Skip to main content
Molecular Oncology logoLink to Molecular Oncology
. 2013 Nov 19;8(2):221–231. doi: 10.1016/j.molonc.2013.11.004

Functional characterization of a novel FGFR1OP‐RET rearrangement in hematopoietic malignancies

Daniela Bossi 1, Francesca Carlomagno 2, Isabella Pallavicini 1, Giancarlo Pruneri 3, Maurizio Trubia 1, Paola Rafaniello Raviele 3, Alessandra Marinelli 4, Suresh Anaganti 2, Maria Christina Cox 5, Giuseppe Viale 3, Massimo Santoro 2,✉, Pier Paolo Di Fiore 1,6,7,✉, Saverio Minucci 1,4,✉
PMCID: PMC5528547  PMID: 24315414

Abstract

The RET (REarranged during Transfection) receptor tyrosine kinase is targeted by oncogenic rearrangements in thyroid and lung adenocarcinoma. Recently, a RET (exon 12) rearrangement with FGFR1OP [fibroblast growth factor receptor 1 (FGFR1) oncogene partner] (exon 12) was identified in one chronic myelomonocytic leukemia (CMML) patient. We report the molecular cloning and functional characterization of a novel FGFR1OP (exon 11)‐RET (exon 11) gene fusion event (named FGFR1OP‐RET), mediated by a reciprocal translocation t(6; 10)(q27; q11), in a patient affected by primary myelofibrosis (PMF) with secondary acute myeloid leukemia (AML). The FGFR1OP‐RET fusion protein displayed constitutive tyrosine kinase and transforming activity in NIH3T3 fibroblasts, and induced IL3‐independent growth and activation of PI3K/STAT signaling in hematopoietic Ba/F3 cells. FGFR1OP‐RET supported cytokine‐independent growth, protection from stress and enhanced self‐renewal of primary murine hematopoietic progenitor and stem cells in vitro. In vivo, FGFR1OP‐RET caused a spectrum of disease phenotypes, with >50% of mice showing a fatal myeloproliferative disorder (MPD). Other phenotypes were leukemia transplantable in secondary recipients, dramatic expansion of the mast cell lineage, and reduction of repopulating activity upon lethal irradiation. In conclusion, FGFR1OP‐RET chimeric oncogenes are endowed with leukemogenic potential and associated to myeloid neoplasms (CMML and PMF/AML).

Keywords: FGFR1OP‐RET, Chromosomal translocation, Murine models, Myeloproliferative disorders, Leukemia, Mast cells

Highlights

  • FGFR1OP‐RET fusion was identified in a myelofibrosis with secondary AML patient.

  • FGFR1OP‐RET has transforming activity in vitro.

  • FGFR1OP‐RET promotes cell survival through the PI3K/JAK/STAT pathway.

  • FGFR1OP‐RET increases self‐renewal of hematopoietic primary progenitors.

  • FGFR1OP‐RET induces myeloproliferation and leukemias in mice.

1. Introduction

Myeloproliferative disorders (MPDs) are characterized by an overproduction of blood cells without obvious defects in maturation, and are considered clonal alterations of hematopoietic stem and/or progenitor cells (Koopmans et al., 2012; Vardiman et al., 2008; Tefferi, 2012b; Sloma et al., 2010). MPDs can present various clinical forms including: Chronic Myelogenous Leukemia (CML), Chronic Eosinophilic Leukemia, Chronic Neutrophilic Leukemia, Polycytemia Vera, Primary Myelofibrosis (PMF), Essential Thrombocytosis, and – together with myelodysplastic syndromes (MDS) and chronic myelomonocytic leukemia (CMML) – they are classified as chronic myeloid neoplasms (Vardiman, 2012). MPDs frequently represent the prelude to acute leukemia, characterized by a sudden increase in proliferation rate and maturation block (blast crisis in CML, leukemic transformation in other forms (Hehlmann and Saussele, 2008; Kundranda et al., 2012).

Recurrent activating somatic mutations in JAK2 are found in a large fraction of non‐CML MPDs, highlighting the role of aberrant cytokine signaling (James et al., 2005; Kralovics et al., 2005). Transgenic models have indeed shown that alterations of the JAK‐STAT signaling pathway are critical for the development of MPDs and secondary leukemia, but in several cases the reported phenotypes reproduce only in part the human disease (Li et al., 2010, 2011, 2012). Approximately half of MPDs, however, does not present JAK2 mutations; mutations of epigenetic regulators, such as TET2, ASXL1 and DNMT3A, have been found in one third of MPDs, as well as in CMML and MDS (Nikoloski et al., 2012; Langemeijer et al., 2009; Tefferi et al., 2009a; Yamazaki et al., 2012; Gelsi‐Boyer et al., 2010; Thol et al., 2011; Jankowska et al., 2011; Walter et al., 2011).

Genetic alterations of the tyrosine kinase (TK) receptor RET (REarranged during Transfection) have been initially reported in papillary thyroid carcinomas, leading to the fusion of the catalytic domain of the receptor to heterologous oligomerization domains encoded by different genes (Takahashi, 2001; Santoro and Carlomagno, 2006c; Lipson et al., 2012; Takeuchi et al., 2012; Kohno et al., 2012). More recently, two cases of chromosomal translocations causing the fusion of RET TK to FGFR1OP (fibroblast growth factor receptor 1 (FGFR1) oncogene partner) or BCR genes have been described in CMML (Ballerini et al., 2012).

Here, we report the identification of an additional case of FGFR1OP‐RET translocation in an MPD patient, and the detailed biochemical and biological properties of the resulting fusion protein both in vitro and in vivo.

2. Materials and methods

2.1. FISH analysis

Metaphases of bone marrow cells were obtained from a patient with primary myelofibrosis as described (Cox et al., 2001). The t(6; 10)(q27; q11) translocation was characterized by FISH as described (Cox et al., 2001).

2.2. RT‐PCR

RT‐PCR of the FGFR10P‐RET fusion transcript was performed using FGFR10P Ex5‐F (5′‐AAGAAAAAGGGCCAACCACT‐3′) and RET Ex17‐R (5′‐GCAGGACACCAAAAGACCAT‐3′). The reverse fusion transcript RET‐FGFR10P was looked for using RET Ex9‐F (5′‐TGTGGAGACCCAAGACATCA‐3′) and FGFR10P Ex12‐R (5′‐AATCCGCAACATCACTGAGC‐3′). The PCR has been tested on mRNA isolated from bone marrow cells obtained from the PMF patient.

2.3. Vectors

The cDNA of FGFR10P‐RET RET fusion transcript was generated in two steps. The N‐terminal FGFR10P moiety and the breakpoint were amplified by PCR using FGFR10P Ex1‐F (5′‐GGGGTACCGAGCTCGGATCCATGGCGGCGACGGCG‐3′) and RET Ex17‐R (5′‐GCAGGACACCAAAAGACCAT‐3′) primers and then cloned into the pcDNA3.1 expression vector (pcDNA3.1‐FGFR10P‐BP‐RETN). The C‐terminal RET fragment was obtained by EcoRI enzymatic digestion from pcDNA3.1‐Ret (already in use in our laboratory) and cloned into pcDNA3.1‐FGFR10P‐BP‐RETN). The K758R mutation of human FGFR10P‐RET was obtained by using the Gene Editor™ in vitro site‐directed mutagenesis kit (Promega, Madison, WI). The presence of the mutation was confirmed by sequencing in both forward and reverse directions. All retroviral vectors encoding FGFR10P‐RET derive from pcDNA3.1‐based expression vectors, cloning FGFR1OP‐RET and the kinase‐dead FGFR1OP‐RET(KD) into pMSCV‐IRES‐EGFP as HpaI/EcoRI fragments (Cheng et al., 1996), or into myc‐ and flag‐tagged pBABE‐puro retroviral vectors as BamHI/EcoRI fragments. The pBABE‐puro vectors expressing RET, NCOA4‐RET have been described elsewhere (Santoro et al., 1994, 1995).

2.4. Antibodies

To detect RET and FGFR1OP‐RET, we used a rabbit anti‐RET (C19) (Santa Cruz Biotechnology (Heidelberg, Germany) or a polyclonal antibody raised against the tyrosine kinase protein fragment of human RET as described elsewhere (Santoro et al., 1994). Mouse anti‐myc (9E10) was from Santa Cruz Biotechnology (Heidelberg, Germany); mouse anti‐STAT3 (9139), rabbit anti‐STAT3pY705 (9131) and rabbit anti‐STAT5pY694 (9351) were from Cell Signaling (Danvers, MA); rabbit anti‐STAT5 (ab7679) was from Abcam (Cambridge, UK); mouse anti‐phosphotyrosine (pY) (4G10) was from Upstate Laboratories (Waltham, MA, USA) and mouse anti‐Flag (F3040) was from Sigma (St Louis, MO, USA).

2.5. Focus formation assay

NIH3T3 cells were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% Calf Serum, 2 mM l‐glutamine, and 100 units/ml penicillin‐streptomycin (GIBCO, Paisley, PA). Cells were transfected with pBABE‐NCOA4‐RET or pBABE‐FGFR1OP‐RET expressing vectors (or empty vector) using the calcium phosphate precipitation method as described elsewhere (Santoro et al., 1994, 1995). Transformed foci were scored at 2 weeks. Transforming efficiency was calculated in focus‐forming units per picomole of added DNA, after normalization for the efficiency of colony formation in parallel dishes subjected to neomycin selection. For the soft‐agar colony assay, cells were seeded on 60‐mm plates (10,000 cells/plate) in 0.3% agar in complete medium on a base layer of 0.5% agar. Colonies larger than 64 cells were counted 15 days later. HEK293 cells were grown in DMEM supplemented with 10% fetal calf serum, 2 mM l‐glutamine, and 100 units/ml penicillin‐streptomycin (GIBCO). HEK293 transient transfections were carried out with the lipofectamine reagent according to manufacturer's instructions (GIBCO).

2.6. Kinase assay

For the in vitro RET auto‐phosphorylation assay, subconfluent cells were solubilized in lysis buffer. Then, protein extracts (200 μg) were incubated with anti‐RET antibodies; immunocomplexes were recovered with protein A sepharose beads, washed five times with kinase buffer, and incubated 20 min at room temperature in kinase buffer containing 2.5 μCi [γ‐32P] ATP and unlabelled ATP (20 μM). Samples were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Gels were dried and exposed to film for autoradiography. Signal intensity was analyzed using a Phosphorimager (Typhoon 8600) interfaced with the ImageQuant TL7.0 (G&E Healthcare life Sciences).

2.7. Proliferation assay

Ba/F3 cells stably expressing FGFR1OP‐RET or its derivatives were obtained by transduction. Using spinoculation, we achieved an efficiency of infection greater than 95%. Two days after infection, Ba/F3 cells (105 cells/well) were grown in triplicate in the presence or absence of interleukin‐3 (IL3). The number of viable cells was measured by trypan blue exclusion. For drug treatments, LY294002 and PD98059 (Sigma–Aldrich) were used at a concentration of 5 μM and 50 μM, respectively.

2.8. Purification of Lin − cells

Murine hematopoietic progenitors (Lineage negative or Lin − cells) were purified from the bone marrow of 8‐ to 10‐weeks old 129SvEv mice. After centrifugation through a Ficoll gradient, mononucleate cells were enriched for progenitors by depletion of cells presenting myeloid, erythroid, and lymphoid differentiation markers using commercially available reagents (Stem Cell Technologies, Vancouver, BC, Canada) (Minucci et al., 2002).

2.9. Transduction and sorting of Lin‐cells

Lin− cells were grown for 36 h in medium supplemented with mouse IL3 (20 ng/ml, Peprotech), mouse interleukin‐6 (m‐IL6; 20 ng/ml, Peprotech) and mouse Stem Cell Factor (m‐SCF; 100 ng/ml, Peprotech). The cells were then plated onto retronectin‐coated (Takara‐Shuzo, Shiga, Japan), non–tissue culture–treated plates and exposed to the supernatant of packaging, ecotropic 293T cells transiently transfected with the indicated retroviral vectors. Transduced cells were sorted using a Becton Dickinson (Franklin Lakes, NJ) FACS Vantage instrument. Purity of sorted cells was more than 98% in all experiments.

2.10. Survival assays

Sorted Lin‐cells were subjected to starvation by depleting supplemented cytokines in liquid medium. Four hours after cytokine deprivation, Lin‐cells were treated with X‐rays (2 Gy). For analysis of colony forming cells (CFCs), cells were plated in methylcellulose medium 24 h after treatments. 8–10 days after plating, colonies were counted. Data were plotted as means plus standard deviations from three independent experiments. For the proliferation assays, 24 h after cytokine deprivation and X‐rays treatment, Lin‐cells were plated in standard liquid medium and their viability tested daily by trypan blue staining. Apoptosis was quantified by evaluating the sub‐G1 fraction, after cell permeabilization and propidium iodide (PI) (50 μg/ml) staining (Insinga et al., 2004).

2.11. Methylcellulose assays

To analyze differentiation in vitro, transduced and sorted Lin‐cells were plated (5000 cells/plate) in methylcellulose medium (MC3434; Stem Cell Technology, Vancouver, BC, Canada) containing Fetal Calf Serum (FCS), m‐IL3, m‐IL6, m‐SCF, m‐Erythropoietin and Granulocyte‐Monocyte‐Colony Stimulating Factor (m‐GM‐CSF; 20 ng/ml, Peprotech). Ten days after plating, colonies were counted, and stained by May‐Grünwald‐Giemsa. Pooled colonies were harvested, stained using APC‐conjugated Mac‐1 and PE‐conjugated Gr1 (eBioscience) antibodies and then analyzed by FACS (Becton Dickinson FACScan). For serial replating assays, after the first passage in semisolid medium, pooled colonies were serially re‐seeded (10,000 cells/plate) in methylcellulose, as previously described (Minucci et al., 2002; Insinga et al., 2004). This procedure was repeated until no colonies developed in control plates (usually after 2–3 passages), due to terminal differentiation of the cells.

2.12. Long‐term culture‐initiating cell (LTC‐IC) assays

To prepare stroma layers, BM cells were extracted from 129sv mice and then cultured in IMDM medium supplemented with 12.5% horse serum, 12.5% fetal bovine serum, penicillin, streptomycin, 1 μM hydrocortisone and 50 μM 2‐β‐mercaptoethanol at 34 °C. After 4 weeks, confluent stroma layers were trypsinized, sub cultured in 24 multi‐well plates, and irradiated (150 cGy). Pre‐irradiated stroma feeder layers were seeded with transduced and sorted Lin‐cells. Co‐cultures were refreshed weekly. After 4–6 weeks, non‐adherent cells were harvested and then plated in methylcellulose medium as described above. At day 14, colonies (LTC‐IC) were counted as described (Dexter et al., 1997).

2.13. Generation and analysis of a murine model to study FGFR1OP‐RET function

Donor mice were used at 8–10 weeks of age, while recipient mice were transplanted at 12–14 weeks of age. GFP + Lin‐cells expressing FGFR1OP‐RET (or GFP alone as control) were injected intravenously (106 cells/mouse) into lethally irradiated (800 cGy) 129sv recipient mice, along with 250,000 spleen cells (obtained from an untreated mouse) as previously described (Minucci et al., 2002). After transplantation, mice were checked weekly for clinical signs of disease and for the presence of abnormal cells in the blood smear, by May‐Grünwald‐Giemsa staining. Mice with signs of disease were sacrificed by CO2 inhalation and subjected to necropsy. Tissues were fixed in 4% buffered formalin and processed for histological examination. In the case of leukemias, fresh blast cells were injected intravenously (106 cells/mouse) in secondary recipient mice. Presence of blast cells was evaluated in peripheral blood smears stained by May‐Grünwald‐Giemsa. Cells were stained with FITC‐conjugated CD4, PE‐conjugated Gr1 or CD8, PEcy7‐conjugated CD3 or Sca‐1, APC‐conjugated Mac1 or c‐Kit and Pacific Blue‐conjugated CD45R antibodies and analyzed by FACS using Becton Dickinson FACScan and Flow Jo software. All procedures involving animals were done in accordance with national and international laws and policies.

2.14. Statistical analysis

Statistical analysis was performed using an ANOVA or a Student's t‐test. Results from survival experiments were analyzed with a log‐rank non‐parametric test and expressed as Kaplan–Meier survival curves.

3. Results

3.1. FGFR1OP‐RET is a constitutively active kinase and displays transforming activity in NIH3T3 cells

We characterized the genetic lesion in a patient affected by PMF that progressed to M5a AML, harboring the t(6; 10)(q27; q11) translocation since the stage of PMF. To map the breakpoint, a cohort of region specific genomic clones, covering human 6q27 and 10q11 chromosomal regions, were used as FISH probes. PAC 167a14 and BAC 366n23 containing FGFR1OP and RET genes and mapping on chromosomes 6 and 10, respectively, produced a split signal, suggesting the possibility that FGFR1OP and RET were fused secondary to the translocation (Fig. S1A and data not shown). RT‐PCR on total RNA extracted from patient‐derived bone marrow cells, using FGFR1OP and RET specific amplimers, yielded a specific product of 1.5 Kb (Fig. S1A). Sequencing revealed that exon 11 of FGFR1OP was fused in‐frame to the 3′ portion of exon 11 of RET, giving rise to a FGFR1OP‐RET chimeric transcript (Fig. S1C). This fusion differed from the previously described FGFR1OP‐RET, in which the fusion occurred between FGFR1OP intron 13 and RET intron 11, leading to the transcription of a chimeric mRNA in which FGFR1OP exon 12 was fused in frame to RET exon 12 (Fig. S1B) (Ballerini et al., 2012). We failed, in repeated RT‐PCR attempts to amplify any band corresponding to the reciprocal fusion transcript (RET‐FGFR1OP).

We tested the transforming activity in vitro of FGFR1OP‐RET in a focus‐formation assay in NIH3T3 cells. As controls, we used wt RET and NCOA4‐RET, a well‐described RET‐derived rearranged oncogene (Santoro et al., 1994, 1995) (Figure 1A). FGFR1OP‐RET was capable of inducing foci of transformation, albeit at lower efficiency than NCOA4‐RET (1 × 102 vs. 2 × 103 foci/pmole of DNA) and to confer anchorage‐independent growth to NIH3T3 cells (Figure 1B–C). The transforming ability of FGFR1OP‐RET was most likely due to the constitutive activation of its kinase moiety. Indeed, FGFR1OP‐RET showed high levels of tyrosine phosphorylation in intact cells (Figure 1D) and of intrinsic kinase activity in an in vitro immunocomplex kinase assay (Figure 1E). In comparison, wt RET did not display detectable levels of autophosphorylation in intact cells and only weak activity in vitro (Figure 1D–E).

Figure 1.

Figure 1

FGFR1OP‐RET has constitutive kinase activity and transforms NIH3T3 cells. (A) Schematic representation of FGFR1OP‐RET, NCOA4‐RET and RET proteins. CC: coiled‐coil domain; LISH: Lis homology domain; TM: transmembrane domain; TK: tyrosine kinase domain. (B) Foci Formation Unit [(FFU)/picomol of DNA] and anchorage‐independent growth efficiency in soft agar of cells transduced by RET‐derived chimeric genes (or empty vector as control). Transforming activity was corrected for the efficiency of transfection calculated in parallel plates subjected to neomycin selection. Cells (2 × 104) were plated in soft agar in 60‐mm culture dishes, and the colony formation was scored at 15 days. Colonies larger than 64 cells and with an efficiency ratio [(number of colonies formed/number of plated cells) × 100] of about 80% were observed in NCOA4‐RET transfectants (+++). Smaller colonies, on average, and with an efficiency of about 40% were observed in the FGFR1OP‐RET transfectants (+). No colonies were observed in the case of RET wt and empty vector transfectants (negative). Results are the mean of three experiments performed in duplicate. (C) Representative microphotographs (50×‐magnification) of soft‐agar colonies of FGFR1OP‐RET‐ and NCOA4‐RET‐transduced NIH3T3 cells. (D) Comparable amounts of RET proteins from NIH3NCOA4‐RET transfectants, 2 independent clones (Cl1 and Cl2) and one bulk population (m.p.) of FGFR1OP‐RET‐transduced cells taken as a pool were immunoprecipitated with anti‐RET polyclonal antibody and immunoblotted with anti‐phosphotyrosine (anti‐pY) or anti‐RET antibody. (E) Another set of anti‐RET immunoprecipitates was divided in two. One half was subjected to an in vitro immunocomplex kinase assay (left panel) and the second half was immunoblotted with anti‐RET for normalization (right panel). Kinase assay reactions were run on SDS‐PAGE; gels were dried and quantified by phosphorimaging. The results are representative of three independent experiments. (F) Myc‐ or FLAG‐tagged FGFR1OP‐RET, FGFR1OP‐FLAG and RET TK‐FLAG expressing vectors were co‐transfected as indicated in HEK293 cells. Protein lysates (500 μg) were immunoprecipitated with an anti‐myc antibody and then immunoblotted using an anti‐FLAG antibody (right panel). Total extracts were immunoblotted with an anti‐myc antibody as a loading control (left panel).

A general mechanism of protein kinases activation relies on their dimerization, both under physiological conditions and in hybrid proteins present in cancer (Endicott et al., 2012; Lemmon and Schlessinger, 2010). A region in FGFR1OP (residues 52–134), encompassing the LISH domain (Lis‐homology motif), is able to form dimers (Figure 1A) (Mikolajka et al., 2006). Therefore, the constitutive activation of FGFR1OP‐RET might be due to ligand‐independent dimerization mediated by its FGFR1OP moiety. To test this hypothesis, we co‐expressed two differently tagged (myc‐ and FLAG‐) FGFR1OP‐RET proteins in HEK293 cells and checked whether they formed a complex in vivo. As a positive control, we used wt FGFR1OP‐FLAG while the isolated RET kinase domain (RET‐KD) was employed as a negative control. As we shown in Figure 1F, FGFR1OP‐RET‐FLAG and FGFR1OP‐FLAG proteins, but not RET‐KD‐FLAG, co‐immunoprecipitated with respectively FGFR1OP‐RET‐myc and FGFR1OP‐myc, indicating the ability of the chimeric protein to dimerize.

Taken together, these results point to an oncogenic activity exerted by FGFR1OP‐RET mediated by its constitutive dimerization and kinase activation.

3.2. FGFR1OP‐RET promotes survival of hematopoietic Ba/F3 cells through activation of the PI3K/STAT signaling pathway

We stably transfected immortalized IL3‐dependent hematopoietic Ba/F3 cells with expression vectors for FGFR1OP‐RET and for a mutant version carrying an inactivating mutation in its TK domain [FGFR1OP‐RET(KD)] (Fig. S2 and data not shown). Control cells (transduced with the empty vector) underwent cell death when grown in the absence of IL3, while FGFR1OP‐RET promoted IL3‐independent growth (Figure 2A). The kinase activity of the chimeric protein was essential since FGFR1OP‐RET(KD) was unable to sustain IL3‐independent survival (Figure 2A).

Figure 2.

Figure 2

FGFR1OP‐RET promotes IL3‐independent survival and proliferation of Ba/F3 cells through activation of PI‐3K/STAT signaling. (A) Cell growth curves of Ba/F3 cells transduced with viral vectors expressing FGFR1OP‐RET or the kinase‐inactive mutant FGFR1OP‐RET(KD), and cultured in presence (left panel) or absence (right panel) of IL3. Viable cells were counted daily by using trypan blue dye, over a period of 3 days. As control, we used Ba/F3 cells transduced with the empty expression vector (CNTR) (B) Growth curves of Ba/F3 cells after treatment with a PI3K or MEK inhibitor (LY294002 and PD98059, respectively). Ba/F3 cells expressing FGFR1OP‐RET were plated in IL3‐free medium (−IL3) and treated with 50 μM PD98059 or 5 μM LY294002 (C) Activation of STAT5 and STAT3 in Ba/F3 cells expressing either FGFR1OP‐RET, FGFR1OP‐RET(KD) or empty vector (CNTR) grown in standard (+IL3) or IL3‐free medium (−IL3). Western blot analysis was performed on whole‐cell lysates with phospho‐specific anti‐STA5pY694 and anti‐STAT3pY705 antibodies. Vinculin was used as a loading control.

Cytokine receptors promote survival and growth through PI3K and its downstream signaling pathway (Baker et al., 2007; Matsumura et al., 2008; McCubreya et al., 2006; Steelman et al., 2004). Accordingly, treatment of Ba/F3 cells expressing FGFR1OP‐RET with the PI3K inhibitor LY294002 blocked the ability of FGFR1OP‐RET to promote cell growth in the absence of IL3, while an inhibitor of MAPK was ineffective (Figure 2B). Activation of members of the STAT family of transcription factors is critical for cytokine‐mediated proliferative, differentiative, and survival stimuli (Steelman et al., 2004; Smithgall et al., 2000). In addition, STAT5a/b activation is essential for BCR‐ABL or JAK2 V617F‐induced myeloproliferative neoplasms in mice12. Therefore, we tested Ba/F3 cells transduced with FGFR1OP‐RET, or its kinase‐dead mutant, for the presence of phosphorylated (i.e. active) STAT proteins upon IL3 deprivation. FGFR1OP‐RET expression resulted in STAT5 and STAT3 phosphorylation in the absence of IL3 (Figure 2C and Fig S3). Again, these effects were abrogated when the kinase‐inactive FGFR1OP‐RET(KD) was used (Figure 2C).

Taken together, these results point to PI3K and STAT3/5 activation as key steps for FGFR1OP‐RET mediated cytokine‐independent cell survival and growth.

3.3. FGFR1OP‐RET protects from X‐rays irradiation and cytokine deprivation and increases self‐renewal of primary hematopoietic progenitors in vitro

We investigated the effects of FGFR1OP‐RET expression in primary murine hematopoietic progenitors (Lin‐cells) (Minucci et al., 2002). Lin‐cells were transduced with retroviral vectors expressing FGFR1OP‐RET or FGFR1OP‐RET(KD) together with GFP to purify the transduced cells (see Fig. S3 for expression levels of the fusion proteins). Upon methylcellulose plating in the presence of a cytokine cocktail supporting myeloid differentiation, we noted that the colonies derived from FGFR1OP‐RET cells were similar in number and size to those of control cells (Figure 3A). In addition, FGFR1OP‐RET cells were morphological similar to parental cells and showed comparable level of differentiation markers expression, such as Mac1 and Gr1, indicating that FGFR1OP‐RET did not affect the ability of hematopoietic progenitors to differentiate in vitro (Fig. S4A–B).

Figure 3.

Figure 3

FGFR1OP‐RET protects Lin‐cells from cytokine deprivation and X‐rays irradiation. Lin‐cells transduced with FGFR1OP‐RET, its kinase‐inactive mutant (KD) or empty expression vector (CNTR) were subjected or not (untreated) to cytokine depletion (−Cyt) followed by (2Gy) X‐rays treatment (−Cyt + X‐rays). After 24 h, cells were either seeded in methylcellulose (A), or analyzed for apoptosis (B), or plated in liquid culture (C). (A) The graph shows the mean number of colonies arising from 10,000 transduced Lin‐cells: upon cytokine deprivation, FGFR1OP‐RET (but not KD) transduced cells kept colony formation ability both with (ANOVA: F = 19.05, p = 0.020) or without (ANOVA: F = 16.56, p = 0.024) X‐rays treatment. (B) Apoptosis analysis by FACS after PI staining. Each data point represents the mean of at least three independent experiments. CTRL cells (ANOVA: F = 9.27, p = 0.007) and FGFR1OP‐RET(KD) cells (ANOVA: F = 49.94, p = 0.005) show a significant increase in apoptosis, while apoptosis rate of FGFR1OP‐RET expressing cells was comparable to untreated cells. (C) Growth cultures in liquid culture of Lin‐cells transduced and treated as indicated. Cells were counted daily by trypan blue dye.

Cytokines such as IL3, IL6 and SCF are essential for survival of hematopoietic progenitors, and for suppression of X‐rays‐induced apoptosis in vitro (Insinga et al., 2004) After cytokine deprivation, control Lin‐cells showed a significant drop in the number of colonies in methylcellulose medium, and an increase in apoptosis in liquid culture: these events were further enhanced by concomitant exposure to X‐rays (Figure 3). FGFR1OP‐RET expression dramatically increased Lin‐cells survival in methylcellulose and liquid culture assays upon cytokine deprivation alone, or in association with X‐rays irradiation (Figure 3). Notably, this protective activity of FGFR1OP‐RET was dependent on its kinase activity, since the catalytically inactive FGFR1OP‐RET(KD) fusion protein showed a phenotype virtually identical to control Lin‐cells (Figure 3).

The proliferative potential of Lin‐cells decreases after serial passaging in methylcellulose, and at the 3rd/4th passage the colony‐forming ability is virtually exhausted (Figure 4A). In contrast, FGFR1OP‐RET expressing cells retained the ability to stably form colonies for at least four passages (Figure 4A). Interestingly, FGFR1OP‐RET cells maintained the ability to differentiate into morphologically mature myeloid cells up to the 4th passage, consistent with the lack of modulation of differentiation observed at the 1st passage (Fig. S4B).

Figure 4.

Figure 4

FGFR1OP‐RET increases the proliferative potential of myeloid progenitor and stem cells. (A) Immediately after sorting, Lin‐cells expressing FGFR1OP‐RET, FGFR1OP‐RET(KD) or the empty vector (CNTR) were plated in methylcellulose and re‐seeded serially, until CNTR cells exhausted their ability to yield colonies. In the graph are reported the number of colonies counted after each passage. The assay was repeated two times and each data point was obtained from four replicates. The difference among samples was statistically significant at ANOVA starting from the third passage (Plating 1: F = 1.48, p = 0.358; Plating 2: F = 8.47, p = 0.058; Plating 3: F = 12.415, p = 0.035; Plating 4: F = 324.0, p < 0.001). (B) The graph shows the number of LTC‐IC (CFC number) present in 10,000 Lin‐cells transduced as indicated. The LTC assay was repeated three times and each data point was generated from at least four replicates. FGFR1OP‐RET cells showed a significant increase (Student's t test) of LTC‐IC number in comparison to both CTRL cells (p = 0.009) and FGFR1OP‐RET(KD) cells (p = 0.014).

Increased proliferative potential of hematopoietic progenitors is frequently associated with enhanced self‐renewal properties of the stem cell component. Therefore, we performed LTC (Long‐Term Culture) assays to directly measure the function of the stem cell compartment upon FGFR1OP‐RET expression in vitro (Dexter et al., 1997). Transduced Lin‐cells were co‐cultured with a stroma‐derived feeder layer; after 8 weeks, cells were plated in methylcellulose, and the number of LTC initiating cells (LTC‐IC) was determined, based on the number of observed colonies (LTC‐ICs are a direct function of the number of stem cells at the moment of plating). As shown in Figure 4B, FGFR1OP‐RET enhanced the number of LTC‐ICs by 3‐fold. Increase in proliferative potential and number of LTC‐ICs depended on an intact kinase domain of FGFR1OP‐RET (Figure 4A and B).

Taken together, these results show that FGFR1OP‐RET, through its kinase activity, is able to increase hematopoietic stem cell self‐renewal and protects cells from stress.

3.4. FGFR1OP‐RET induces a myeloproliferative disorder and leukemias in mice

Finally, we investigated the effect of expression of FGFR1OP‐RET in vivo. Lin‐cells were transduced with viral vectors expressing FGFR1OP‐RET and GFP (or GFP only, as control) and then, after GFP sorting, transduced cells were inoculated into lethally irradiated syngeneic recipients. In contrast to control mice, who survived with no signs of disease, 100% of mice that received FGFR1OP‐RET expressing cells died within 7 months (Figure 5A). Approximately one third of the mice died quickly after transplantation (most of them within three weeks), showing signs of bone marrow failure, suggesting that FGFR1OP‐RET expressing hematopoietic stem cells have a weaker bone marrow reconstituting potential than wild‐type cells (Figure 5A). Most (57%) of the remaining mice showed histological evidence of myeloproliferative disease: in particular, their bone marrow was characterized by trilineage hyperplasia with increased red cell mass, leukocytosis and thrombocytosis in the absence of myelodysplasia (Figure 5B and Table S1). Maturation of myeloid and erythroid lineages appeared normal, without any excess of blasts. The megakaryocyte lineage displayed marked hyperplasia with several aggregates of large megakaryocytes with convoluted nuclei (Figure 5C). Moreover, an increased number of interstitial mast cells were observed in most of the cases (data not shown). Spleen and liver showed extra medullary hematopoiesis with evident signs of hyperplasia without myelodysplasia and without increased number of myeloblasts (Table S1). In a significant number of cases (33%), multifocal aggregates of medium sized cells with large cytoplasm and small indented nuclei without evident nucleoli, morphologically resembling monocytes, were detectable in the spleen, liver and lung (Table S1). We did not observe signs of primary myelofibrosis in the recipient mice, unlike the original clinical case where the FGFR1OP‐RET translocation was cloned.

Figure 5.

Figure 5

FGFR1OP‐RET induces a severe hematological phenotype in vivo. (A) Survival of mice transplanted with sorted GFP + cells expressing FGFR1OP‐RET, or the empty vector (CNTR). (B) Spectrum of diseases in FGFR1OP‐RET mice. The pie chart illustrates the frequency rate for each observed hematological disorder. (C–E) Representative histological analyses of tissues from mice inoculated with FGFR1OP‐RET expressing cells. Hematoxylin and eosin staining of tissue sections (Bone Marrow and Spleen; X40): (C) myeloproliferative disease (MPD): trilineage hyperplasia; (D) lymphoid leukemia; (E) Mast cell infiltration (right, toluidine blue staining).

One fourth of the mice (24%) developed a fatal leukemia, composed by immature cells characterized by round nuclei, evident nucleoli, and scarce cytoplasm. Leukemic cells showed a high mitotic index coupled with apoptotic bodies and punctuate necrosis, and formed large tumor sheets in the bone marrow and extra medullary sites (Figure 5B and D). FACS analysis showed that leukemic cells were derived from the lymphoid lineage and that simultaneously expressed c‐Kit and Sca1 stem markers and either CD4/CD8 T cell receptor (Type 1 T‐cell leukemias CD4+CD8+c‐kit + Sca1+) or B220 B cell receptor (Type 2 B‐cell leukemias B220+ c‐Kit + Sca1+) markers (Fig. S5). Leukemic mice showed massive hepatomegaly and splenomegaly (Table S1). The histological analysis demonstrated the presence of blasts in the peripheral blood, in the bone marrow, in the spleen and in the liver (Figure 5D and data not shown). In addition, leukemias were serially transplantable by inoculation of spleen cells (infiltrated with 50–80% leukemic cells) into non‐irradiated secondary recipients. The secondary recipients developed a secondary leukemia with short latency (between 3 and 5 weeks) and with features identical to those observed in the primary recipient mice (Fig. S5).

Finally, in some mice (14%) we observed a massive infiltration of mast cells, associated with depletion of other bone marrow progenitors (Figures 5B and E). Spleen and liver were completely unstructured, due to the expanded mast cell compartment. Mast cell infiltration in bone marrow and (more rarely) spleen was observed also in some mice died prematurely due to bone marrow failure (Table S1).

Taken together, these results show that FGFR1OP‐RET expression in the hematopoietic compartment is able to induce a fatal disease in vivo, with a complex phenotype consistent with the induction of a myeloproliferative syndrome and leukemic transformation.

4. Discussion

Here we report the identification of a t(6; 10)(q27; q11) chromosomal translocation yielding the FGFR1OP‐RET fusion protein in a PMF case with secondary M5a AML, and show its oncogenic activity in vitro and in vivo. At the molecular level, we show that fusion with the FGFR1OP portion, containing a bona fide oligomerization domain (LISH domain), leads to the constitutive activation of RET tyrosine kinase, and provide the proof that RET kinase gain‐of‐function contributes to FGFR1OP‐RET oncogenic activity. We cannot exclude that the FGFR1OP moiety contributes to FGFROP‐RET oncogenic activity also with additional mechanisms. Wild‐type FGFR1OP codes for a centrosomal protein required for cell cycle progression and survival, and is involved as a fusion partner of FGFR1 in patients with rare myeloproliferative disorders; thus, its genetic alteration may also contribute to leukemogenesis (Yan et al., 2006; Lelièvre al., 2008; Popovici et al., 1999).

FGFR1OP‐RET promotes Ba/F3 cell autonomy from cytokines in a PI3K dependent manner and leads to the activation of STAT3/5 transcription factors. RET signaling has been previously shown to activate STAT3 in both a JAK1/2 dependent and independent fashion (Plaza Menacho et al., 2005; Plaza‐Menacho et al., 2007). It is tempting to speculate that cells expressing FGFR1OP‐RET display a leukemogenic PI3K/STAT axis, as observed in myeloproliferative diseases driven by other oncogenic kinases (Walz et al., 2012; Baker et al., 2007; Matsumura et al., 2008; McCubreya et al., 2006; Steelman et al., 2004; Smithgall et al., 2000). Thus, RET rearrangements may belong to a common set of genetic alterations, that converge on an STAT‐dependent transcription program, able to and foster self‐renewal, stress resistance and myeloproliferative disease.

Expression of FGFR1OP‐RET in murine primary hematopoietic progenitors leads to an alteration of self‐renewal and dramatic inhibition of stress responses in vitro. Both p53 dependent (X‐rays treatment) and p53 independent (cytokine withdrawal) stress responses were equally inhibited by FGFR1OP‐RET signaling. Protection from stress and alteration of self‐renewal may be linked, since p53 has been shown to limit self‐renewal in hematopoietic stem cells. Interestingly, these results are partially at odds with comparable in vitro experiments previously reported, in which FGFR1OP‐RET did not extend self‐renewal of primary hematopoietic progenitors (Ballerini et al., 2012). Differences in experimental conditions or in the mouse strain used to derive Lin‐cells can explain those discrepancies. Consistent with a global unbalance in hematopoiesis due to the fusion protein, our in vivo characterization reveals that FGFR1OP‐RET expressing cells were less proficient in rescuing lethally irradiated mice than wild‐type cells.

Surviving mice developed a myeloproliferative disease, in some cases resembling human MPDs. In particular, a large fraction of animals developed an MPD featuring a trilingual (leukocytes, erytrocytes and megakaryocytes) expansion often accompanied by mast cell infiltration and monocyte expansion; other mice developed lymphoid leukemia or systemic mastocytosis (SM) (Pardanani, 2012; Valent et al., 2001). Interestingly, the same progenitor cell has been considered as the target cell in both SM and CMML (Pittoni et al., 2011). However, it should be noted that the disease developed in FGFR1OP‐RET mice only partially phenocopied human disorders (CMML or PMF) so far associated to FGFR1OP‐RET oncogenes (Ballerini et al., 2012; Cox et al., 2001). A possible explanation is that RET rearrangements might be present also in human MPDs other than CMML and PMF. Alternatively, differences between FGFR1OP‐RET‐associated human and murine diseases can be explained by differences in target cell or the host.

5. Conclusions

In conclusion, FGFR10P‐RET fusion oncoproteins display leukemogenic potential, thereby suggesting that pharmacological inhibition of RET signaling may be clinically exploited in RET‐mutant MPD patients. RET kinase inhibitors are available and can be clinically tested upon RET genotyping of MPD patients.

Conflict of interest

The authors declare no competing financial interests.

Supporting information

The following are the supplementary data related to this article:

Supplementary data

Fig. S1. Cloning of FGFR1OP‐RET. (A) In the left panel, FISH analysis was performed using the human genomic clone BAC 366n23 (chromosome 10) as probe on bone marrow (BM) cells derived from the patient carrying the t(6;10)(q27;q11) translocation. Arrows indicate wild type chromosome 10, der10 and der6 chromosomes. Similar results were obtained by using as probe the PAC 167a14 clone (chromosome 6) (data not shown). In the right panel, agarose gel electrophoresis of Reverse Transcriptase‐PCR reaction products obtained using cDNA (+) from the bone marrow of the patient under study, or buffer alone (−) and either RET forward primer (exon 9) and FGFR1OP reverse primer (exon 12) (RET‐FGFR1OP product) or FGFR1OP forward primer (exon 5) and RET reverse primer (exon 17) (FGFR1OP‐RET product). Expected sizes of the two RT‐PCR fragments (RET‐FGFR1OP and FGFR1OP‐RET) are indicated. (B) Schematic representation of FGFR1OP, RET, the previously described FGFR1OP‐RET (Ballerini et al., 2012) and the newly identified FGFR1OP‐RET chimeric proteins (this study). Amino acid numbering is indicated. The two breakpoints are indicated. Amino acid and nucleotide sequences at the rearrangement points are indicated: FGFR1OP‐derived nucleotide sequence is in upper case while RET‐derived sequence is in lower case letters: please note that the AGG triplet encoding Arg (R) in FGFR1OP‐RET (this study) derives in part from FGFR1OP (A and G nucleotides) and in part from RET (G nucleotide) sequences and therefore it is present neither in FGFR1OP nor in RET wild type proteins. The FGFR1OP dimerization domain (LISH: Lis homology domain, residues 69–102) is indicated; TM: transmembrane domain; TK: tyrosine kinase domain. (C) Electrophoregrams of the FGFR1OP‐RET (this study) fusion transcript demonstrating the fusion of FGFR1OP exon 11 to RET exon 11.

Fig. S2. Expression of FGFR1OP‐RET in Ba/F3 cells. Western blot analysis of cell lysates from Ba/F3 cells transduced with the indicated FGFR1OP‐RET expression vectors, using the anti‐RET antibody.

Fig. S3. Sorting of Lin‐ cells after transduction with FGFR1OP‐RET encoding vectors. Lin‐ cells transduced with the indicated FGFR1OP‐RET constructs or the empty vector (CNTR) were purified by FACS based on GFP expression. (A) FACS analysis of transduced Lin‐ cells before (upper panel) and after (bottom panel) sorting. (B) Western blot analysis of Lin‐ cells using an anti‐RET antibody immediately after sorting. Lane 1 represents Lin‐ cells infected with an empty vector that expresses only GFP; lanes 2–3 Lin‐ cells expressing FGFR1OP‐RET and its mutant FGFR1OP‐RET(KD).

Fig. S4. In vitro myeloid differentiation of Lin‐ cells infected with FGFR1OP‐RET constructs. Sorted Lin‐ cells transduced with the empty (CNTR), or the indicated FGFR1OP‐RET expression vectors were plated in methylcellulose medium. (A) Pooled colonies were analyzed by FACS for the presence of the myeloid differentiation markers Mac1 (left panel) and Gr‐1 (right panel), or (B) stained with May‐Grunwald‐Giemsa at the 1st and 4th plating in methylcellulose medium.

Fig. S5. Histopathology and immunophenotype of FGFR1OP‐RET induced secondary leukemia. Recipient mice were transplanted with bone marrow (106 cells/mouse) from primary FGFR1OP‐RET leukemic mice, and analyzed when they developed secondary disease. (A) Hematoxylin and eosin staining of bone marrow and spleen from mice with Type 1 and Type 2 secondary leukemias (see main text). (B) FACS analysis of blasts obtained from bone marrow of primary and secondary leukemic mice using antibodies against myeloid (Mac‐1 Gr‐1), lymphoid (B220,CD3,CD4 and CD8), or stem/progenitor (c‐Kit and Sca‐1) markers. As reference (CNTR), we used cells isolated from the bone marrow of control mice. Leukemic cells were simultaneously positive for (Type 1) CD4, CD8, c‐kit and Sca1, or (Type 2) B220, c‐Kit and Sca1 markers.

Acknowledgments

This study has been partially supported by grants of AIRC (Italian Association for Cancer Research) to M. Santoro and F. Carlomagno. Work is SM's lab is supported by AIRC (Italian Association for Cancer Research). We thank: Lorenzo Fornasari for statistical analyses, Simona Ronzoni for FACS acquisition and Elena Belloni, Eugenio Scanziani for help in the initial analyses. Contributions; SM, PPDF, MS, MT and DB‐conceived and designed the study and performed research; DB, IP, AM, PRR, FC, SA ‐performed experiments; MT, MS, FC, SA and GV provided critical reagents or analytical tools; DB, IP, AM, PRR, GP and GV analyzed data and SM, PPDF, MS, GP, DB wrote the manuscript.

Supplementary data 1.

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.molonc.2013.11.004.

Bossi Daniela, Carlomagno Francesca, Pallavicini Isabella, Pruneri Giancarlo, Trubia Maurizio, Raviele Paola Rafaniello, Marinelli Alessandra, Anaganti Suresh, Cox Maria Christina, Viale Giuseppe, Santoro Massimo, Di Fiore Pier Paolo and Minucci Saverio, (2014), Functional characterization of a novel FGFR1OP‐RET rearrangement in hematopoietic malignancies, Molecular Oncology, 8, doi: 10.1016/j.molonc.2013.11.004.

Contributor Information

Massimo Santoro, Email: masantor@unina.it.

Pier Paolo Di Fiore, Email: pierpaolo.difiore@ifom.eu.

Saverio Minucci, Email: saverio.minucci@ieo.eu.

References

  1. Baker, S.J. , Rane, S.G. , Reddy, E.P. , 2007. Hematopoietic cytokine receptor signaling. Oncogene. 26, 6724–6737. [DOI] [PubMed] [Google Scholar]
  2. Ballerini, P. , Struski, S. , Cresson, C. , Prade, N. , Toujani, S. , Deswarte, C. , Dobbelstein, S. , Petit, A. , Lapillonne, H. , Gautier, E.F. , Demur, C. , Lippert, E. , Pages, P. , Mansat-De Mas, V. , Donadieu, J. , Huguet, F. , Dastugue, N. , Broccardo, C. , Perot, C. , Delabesse, E. , 2012. RET fusion genes are associated with chronic myelomonocytic leukemia and enhance monocytic differentiation. Leukemia. 26, 2384–2389. [DOI] [PubMed] [Google Scholar]
  3. Cheng, L. , Fu, J. , Tsukamoto, A. , Hawley, R.G. , 1996. Use of green fluorescent protein variants to monitor gene transfer and expression in mammalian cells. Nat. Biotechnol.. 14, 606–609. [DOI] [PubMed] [Google Scholar]
  4. Cox, M.C. , Panetta, P. , Venditti, A. , Abruzzese, E. , Del Poeta, G. , Cantonetti, M. , Amadori, S. , 2001. New reciprocal translocation t(6;10) (q27;q11) associated with idiopathic myelofibrosis and eosinophilia. Leuk. Res.. 25, 349–351. [DOI] [PubMed] [Google Scholar]
  5. Dexter, T.M. , Allen, T.D. , Lajtha, L.G. , 1997. Conditions controlling the proliferation of haemopoietic stem cells in vitro. J. Cell. Physiol.. 91, 335–344. [DOI] [PubMed] [Google Scholar]
  6. Endicott, J.A. , Noble, M.E.M. , Johnson, L.N. , 2012. The structural basis for control of eukaryotic protein kinases. Annu. Rev. Biochem.. 81, 587–613. [DOI] [PubMed] [Google Scholar]
  7. Gelsi-Boyer, V. , Trouplin, V. , Roquain, J. , Adélaïde, J. , Carbuccia, N. , Esterni, B. , Finetti, P. , Murati, A. , Arnoulet, C. , Zerazhi, H. , Fezoui, H. , Tadrist, Z. , Nezri, M. , Chaffanet, M. , Mozziconacci, M.J. , Vey, N. , Birnbaum, D. , 2010. ASXL1 mutation is associated with poor prognosis and acute transformation in chronic myelomonocytic leukaemia. Br. J. Haematol.. 151, 365–375. [DOI] [PubMed] [Google Scholar]
  8. Hehlmann, R. , Saussele, S. , 2008. Treatment of chronic myeloid leukemia in blast crisis. Haematologica. 93, 1765–1769. [DOI] [PubMed] [Google Scholar]
  9. Insinga, A. , Monestiroli, S. , Ronzoni, S. , Carbone, R. , Pearson, M. , Pruneri, G. , Viale, G. , Appella, E. , Pelicci, P. , Minucci, S. , 2004. Impairment of p53 acetylation, stability and function by an oncogenic transcription factor. EMBO J.. 23, 1144–1154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. James, C. , Ugo, V. , Le Couédic, J.P. , Staerk, J. , Delhommeau, F. , Lacout, C. , Garçon, L. , Raslova, H. , Berger, R. , Bennaceur-Griscelli, A. , Villeval, J.L. , Constantinescu, S.N. , Casadevall, N. , Vainchenker, W. , 2005. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera. Nature. 434, 1144–1148. [DOI] [PubMed] [Google Scholar]
  11. Jankowska, A.M. , Makishima, H. , Tiu, R.V. , Szpurka, H. , Huang, Y. , Traina, F. , Visconte, V. , Sugimoto, Y. , Prince, C. , O'Keefe, C. , Hsi, E.D. , List, A. , Sekeres, M.A. , Rao, A. , McDevitt, M.A. , Maciejewski, J.P. , 2011. Mutational spectrum analysis of chronic myelomonocytic leukemia includes genes associated with epigenetic regulation: UTX, EZH2, and DNMT3A. Blood. 118, 3932–3941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kohno, T. , Ichikawa, H. , Totoki, Y. , Yasuda, K. , Hiramoto, M. , Nammo, T. , Sakamoto, H. , Tsuta, K. , Furuta, K. , Shimada, Y. , Iwakawa, R. , Ogiwara, H. , Oike, T. , Enari, M. , Schetter, A.J. , Okayama, H. , Haugen, A. , Skaug, V. , Chiku, S. , Yamanaka, I. , Arai, Y. , Watanabe, S. , Sekine, I. , Ogawa, S. , Harris, C.C. , Tsuda, H. , Yoshida, T. , Yokota, J. , Shibata, T. , 2012. KIF5B-RET fusions in lung adenocarcinoma. Nat. Med.. 18, 375–377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Koopmans, S.M. , Van Marion, A.M. , Schouten, H.C. , 2012. Myeloproliferative neoplasia: a review of clinical criteria and treatment. Neth. J. Med.. 70, 159–166. [PubMed] [Google Scholar]
  14. Kralovics, R. , Passamonti, F. , Buser, A.S. , Teo, S.S. , Tiedt, R. , Passweg, J.R. , Tichelli, A. , Cazzola, M. , Skoda, R.C. , 2005. A gain-of-function mutation of JAK2 in myeloproliferative disorders. N. Engl. J. Med.. 352, 1779–1790. [DOI] [PubMed] [Google Scholar]
  15. Kundranda, M.N. , Tibes, R. , Mesa, R.A. , 2012. Transformation of a chronic myeloproliferative neoplasm to acute myelogenous leukemia: does anything work?. Curr. Hematol. Malig Rep.. 7, 78–86. [DOI] [PubMed] [Google Scholar]
  16. Langemeijer, S.M. , Kuiper, R.P. , Berends, M. , Knops, R. , Aslanyan, M.G. , Massop, M. , Stevens-Linders, E. , van Hoogen, P. , van Kessel, A.G. , Raymakers, R.A. , Kamping, E.J. , Verhoef, G.E. , Verburgh, E. , Hagemeijer, A. , Vandenberghe, P. , de Witte, T. , van der Reijden, B.A. , Jansen, J.H. , 2009. Acquired mutations in TET2 are common in myelodysplastic syndromes. Nat. Genet.. 41, 838–842. [DOI] [PubMed] [Google Scholar]
  17. Lelièvre, H. , Chevrier, V. , Tassin, A.M. , Birnbaum, D. , 2008. Myeloproliferative disorder FGFR1OP-FGFR1 fusion kinase recruits phosphoinositide-3 kinase and phospholipase Cγ at the centrosome. Mol. Cancer. 7, 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lemmon, M.A. , Schlessinger, J. , 2010. Cell signaling by receptor tyrosine kinases. Cell. 25, 1117–1134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Li, J. , Spensberger, D. , Ahn, J.S. , Anand, S. , Beer, P.A. , Ghevaert, C. , Chen, E. , Forrai, A. , Scott, L.M. , Ferreira, R. , Campbell, P.J. , Watson, S.P. , Liu, P. , Erber, W.N. , Huntly, B.J. , Ottersbach, K. , Green, A.R. , 2010. JAK2 V617F impairs hematopoietic stem cell function in a conditional knock-in mouse model of JAK2 V617F-positive essential thrombocythemia. Blood. 116, 1528–1538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Li, J. , Kent, D.G. , Chen, E. , Green, A.R. , 2011. Mouse models of myeloproliferative neoplasms: JAK of all grades. Dis. Models Mech.. 4, 311–317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lipson, D. , Capelletti, M. , Yelensky, R. , Otto, G. , Parker, A. , Jarosz, M. , Curran, J.A. , Balasubramanian, S. , Bloom, T. , Brennan, K.W. , Donahue, A. , Downing, S.R. , Frampton, G.M. , Garcia, L. , Juhn, F. , Mitchell, K.C. , White, E. , White, J. , Zwirko, Z. , Peretz, T. , Nechushtan, H. , Soussan-Gutman, L. , Kim, J. , Sasaki, H. , Kim, H.R. , Park, S.I. , Ercan, D. , Sheehan, C.E. , Ross, J.S. , Cronin, M.T. , Jänne, P.A. , Stephens, P.J. , 2012. Identification of new ALK and RET gene fusions from colorectal and lung cancer biopsies. Nat. Med.. 18, 382–384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Matsumura, I. , Mizuki, M. , Kanakura, Y. , 2008. Roles for deregulated receptor tyrosine kinases and their downstream signaling molecules in hematologic malignancies. Cancer Sci.. 99, 479–485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. McCubrey, J.A. , Steelman, L.S. , Abrams, S.L. , Lee, J.T. , Chang, F. , Bertrand, F.E. , Navolanic, P.M. , Terrian, D.M. , Franklin, R.A. , D'Assoro, A.B. , Salisbury, J.L. , Mazzarino, M.C. , Stivala, F. , Libra, M. , 2006. Roles of the RAF/MEK/ERK and PI3K/PTEN/AKT pathways in malignant transformation and drug resistance. Adv. Enzyme Regul.. 46, 249–279. [DOI] [PubMed] [Google Scholar]
  24. Mikolajka, A. , Yan, X. , Popowicz, G.M. , Smialowski, P. , Nigg, E.A. , Holak, T.A. , 2006. Structure of the N-terminal domain of the FGFR1OP (FGFR1OP) protein and implications for its dimerization and centrosomal localization. J. Mol. Biol.. 359, 863–875. [DOI] [PubMed] [Google Scholar]
  25. Minucci, S. , Monestiroli, S. , Giavara, S. , Ronzoni, S. , Marchesi, F. , Insinga, A. , Diverio, D. , Gasparini, P. , Capillo, M. , Colombo, E. , Matteucci, C. , Contegno, F. , Lo-Coco, F. , Scanziani, E. , Gobbi, A. , Pelicci, P.G. , 2002. PML-RAR induces promyelocytic leukemias with high efficiency following retroviral gene transfer into purified murine hematopoietic progenitors. Blood. 100, 2989–2995. [DOI] [PubMed] [Google Scholar]
  26. Nikoloski, G. , van der Reijden, B.A. , Jansen, J.H. , 2012. Mutations in epigenetic regulators in myelodysplastic syndromes. Int. J. Hematol.. 1, 8–16. [DOI] [PubMed] [Google Scholar]
  27. Pardanani, A. , 2012. Systemic mastocytosis in adults: 2012 Update on diagnosis, risk stratification, and management. Am. J. Hematol.. 87, 401–411. [DOI] [PubMed] [Google Scholar]
  28. Pittoni, P. , Piconese, S. , Tripodo, C. , Colombo, M.P. , 2011. Tumor-intrinsic and -extrinsic roles of c-Kit: mast cells as the primary off-target of tyrosine kinase inhibitors. Oncogene. 30, 757–769. [DOI] [PubMed] [Google Scholar]
  29. Plaza Menacho, I. , Koster, R. , van der Sloot, A.M. , Quax, W.J. , Osinga, J. , van der Sluis, T. , Hollema, H. , Burzynski, G.M. , Gimm, O. , Buys, C.H. , Eggen, B.J. , Hofstra, R.M. , 2005. RET-familial medullary thyroid carcinoma mutants Y791F and S891A activate a Src/JAK/STAT3 pathway, independent of glial cell line-derived neurotrophic factor. Cancer Res.. 65, 1729–1737. [DOI] [PubMed] [Google Scholar]
  30. Plaza-Menacho, I. , van der Sluis, T. , Hollema, H. , Gimm, O. , Buys, C.H. , Magee, A.I. , Isacke, C.M. , Hofstra, R.M. , Eggen, B.J. , 2007. Ras/ERK1/2-mediated STAT3 Ser727 phosphorylation by familial medullary thyroid carcinoma-associated RET mutants induces full activation of STAT3 and is required for c-fos promoter activation, cell mitogenicity, and transformation. J. Biol. Chem.. 282, 6415–6424. [DOI] [PubMed] [Google Scholar]
  31. Popovici, C. , Zhang, B. , Grégoire, M.J. , Jonveaux, P. , Lafage-Pochitaloff, M. , Birnbaum, D. , Pébusque, M.J. , 1999. The t(6;8)(q27;p11) translocation in a stem cell myeloproliferative disorder fuses a novel gene, FGFR1OP, to fibroblast growth factor receptor 1. Blood. 93, 1381–1389. [PubMed] [Google Scholar]
  32. Santoro, M. , Dathan, N.A. , Berlingieri, M.T. , Bongarzone, I. , Paulin, C. , Grieco, M. , Pierotti, M.A. , Vecchio, G. , Fusco, A. , 1994. Molecular characterization of NCOA4-RET; a novel rearranged version of the RET proto-oncogene in a human thyroid papillary carcinoma. Oncogene. 9, 509–516. [PubMed] [Google Scholar]
  33. Santoro, M. , Carlomagno, F. , Romano, A. , Bottaro, D.P. , Dathan, N.A. , Grieco, M. , Fusco, A. , Vecchio, G. , Matoskova, B. , Kraus, M.H. , 1995. Activation of RET as a dominant transforming gene by germline mutations of MEN2A and MEN2B. Science. 267, 381–383. [DOI] [PubMed] [Google Scholar]
  34. Santoro, M. , Carlomagno, F. , 2006. Drug insight: small-molecule inhibitors of protein kinases in the treatment of thyroid cancer. Nat. Clin. Pract. Endocrinol. Metab.. 2, 42–52. [DOI] [PubMed] [Google Scholar]
  35. Sloma, I. , Jiang, X. , Eaves, A.C. , Eaves, C.J. , 2010. Insights into the stem cells of chronic myeloid leukemia. Leukemia. 24, 1823–1833. [DOI] [PubMed] [Google Scholar]
  36. Smithgall, T.E. , Briggs, S.D. , Schreiner, S. , Lerner, E.C. , Cheng, H. , Wilson, M.B. , 2000. Control of myeloid differentiation and survival by Stats. Oncogene. 19, 2612–2618. [DOI] [PubMed] [Google Scholar]
  37. Steelman, L.S. , Pohnert, S.C. , Shelton, J.G. , Franklin, R.A. , Bertrand, F.E. , McCubrey, J.A. , 2004. JAK/STAT, Raf/MEK/ERK, PI3K/Akt and BCR-ABL in cell cycle progression and leukemogenesis. Leukemia. 18, 189–218. [DOI] [PubMed] [Google Scholar]
  38. Takahashi, M. , 2001. The GDNF/RET signaling pathway and human diseases. Cytokine Growth Factor Rev.. 12, 361–373. [DOI] [PubMed] [Google Scholar]
  39. Takeuchi, K. , Soda, M. , Togashi, Y. , Suzuki, R. , Sakata, S. , Hatano, S. , Asaka, R. , Hamanaka, W. , Ninomiya, H. , Uehara, H. , Lim Choi, Y. , Satoh, Y. , Okumura, S. , Nakagawa, K. , Mano, H. , Ishikawa, Y. , 2012. RET, ROS1 and ALK fusions in lung cancer. Nat. Med.. 18, 378–381. [DOI] [PubMed] [Google Scholar]
  40. Tefferi, A. , Lim, K.H. , Abdel-Wahab, O. , Lasho, T.L. , Patel, J. , Patnaik, M.M. , Hanson, C.A. , Pardanani, A. , Gilliland, D.G. , Levine, R.L. , 2009. Detection of mutant TET2 in myeloid malignancies other than myeloproliferative neoplasms: CMML, MDS, MDS/MPN and AML. Leukemia. 23, 1343–1345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tefferi, A. , 2012. Myeloproliferative neoplasms 2012: the John M. Bennett 80th birthday anniversary lecture. Leuk. Res.. 36, 1481–1489. [DOI] [PubMed] [Google Scholar]
  42. Thol, F. , Friesen, I. , Damm, F. , Yun, H. , Weissinger, E.M. , Krauter, J. , Wagner, K. , Chaturvedi, A. , Sharma, A. , Wichmann, M. , Göhring, G. , Schumann, C. , Bug, G. , Ottmann, O. , Hofmann, W.K. , Schlegelberger, B. , Heuser, M. , Ganser, A. , 2011. Prognostic significance of ASXL1 mutations in patients with myelodysplastic syndromes. J. Clin. Oncol.. 29, 2499–2506. [DOI] [PubMed] [Google Scholar]
  43. Valent, P. , Horny, H.P. , Escribano, L. , Longley, B.J. , Li, C.Y. , Schwartz, L.B. , Marone, G. , Nuñez, R. , Akin, C. , Sotlar, K. , Sperr, W.R. , Wolff, K. , Brunning, R.D. , Parwaresch, R.M. , Austen, K.F. , Lennert, K. , Metcalfe, D.D. , Vardiman, J.W. , Bennett, J.M. , 2001. Diagnostic criteria and classification of mastocytosis: a consensus proposal. Leuk. Res.. 25, 603–625. [DOI] [PubMed] [Google Scholar]
  44. Vardiman, J. , 2012. The classification of MDS: from FAB to WHO and beyond. Leuk. Res.. 36, 1453–1458. [DOI] [PubMed] [Google Scholar]
  45. Vardiman, J.W. , Thiele, J. , Arber, D.A. , Brunning, R.D. , Borowitz, M.J. , Porwit, A. , Harris, N.L. , Le Beau, M.M. , Hellström-Lindberg, E. , Tefferi, A. , Bloomfield, C.D. , 2008. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood. 114, 937–951. [DOI] [PubMed] [Google Scholar]
  46. Walter, M.J. , Ding, L. , Shen, D. , Shao, J. , Grillot, M. , McLellan, M. , Fulton, R. , Schmidt, H. , Kalicki-Veizer, J. , O'Laughlin, M. , Kandoth, C. , Baty, J. , Westervelt, P. , DiPersio, J.F. , Mardis, E.R. , Wilson, R.K. , Ley, T.J. , Graubert, T.A. , 2011. Recurrent DNMT3A mutations in patients with myelodysplastic syndromes. Leukemia. 25, 1153–1158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Walz, C. , Ahmed, W. , Lazarides, K. , Betancur, M. , Patel, N. , Hennighausen, L. , Zaleskas, V.M. , Van Etten, R.A. , 2012. Essential role for Stat5a/b in myeloproliferative neoplasms induced by BCR-ABL1 and JAK2V617F in mice. Blood. 119, 3550–3560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yamazaki, J. , Taby, R. , Vasanthakumar, A. , Macrae, T. , Ostler, K.R. , Shen, L. , Kantarjian, H.M. , Estecio, M.R. , Jelinek, J. , Godley, L.A. , Issa, J.P. , 2012. Effects of TET2 mutations on DNA methylation in chronic myelomonocytic leukemia. Epigenetics. 7, 201–207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yan, X. , Habedanck, R. , Nigg, E.A. , 2006. A complex of two centrosomal proteins, CAP350 and FGFR1OP, cooperates with EB1 in microtubule anchoring. Mol. Biol. Cell. 17, 634–644. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

The following are the supplementary data related to this article:

Supplementary data

Fig. S1. Cloning of FGFR1OP‐RET. (A) In the left panel, FISH analysis was performed using the human genomic clone BAC 366n23 (chromosome 10) as probe on bone marrow (BM) cells derived from the patient carrying the t(6;10)(q27;q11) translocation. Arrows indicate wild type chromosome 10, der10 and der6 chromosomes. Similar results were obtained by using as probe the PAC 167a14 clone (chromosome 6) (data not shown). In the right panel, agarose gel electrophoresis of Reverse Transcriptase‐PCR reaction products obtained using cDNA (+) from the bone marrow of the patient under study, or buffer alone (−) and either RET forward primer (exon 9) and FGFR1OP reverse primer (exon 12) (RET‐FGFR1OP product) or FGFR1OP forward primer (exon 5) and RET reverse primer (exon 17) (FGFR1OP‐RET product). Expected sizes of the two RT‐PCR fragments (RET‐FGFR1OP and FGFR1OP‐RET) are indicated. (B) Schematic representation of FGFR1OP, RET, the previously described FGFR1OP‐RET (Ballerini et al., 2012) and the newly identified FGFR1OP‐RET chimeric proteins (this study). Amino acid numbering is indicated. The two breakpoints are indicated. Amino acid and nucleotide sequences at the rearrangement points are indicated: FGFR1OP‐derived nucleotide sequence is in upper case while RET‐derived sequence is in lower case letters: please note that the AGG triplet encoding Arg (R) in FGFR1OP‐RET (this study) derives in part from FGFR1OP (A and G nucleotides) and in part from RET (G nucleotide) sequences and therefore it is present neither in FGFR1OP nor in RET wild type proteins. The FGFR1OP dimerization domain (LISH: Lis homology domain, residues 69–102) is indicated; TM: transmembrane domain; TK: tyrosine kinase domain. (C) Electrophoregrams of the FGFR1OP‐RET (this study) fusion transcript demonstrating the fusion of FGFR1OP exon 11 to RET exon 11.

Fig. S2. Expression of FGFR1OP‐RET in Ba/F3 cells. Western blot analysis of cell lysates from Ba/F3 cells transduced with the indicated FGFR1OP‐RET expression vectors, using the anti‐RET antibody.

Fig. S3. Sorting of Lin‐ cells after transduction with FGFR1OP‐RET encoding vectors. Lin‐ cells transduced with the indicated FGFR1OP‐RET constructs or the empty vector (CNTR) were purified by FACS based on GFP expression. (A) FACS analysis of transduced Lin‐ cells before (upper panel) and after (bottom panel) sorting. (B) Western blot analysis of Lin‐ cells using an anti‐RET antibody immediately after sorting. Lane 1 represents Lin‐ cells infected with an empty vector that expresses only GFP; lanes 2–3 Lin‐ cells expressing FGFR1OP‐RET and its mutant FGFR1OP‐RET(KD).

Fig. S4. In vitro myeloid differentiation of Lin‐ cells infected with FGFR1OP‐RET constructs. Sorted Lin‐ cells transduced with the empty (CNTR), or the indicated FGFR1OP‐RET expression vectors were plated in methylcellulose medium. (A) Pooled colonies were analyzed by FACS for the presence of the myeloid differentiation markers Mac1 (left panel) and Gr‐1 (right panel), or (B) stained with May‐Grunwald‐Giemsa at the 1st and 4th plating in methylcellulose medium.

Fig. S5. Histopathology and immunophenotype of FGFR1OP‐RET induced secondary leukemia. Recipient mice were transplanted with bone marrow (106 cells/mouse) from primary FGFR1OP‐RET leukemic mice, and analyzed when they developed secondary disease. (A) Hematoxylin and eosin staining of bone marrow and spleen from mice with Type 1 and Type 2 secondary leukemias (see main text). (B) FACS analysis of blasts obtained from bone marrow of primary and secondary leukemic mice using antibodies against myeloid (Mac‐1 Gr‐1), lymphoid (B220,CD3,CD4 and CD8), or stem/progenitor (c‐Kit and Sca‐1) markers. As reference (CNTR), we used cells isolated from the bone marrow of control mice. Leukemic cells were simultaneously positive for (Type 1) CD4, CD8, c‐kit and Sca1, or (Type 2) B220, c‐Kit and Sca1 markers.


Articles from Molecular Oncology are provided here courtesy of Wiley

RESOURCES