Rev. Med. Chem.. 10, 938–945. [DOI] [PubMed] [Google Scholar]
  35. Nakamura, A. , Matsuura, S. , Tauchi, H. , Hanada, R. , Ohashi, H. , Hasagawa, T. , Honda, K. , Masuno, M. , Imaizumi, K. , Sugita, K. , Ide, T. , Komatsu, K. , 1999. Four novel mutations of the Fanconi anemia group A gene (FAA) in Japanese patients. J. Hum. Genet.. 44, 48–51. [DOI] [PubMed] [Google Scholar]
  36. Naylor, J.A. , Green, P.M. , Rizza, C.R. , Giannelli, F. , 1993. Analysis of factor VIII mRNA reveals defects in everyone of 28 haemophilia A patients. Hum. Mol. Genet.. 2, 11–17. [DOI] [PubMed] [Google Scholar]
  37. Ng, P.C. , Henikoff, S. , 2003. SIFT: predicting amino acid changes that affect protein function. Nucleic Acids Res.. 31, 3812–3814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Notredame, C. , Higgins, D.G. , Heringa, J. , 2000. T-Coffee: a novel method for fast and accurate multiple sequence alignment. J. Mol. Biol.. 302, 205–217. [DOI] [PubMed] [Google Scholar]
  39. Otsuki, T. , Furukawa, Y. , Ikeda, K. , Endo, H. , Yamashita, T. , Shinohara, A. , Iwamatsu, A. , Ozawa, K. , Liu, J.M. , 2001. Fanconi anemia protein, FANCA, associates with BRG1, a component of the human SWI/SNF complex. Hum. Mol. Genet.. 10, 2651–2660. [DOI] [PubMed] [Google Scholar]
  40. Pang, Z. , Yao, L. , Zhang, J. , Ouyang, T. , Li, J. , Wang, T. , Fan, Z. , Fan, T. , Lin, B. , Xie, Y. , 2011 May 20. RAD51C germline mutations in Chinese women with familial breast cancer. Breast Cancer Res. Treat.. (Epub ahead of print) [DOI] [PubMed] [Google Scholar]
  41. Rahman, N. , Seal, S. , Thompson, D. , Kelly, P. , Renwick, A. , Elliott, A. , Reid, S. , Spanova, K. , Barfoot, R. , Chagtai, T. , Jayatilake, H. , McGuffog, L. , Hanks, S. , Evans, D.G. , Eccles, D. , Breast Cancer Susceptibility Collaboration (UK) Easton, D.F. , Stratton, M.R. , 2007. PALB2, which encodes a BRCA2-interacting protein, is a breast cancer susceptibility gene. Nat. Genet.. 39, 165–167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Ramensky, V. , Bork, P. , Sunyaev, S. , 2002. Human non-synonymous SNPs: server and survey. Nucleic Acids Res.. 30, 3894–3900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Raschle, M. , Knipscheer, P. , Enoiu, M. , Angelov, T. , Sun, J. , Griffith, J.D. , Ellenberger, T.E. , Schärer, O.D. , Walter, J.C. , 2008. Cell. 134, 969–980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Reese, M.G. , Eeckman, F.H. , Kulp, D. , Haussler, D. , 1997. Improved splice site detection in genie. J. Comput. Biol.. 4, 311–323. [DOI] [PubMed] [Google Scholar]
  45. Reuter, T. , Herterich, S. , Bernhard, O. , Hoehn, H. , Gross, H.J. , 2000. Strong FANCA/FANCG but weak FANCA/FANCC interaction in the yeast 2-hybrid system. Blood. 95, 719–720. [PubMed] [Google Scholar]
  46. Ricketts, M.H. , Simons, M.J. , Parma, J. , Mercken, L. , Dong, Q. , Vassart, G. , 1987. A nonsense mutation causes hereditary goitre in the Afrikander cattle and unmasks alternative splicing of thyroglobulin transcripts. Proc. Natl. Acad. Sci. U. S. A.. 84, 3181–3184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Savino, M. , Borriello, A. , D'Apolito, M. , Criscuolo, M. , Del Vecchio, M. , Bianco, A.M. , Di Perna, M. , Calzone, R. , Nobili, B. , Zatterale, A. , Zelante, L. , Joenje, H. , Della Ragione, F. , Savoia, A. , 2003. Spectrum of FANCA mutations in Italian Fanconi anemia patients: identification of six novel alleles and phenotypic characterization of the S858R variant. Hum. Mutat.. 22, 338–339. [DOI] [PubMed] [Google Scholar]
  48. Seal, S. , Barfoot, R. , Jayatilake, H. , Smith, P. , Renwick, A. , Bascombe, L. , McGuffog, L. , Evans, D.G. , Eccles, D. , Easton, D.F. , Stratton, M.R. , Rahman, N. , 2003. Breast cancer susceptibility Collaboration. Evaluation of Fanconi anemia genes in familial breast cancer predisposition. Cancer Res.. 63, 8596–8599. [PubMed] [Google Scholar]
  49. Seal, S. , Thompson, D. , Renwick, A. , Elliott, A. , Kelly, P. , Barfoot, R. , Chagtai, T. , Jayatilake, H. , Ahmed, M. , Spanova, K. , North, B. , McGuffog, L. , Evans, D.G. , Eccles, D. , Breast Cancer Susceptibility Collaboration (UK) Easton, D.F. , Stratton, M.R. , Rahman, N. , 2006. Truncating mutations in the Fanconi anemia J gene BRIP1 are low-penetrance breast cancer susceptibility alleles. Nat. Genet.. 38, 1239–1241. [DOI] [PubMed] [Google Scholar]
  50. Simard, J. , Dumont, M. , Moisan, A.M. , Gaborieau, V. , Malouin, H. , Durocher, F. , Chiquette, J. , Plante, M. , Avard, D. , Bessette, P. , Brousseau, C. , Dorval, M. , Godard, B. , Houde, L. , BRCAs, I.N.H.E.R.I.T. , Joly, Y. , Lajoie, M.A. , Leblanc, G. , Lépine, J. , Lespérance, B. , Vézina, H. , Parboosingh, J. , Pichette, R. , Provencher, L. , Rhéaume, J. , Sinnett, D. , Samson, C. , Simard, J.C. , Tranchant, M. , Voyer, P. , Easton, D. , Tavtigian, S.V. , Knoppers, B.M. , Laframboise, R. , Bridge, P. , Goldgar, D. , 2007. Evaluation of BRCA1 and BRCA2 mutation prevalence, risk prediction models and a multistep testing approach in French-Canadian families with high risk of breast and ovarian cancer. J. Med. Genet.. 44, 107–121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Smith, P.J. , Zhang, C. , Wang, J. , Chew, S.L. , Zhang, M.Q. , Krainer, A.R. , 2006. An increased specificity score matrix for the prediction of SF2/ASF-specific exonic splicing enhancers. Hum. Mol. Genet.. 15, 2490–2508. [DOI] [PubMed] [Google Scholar]
  52. Solyom, S. , Winqvist, R. , Nikkilä, J. , Rapakko, K. , Hirvikoski, P. , Kokkonen, H. , Pylkäs, K. , 2011. Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family. Cancer Lett.. 302, 113–118. [DOI] [PubMed] [Google Scholar]
  53. Somyajit, K. , Subramanya, S. , Nagaraju, G. , 2010. RAD51C: a novel cancer susceptibility gene is linked to Fanconi anemia and breast cancer. Carcinogenesis. 31, 2031–2038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sridharan, D. , Brown, M. , Lambert, W.C. , McMahon, L.W. , Lambert, M.W. , 2003. Nonerythroid alphaII spectrin is required for recruitment of FANCA and XPF to nuclear foci induced by DNA interstrand cross-links. J. Cell. Sci.. 116, 823–835. [DOI] [PubMed] [Google Scholar]
  55. Stratton, M.R. , Rahman, N. , 2008. The emerging landscape of breast cancer susceptibility. Nat. Genet.. 40, 17–22. [DOI] [PubMed] [Google Scholar]
  56. Sunyaev, S. , Ramensky, V. , Koch, I. , Lathe, W. , Kondrashov, A.S. , Bork, P. , 2001. Prediction of deleterious human alleles. Hum. Mol. Genet.. 10, 591–597. [DOI] [PubMed] [Google Scholar]
  57. Tachibana, A. , Kato, T. , Ejima, Y. , Yamada, T. , Shimizu, T. , Yang, L. , Tsunematsu, Y. , Sasaki, M.S. , 1999. The FANCA gene in Japanese Fanconi anemia: reports of eight novel mutations and analysis of sequence variability. Hum. Mutat.. 13, 237–244. [DOI] [PubMed] [Google Scholar]
  58. Tamary, H. , Bar-Yam, R. , Shalmon, L. , Rachavi, G. , Krostichevsky, M. , Elhasid, R. , Barak, Y. , Kapelushnik, J. , Yaniv, I. , Auerbach, A.D. , Zaizov, R. , 2000. Fanconi anaemia group A (FANCA) mutations in Israeli non-Ashkenazi Jewish patients. Br. J. Haematol.. 111, 338–343. [DOI] [PubMed] [Google Scholar]
  59. Tavtigian, S.V. , Deffenbaugh, A.M. , Yin, L. , Judkins, T. , Scholl, T. , Samollow, P.B. , de Silva, D. , Zharkikh, A. , Thomas, A. , 2006. Comprehensive statistical study of 452 BRCA1 missense substitutions with classification of eight recurrent substitutions as neutral. J. Med. Genet.. 43, 295–305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Thompson, E. , Dragovic, R.L. , Stephenson, S.A. , Eccles, D.M. , Campbell, I.G. , Dobrovic, A. , 2005. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer. BMC Cancer. 5, 43 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Tipping, A.J. , Pearson, T. , Morgan, N.V. , Gibson, R.A. , Kuyt, L.P. , Havenga, C. , Gluckman, E. , Joenje, H. , de Ravel, T. , Jansen, S. , Mathew, C.G. , 2001. Molecular and genealogical evidence for a founder effect in Fanconi anemia families of the Afrikaner population of South Africa. Proc. Natl. Acad. Sci. U. S. A. 98, 5734–5739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Tischkowitz, M. , Easton, D.F. , Ball, J. , Hodgson, S.V. , Mathew, C.G. , 2008. Cancer incidence in relatives of British Fanconi anaemia patients. BMC Cancer. 8, 257 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Wang, W. , 2007. Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins. Nat. Rev. Genet.. 8, 735–748. [DOI] [PubMed] [Google Scholar]
  64. Wang, S.S. , Bratti, M.C. , Rodríguez, A.C. , Herrero, R. , Burk, R.D. , Porras, C. , González, P. , Sherman, M.E. , Wacholder, S. , Lan, Z.E. , Schiffman, M. , Chanock, S.J. , Hildesheim, A. , 2009. Common variants in immune and DNA repair genes and risk for human papillomavirus persistence and progression to cervical cancer. J. Infect. Dis.. 199, 20–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Wijker, M. , Morgan, N.V. , Herterich, S. , van Berkel, C.G. , Tipping, A.J. , Gross, H.J. , Gille, J.J. , Pals, G. , Savino, M. , Altay, C. , Mohan, S. , Kokal, I. , Cavenagh, J. , Marsh, J. , van Weel, M. , Ortega, J.J. , Schuler, D. , Samochatova, E. , Karwacki, M. , Bekassy, A.N. , Abecasis, M. , Ebell, W. , Kwee, M.L. , de Ravel, T. , Mathew, C.G. , 1999. Heterogeneous spectrum of mutations in the Fanconi anemia group A gene. Eur. J. Hum. Genet.. 7, 52–59. [DOI] [PubMed] [Google Scholar]
  66. Yagasaki, H. , Hamanoue, S. , Oda, T. , Nakahata, T. , Asano, S. , Yamashita, T. , 2004. Identification and characterization of novel mutations of the major Fanconi anemia gene FANCA in the Japanese population. Hum. Mutat.. 24, 481–490. [DOI] [PubMed] [Google Scholar]
  67. Zheng, Y. , Zhang, J. , Hope, K. , Niu, Q. , Huo, D. , Olopade, O.I. , 2010. Screening RAD51C nucleotide alterations in patients with a family history of breast and ovarian cancer. Breast Cancer Res. Treat.. 124, 857–861. [DOI] [PubMed] [Google Scholar]
  68. Zhu, Y. , Spitz, M.R. , Lei, L. , Mills, G.B. , Wu, X. , 2001. A single nucleotide polymorphism in the matrix metalloproteinase-1 promoter enhances lung cancer susceptibility. Cancer Res.. 61, 7825–7829. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

The following are the supplementary data related to this article:

Supplementary data

Supplementary data


Articles from Molecular Oncology are provided here courtesy of Wiley

RESOURCES