Skip to main content
Molecular Oncology logoLink to Molecular Oncology
. 2014 Jul 3;8(8):1640–1652. doi: 10.1016/j.molonc.2014.06.015

A novel small‐molecule activator of procaspase‐3 induces apoptosis in cancer cells and reduces tumor growth in human breast, liver and gallbladder cancer xenografts

Fangyang Wang 1, Lihui Wang 1, Yanfang Zhao 2, Yi Li 1, Guanfang Ping 1, Shu Xiao 1, Kang Chen 1, Wufu Zhu 2, Ping Gong 2,✉, Jingyu Yang 1,✉, Chunfu Wu 1,✉
PMCID: PMC5528581  PMID: 25053517

Abstract

Purpose

Procaspase‐3, a proenzyme of apoptotic executioner caspase‐3, is overexpressed in numerous tumors. We aimed to characterize a novel procaspase‐3 activator, WF‐210, which may have potential as an anticancer drug.

Experimental design

The procaspase‐3 activating ability, antitumor efficacy, mechanisms of action, and toxicity profiles of WF‐210 were investigated in vitro and in vivo, using normal cells, cancer cells, and mouse xenograft models. The role of procaspase‐3 in WF‐210‐induced apoptosis was explored by manipulating procaspase‐3 expression in cultured cells.

Results

WF‐210 activated procaspase‐3 with an EC50 of 0.95 μM, less than half that of its mother compound PAC‐1 (2.08 μM). The mechanism involved the chelation of inhibitory zinc ions, subsequently resulting in an auto‐activation of procaspase‐3. WF‐210 was more cytotoxic than PAC‐1 to human cancer cells, but less cytotoxic to normal cells. Cancer cells with high procaspase‐3 expression, like HL‐60 and U‐937, were particularly sensitive. WF‐210‐induced the apoptosis of HL‐60 and U‐937 cells by activating procaspases and promoting proteasome‐dependent degradation of XIAP and Survivin. The level of WF‐210‐induced apoptosis in cultured cells was related to the level of procaspase‐3 expression. Finally, WF‐210 was superior to PAC‐1 in retarding the in vivo growth of breast, liver and gallbladder xenograft tumors which overexpress procaspase‐3, and induced no substantial weight loss or neurotoxicity. WF‐210 and PAC‐1 had no effect on the growth of MCF‐7 xenograft tumors, which do not express procaspase‐3.

Conclusion

We identified WF‐210 as a potent small‐molecule activator of procaspase‐3. The favorable antitumor activity and acceptable toxicity profile of WF‐210 provide a strong rationale for its clinical evaluation in the treatment of tumors with high procaspase‐3 expression.

Keywords: Procaspase-3, Apoptosis, Small molecular activator, Tumor

Highlights

  • We discovered a novel procaspase‐3 activator WF‐210.

  • We demonstrated that WF‐210 has higher selection index.

  • We found that WF‐210 could induce tumor cell apoptosis through activate procaspase‐3.

  • WF‐210 or PAC‐1 induced apoptosis by promoting proteasome‐dependent degradation of IAPs.

  • WF‐210 showed greater therapeutic effect in vivo compared with PAC‐1.

1. Introduction

Many chemotherapeutic agents kill cancer cells by inducing apoptosis, and defects in apoptosis often result in the failure of chemotherapy (Johnstone et al., 2002). Moreover, dysregulation of apoptosis leads to cancer development and progression (Storey, 2008). Therefore, apoptosis pathways are attractive targets for the development of new anticancer drugs.

The caspase family of cysteine proteases plays key roles in both the initiation and execution of apoptosis (Green, 2000). The initiator caspases caspase‐8 and caspase‐9 mainly contribute to the activation of the death receptor apoptosis pathway and the mitochondrial apoptosis pathway, respectively. Both of these pathways converge on executioner caspases, including caspase‐3, 6, and 7. Among these, caspase‐3 is considered as the key molecule which exists in the cell as a low‐activity zymogen, procaspase‐3 (Green, 2000; Hengartner, 2000). Procaspase‐3 is activated by proteolysis to give caspase‐3 (Pop and Salvesen, 2009), which enters the nucleus and cleaves more than 300 substrates, including poly ADP‐ribose polymerase (PARP), mouse double minute‐2 (MDM2), and actin, subsequently inducing apoptosis (Crawford and Wells, 2011). Interestingly, numerous studies have demonstrated that procaspase‐3 is overexpressed in a variety of human tumors, including colon cancer (Putt et al., 2006), lung cancer (Krepela et al., 2004), melanoma (Fink et al., 2001), hepatoma (Persad et al., 2004), breast cancer (O'Donovan et al., 2003), lymphoma (Izban et al., 1999), and neuroblastoma (Nakagawara et al., 1997). Therefore, a small molecule that specifically enhances conversion of procaspase‐3 to caspase‐3 may selectively kill cancer cells without harming normal cells.

In 2006, Putt and collaborators reported that the small molecule PAC‐1 (Figure 1A) activated procaspase‐3 in vitro, induced apoptosis in cancer cells and had efficacy in multiple mouse xenograft models (Putt et al., 2006). However, Peterson and colleagues found that PAC‐1 is neurotoxic at high doses (Peterson et al., 2010). Taking PAC‐1 as a starting point, we retained the ortho‐hydroxy N‐acyl hydrazone zinc‐chelating motif and replaced the non‐substituted phenyl group with a phenyl‐substituted oxadiazolyl group to investigate the effect of extending the aromatic region (Peterson et al., 2009a). We also made modifications to the hydrazone phenyl group by introducing a series of heteroaromatic rings connected with flexible chains to the ortho‐hydroxyphenyl group, in order to investigate the activity changes brought about by space effects and electronic effects. As a result, a large library of PAC‐1 derivatives was prepared and screened for their procaspase‐3‐activating properties and death‐inducing efficiency in cancer cell lines (data not shown). Of them, WF‐210 (Figure 1A) stood out due to its dramatically increased ability to activate procaspase‐3 and its significant anti‐tumor effect in vitro.

Figure 1.

Figure 1

PAC‐1 and WF‐210 activate procaspase‐3 in vitro. (A) Structure of PAC‐1 and WF‐210. (B) In vitro activation of procaspase‐3 (measured using a chromogenic caspase‐3 substrate) by increasing concentrations of PAC‐1 and WF‐210 (0.08, 0.2, 1, 5, 10, 50, and 100 μM). (C) PAC‐1 (blue) and WF‐210 (red) activate procaspase‐3 by chelating inhibitory zinc ions. The graphs show activation of procaspase‐3 (measured using a chromogenic caspase‐3 substrate) by PAC‐1 and WF‐210 (0.08, 0.4, 2, 10, 50, and 100 μM) when assayed in a buffer with no zinc (black) and a buffer containing 5 μM ZnSO4. (D) Western blot showing cleavage of procaspase‐3 induced by PAC‐1 or WF‐210 in 5 μM ZnSO4. MW: molecular weight. PC3: procaspase‐3. AU/min: absorbance unit increase per minute. All error bars are S.E.M.

In this article, we describe the comprehensive investigation of the mechanisms that underlie the activity of WF‐210 in vitro and in vivo, including its anti‐tumor effect. Our study provides preliminary evidence that WF‐210 may have potential for treating tumors that express high level of procaspase‐3.

2. Materials and methods

2.1. Reagents

Human recombinant procaspase‐3 was purchased from Enzo. Etoposide, MG132, staurosporine, Fas ligand and the chromogenic caspase‐3 substrate Ac‐DEVD‐pNa were obtained from Sigma. Caspase inhibitors Z‐VAD‐FMK (pan‐caspase), Z‐DEVD‐FMK (caspase‐3), Z‐IEDT‐FMK (caspase‐8) and Z‐LEHD‐FMK (caspase‐9) were purchased from R&D Systems, Inc. Primary antibodies against PARP, caspase‐3, caspase‐8, caspase‐9, Bcl‐2, Bax, Survivin, XIAP, Bcl‐XL, cleaved caspase‐3, ubiquitin and β‐actin were obtained from Cell Signaling Technology. The caspase‐3 siRNA and scramble siRNA duplexes were purchased from Life Technologies. All cell culture supplies were from Invitrogen Gibco Co., RNeasy Mini Kits and Plasmid Midi Kits were obtained from Qiagen. RevertAid First Strand cDNA Synthesis Kits were purchased from Thermo. iQ SYBR Green Supermix was obtained from Bio‐Rad. Other reagents were purchased from Amresco.

2.2. Cell lines and cell culture

Human cancer cell lines A549, COLO205, DU145, NCI‐H226, Hep‐3B, Hep‐G2, K‐562, MCF‐7, U‐87, GBC‐SD, MDA‐MB‐435, PC‐3, U‐937, HL‐60, SH‐SY5Y and human immortalized cell lines MCF‐10A, L‐02, HUVEC were obtained from the American Type Culture Collection (Manassas, VA) or the National Center for Medical Culture Collection (Shanghai, CHN). They were routinely cultured in RPMI 1640, DMEM or DMEM/F12 supplemented with 10% fetal bovine serum (FBS) and maintained at 37 °C in a humidified incubator with 5% CO2. Human primary peripheral blood lymphocytes were isolated as described previously (Zhang et al., 2011). In brief, after diluting blood with PBS, lymphocytes were isolated by centrifugation over a density gradient of Histopaque‐1077 for 15 min at 280 g. Cells were washed twice with PBS then suspended in complete RPMI 1640 with 10% fetal bovine serum. The viability of the isolated lymphocytes was measured by trypan blue exclusion assay and found to be about 99%.

2.3. Synthesis of PAC‐1 and its derivative WF‐210

PAC‐1 was synthesized as described previously (Putt et al., 2006). Detailed procedures are described in Supplemental Methods 1. The synthesis of compound WF‐210 (N′‐(4‐((2‐(benzo[d][1,3]dioxol‐5‐ylmethyl)thiazol‐4‐yl)methoxy)‐2‐hydroxybenzylidene)‐2‐(4‐((3‐(4‐((4‐fluorophenoxy)methyl)phenyl)‐1,2,4‐oxadiazol‐5‐yl)methyl)piperazin‐1‐yl)acetohydrazide, purity ≥ 98%) is also described in the Supplemental Methods (Srivastav and Pandeya, 2011; Mishra et al., 2010). The structure of WF‐210 was confirmed by hydrogen‐1 nuclear magnetic resonance (1H‐NMR, see Supplementary Figure 1).

2.4. Cell viability assay

Cell viability was measured using the MTT method or the CellTiter‐Glo luminescent assay (Promega, Madison, WI). For the MTT assay, the cells (1 × 105 cells/ml) were seeded into 96‐well culture plates. After overnight incubation, cells were treated with various concentrations of agents (PAC‐1, WF‐210 or other agents) for 24 or 72 h. Then 10 μl MTT solution (2.5 mg/ml in PBS) was added to each well, and the plates were incubated for an additional 4 h at 37 °C. After centrifugation (2500 rpm, 10 min), the medium containing MTT was aspirated, and 100 μl DMSO was added. The optical density of each well was measured at 570 nm with a Biotek Synergy™ HT Reader. The CellTiter‐Glo kit was used to determine the relative levels of intracellular ATP as a biomarker for live cells. The assay was performed according to the manufacturer's instructions.

2.5. Caspase‐3 activation assay

Various concentrations of WF‐210 or PAC‐1 were added to procaspase‐3 in buffer containing 50 mM HEPES, 0.1% CHAPS, 10% glycerol, 100 mM NaCl, 0.1 mM EDTA, 10 mM DTT pH 7.4, and incubated for 12 h at 37 °C. The final volume was 10 μl and the final concentration of procaspase‐3 was 1 μM. Then 40 μl of the substrate Ac‐DEVD‐pNA (final concentration 0.4 μM) in buffer containing 50 mM HEPES pH 7.4, 100 mM NaCl, 10 mM DTT, 0.1 mM EDTA disodium salt, 0.10% CHAPS, 10% glycerol was added and the absorbance of the plate was read at 405 nm for a total of 1 h. The slope of the linear portion for each well was determined as the enzyme activity.

2.6. Assay for zinc inhibition of procaspase‐3 activation

Procaspase‐3 and different concentrations of PAC‐1 or WF‐210 were added to HEPES buffer (vehicle) (50 mM HEPES, 300 mM NaCl pH 7.4) and bivalent cations, including zinc, were removed using Chelex resin. The final procaspase‐3 concentration was 1 μM. After 12 h incubation at 37 °C, Ac‐DEVD‐pNA (final concentration 0.4 μM) in buffer containing 50 mM HEPES pH 7.4, 100 mM NaCl, 10 mM DTT, 0.1 mM EDTA disodium salt, 0.1% CHAPS, 10% glycerol was added and the absorbance of the plate was read at 405 nm for a total of 1 h. After varying times of incubation at 37 °C, SDS‐loading buffer was added and the samples were denatured at 95 °C for 5 min before western blotting to detect procaspase‐3 cleavage (Peterson et al., 2009b).

2.7. Flow cytometry analysis

HL‐60 and U‐937 cells were treated with different concentrations of agents (PAC‐1, WF‐210 or other agents). After 24 h, cells were harvested by centrifugation and washed twice in PBS. Apoptosis was measured by flow cytometry (BD FACSCalibur) in the FITC and DAPI channels after staining with fluorescein isothiocyanate (FITC)‐conjugated Annexin V (AV, 5:100, V:V) and propidium iodide (PI, 5 μg/ml) as described in the manual from the FITC Annexin V Apoptosis Detection Kit II (BD Biosciences).

2.8. High‐content analysis of caspase‐3 activation

HL‐60 and U‐937 cells were grown in 96‐well culture plates and cultured for 24 h. After treatment with different concentrations of PAC‐1 or WF‐210 for 0.5, 1, 3, 6, 12 and 24 h, cells were fixed in 4% paraformaldehyde for 15 min and washed in PBS. Cells were then blocked with 10% bovine serum albumin (BSA) for 1 h at room temperature and incubated at 4 °C overnight with anti‐cleaved caspase‐3 rabbit mAb (1:100) diluted in 0.1% BSA. After three PBS washes, a 1:200 dilution of FITC‐conjugated goat anti‐rabbit IgG was added as the secondary antibody for 1 h at room temperature. Nuclei were stained with Hoechst 33342. After washing with PBS, cells were imaged with ImageXpress 5000 (Molecular Devices, Sunnyvale, CA). Images were quantified and analyzed using MetaXpress software (Molecular Devices). Procaspase‐3 activation was expressed as the percentage of cells with positive FITC staining in the nucleus. Data shown is average values from triplicate samples.

2.9. Caspase activity assay

The activities of caspases were determined using Caspase‐3/‐8/‐9 activity kits (Beyotime Institute of Biotechnology, Haimen, China). To evaluate the activities of caspases, lysates of HL‐60 cells were prepared after treatment with various compounds. Assays were performed on 96‐well plates by incubating 10 μl of cell lysate protein per sample in 80 μl reaction buffer (1% NP‐40, 20 mM Tris‐HCl (pH 7.5), 137 mM NAD and 10% glycerol) containing 10 μl of caspase substrate. Lysates were incubated at 37 °C for 30 min. Samples were measured with Biotek Synergy™ HT Reader at an absorbance of 405 nm. The analysis procedure was performed as described in the manufacturer's protocol.

2.10. Transient transfection

Cells were transfected with siRNA (final concentration 100 nM) by Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. The control was Scramble siRNA (Invitrogen). Human procaspase‐3 cDNA was cloned into the pIRES2‐EGFP expression vector so that the procaspase‐3 and EGFP genes were separately expressed. The pIRES2‐EGFP and pIRES2‐EGFP‐procaspase‐3 constructs were transiently transfected into MCF‐7 cells. Transfection efficiency was verified by western blotting.

2.11. Western blot and immunoprecipitation assay

About 1 × 107 cells were gathered after pre‐treatment with PAC‐1, WF‐210 or other agents. Proteins from tumor tissue were purified as reported previously (Zheng et al., 2011). Protein samples from the same treatment group were pooled for detection. Western blotting was performed as previously described (Zhang et al., 2011). In brief, equal amounts of total protein extracts from cultured cells or tissues were fractionated by 10–15% SDS‐PAGE and electrically transferred onto polyvinylidene difluoride (PVDF) membranes. Mouse or rabbit primary antibodies and appropriate horseradish peroxidase (HRP)‐conjugated secondary antibodies were used to detect the designated proteins. Membrane‐bound secondary antibodies were detected with ECL reagents and exposed to X‐ray films. Results were normalized to the internal control, β‐actin.

For immunoprecipitation assays, HL‐60 cells were treatment with PAC‐1 or WF‐210 in the absence and presence MG132 (5 μM). Cells were lysed in lysis buffer (20 mM Tris, 1 μM EDTA, 15% glycerol, 150 μM NaCl, 1% Triton, 8 μM MgSO4, pH 7.5). After centrifugation (10,000× g for 10 min at 4 °C), cell extracts were immunoprecipitated with anti‐XIAP or anti‐Survivin antibody. The ubiquitination of XIAP or Survivin was detected by immunoblotting with ubiquitin antibody. The bands were visualized using film exposure with ECL substrate.

2.12. Quantitative PCR analysis

About 1 × 106 cells were gathered after pre‐treatment with PAC‐1 or WF‐210 as described previously. Total RNA was isolated using an RNeasy Mini Kit as described in the product insert. RNA (1 μg) was reverse transcribed with RevertAid First Strand cDNA Synthesis Kit. The cDNA was stored in aliquots at −80 °C before use. For quantitative PCR, analysis was carried out using iQ SYBR Green Supermix and a CFX96 Real‐Time PCR Detection System (Bio‐Rad) as instructed by the manufacturer. Primers used were GAPDH (reverse 5′‐CCCTCAACGACCACTTTGTCA‐3′, forward 5′‐TTGCCGACAGGATGCAGAA‐3′); XIAP (reverse 5′‐TTGCCGACAGGATGCAGAA‐3′, forward 5′‐GCCGATCCACACGGAGTACT‐3′); and Survivin (reverse 5′‐GGAAACTGCGGAGAAAGTG‐3′, forward 5′‐TAAACCCTGGAAGTGGTGC‐3′). PCR conditions were one cycle for 5 min at 95 °C followed by 35 cycles of 30 s at 95 °C, 25 s at 56 °C, and 20 s at 72 °C. The result was calculated as 2−ΔΔCt of real‐time fluorescence intensity.

2.13. DNA fragmentation assay and TUNEL technique

SH‐SY5Y cells were lysed and DNA was extracted and purified with the Apoptotic DNA Ladder Kit (Beyotime Institute of Biotechnology, China) according to the manufacturer's instructions. Equal amounts of purified apoptotic DNA were subjected to electrophoresis on a 1.5% agarose gel. After staining with 1 mg/ml of Goldview nucleic acid stain, DNA bands were visualized by UV light and photographed.

Cells in 96 well plates were prefixed in paraformaldehyde and incubated with proteinase K at 37 °C for 15 min. Apoptosis was detected using 50 μL TUNEL reaction mixture (Roche Applied Science, USA) for 60 min at 37 °C in the dark. Cells were imaged with an ImageXpress 5000 system (Molecular Devices, Sunnyvale, CA). TUNEL‐positive cells were quantified and analyzed using MetaXpress software (Molecular Devices).

2.14. In vivo antitumor efficacy studies

To determine the in vivo anti‐tumor activity of WF‐210, viable human gallbladder cancer GBC‐SD cells (5 × 106/100 μl PBS per mouse), human breast cancer MDA‐MB‐435 cells (1 × 107/100 μl PBS per mouse), human liver cancer Hep3B cells (5 × 106/100 μl PBS per mouse) and human breast cancer MCF‐7 cells (1 × 107/100 μl PBS per mouse) were subcutaneously (s.c.) injected into the right flank of 7‐ to 8‐week old male SCID mice or Balb/c nude mice. Cell numbers were confirmed by trypan blue staining prior to injection. Specially, MCF‐7 xenograft mice were also administered with the hormone 17‐beta‐estradiol (3 mg/kg) on alternate days. When the average s.c. tumor volume reached 100 mm3, mice were randomly divided into various treatment and control groups (eight mice per group). Tumor size was measured once every two days with a caliper (calculated volume = shortest diameter2 × longest diameter/2). Body weight, diet consumption and tumor size were recorded once every two days. After two or four weeks, mice were sacrificed and tumors were excised and stored at −80 °C until further analysis.

2.15. Immunohistochemistry

Tissues embedded in paraffin were cut into 4 μm sections, deparaffinized, and treated with citrate buffer. Slides were blocked with avidin/biotin for 20 min then incubated with anti‐caspase‐3 or PCNA or Tp53 or MMP‐2 overnight at 4 °C. Next, the slides were treated with horseradish peroxidase‐conjugated goat anti‐rabbit secondary antibody for 1–3 h and developed with 3, 3‐diaminobenzidine (Sigma‐Aldrich). Finally, the slides were counterstained with hematoxylin.

2.16. Comet assay

Comet assays were performed under alkaline conditions essentially according to previous reports with a slight modification (Guo et al., 2007). In brief, after solidification of the gel, the cover slip was removed, and SH‐SY5Y cells were mixed with low‐melting temperature agarose (Amresco Inc., Boston, USA). After solidification, the slide was submersed in lysing solution for 1 h, then placed in unwinding buffer for 30 min. Electrophoresis was carried out using the same unwinding buffer for 20 min at 0.92 V/cm. The slide was then submersed in 99% ethanol for 1 h, air dried and stained with ethidium bromide. Coded slides were viewed using a fluorescence microscope with a magnification of 200×. Fifty randomly selected cells (25 cells from each replicate slide were scored) per experimental point, and analyzed using LUCIA Comet Assay software (LUCIA DNA Analysis Systems family, Laboratory Imaging, Czech Republic). Results are reported as DNA tail moment, which is indicative of DNA damage, expressed as the mean of the 50 cells scored. Four independent experiments were performed in order to obtain the final results.

2.17. Balance beam test

A balance beam test was used to examine whether mice treated with PAC‐1 or WF‐210 for 14 days showed signs of ataxia. The balance beam apparatus consisted of a white board, 170 cm long by 2 cm wide, mounted on supports at both ends and elevated 70 cm above the floor. Experimentally naive mice were trained to traverse the beam at least 1 h prior to testing. Data are presented as the difference in the time to cross the balance beam before and after PAC‐1 or WF‐210 treatment (Hou et al., 2006).

2.18. Statistical analysis

Differences between experimental groups were evaluated by one‐way ANOVA and Tukey's post‐hoc test using the SPSS 11.5 software package for Windows (SPSS, Chicago, IL). Statistical significance was based on a P‐value of 0.05 (P < 0.05, two‐tailed test).

3. Results

3.1. WF‐210 activates procaspase‐3 through relief of zinc‐mediated inhibition

To detect the ability of WF‐210 to activate procaspase‐3, caspase‐3 activity was measured using an enzymatic assay with purified recombinant procaspase‐3. As shown in Supplementary Figure 2, neither PAC‐1 nor WF‐210 activated procaspase‐3 at 0.5 h. However, after incubation for 1 h, procaspase‐3 began to be activated. Maximum activity was detected at 2 h incubation, and this level was maintained at a steady state even after 12 h. The optimal conditions were incubation for 12 h at 37 °C with a final procaspase‐3 concentration of 1 μM. Under these conditions, WF‐210 activated procaspase‐3 with an EC50 value of 0.95 μM, which was lower than that of PAC‐1 (EC50 = 2.08 μM, see Figure 1B). These results demonstrate that WF‐210 displays an enhanced capability to activate procaspase‐3 compared to PAC‐1.

A previous study reported that zinc ions strongly inhibited procaspase‐3 activation, and PAC‐1 activated procaspase‐3 by sequestering zinc (Peterson et al., 2009b). Thus, we assessed the ability of WF‐210 and PAC‐1 to activate procaspase‐3 in the presence and absence of zinc. As shown in Figure 1C, procaspase‐3 enzymatic activity was strongly inhibited in the presence of zinc. However, with an increasing concentration of WF‐210, the enzymatic activity in zinc‐containing buffer reached 80% of the maximal rate (i.e., the rate in the absence of zinc). Compared to PAC‐1 (EC50 = 7.08 μM), WF‐210 exhibited an enhanced zinc chelating ability (EC50 = 2.88 μM). To confirm that WF‐210 enhances the auto‐activation of procaspase‐3 to caspase‐3 by chelating zinc, we performed western blotting to detect cleaved caspase‐3. The caspase‐3 p17 cleavage fragment was observed within 6 h in the absence of zinc, while zymogen processing was significantly inhibited in the presence of zinc (Figure 1D). Upon addition of PAC‐1 or WF‐210, a concentration‐dependent increase in the level of the processed fragment was observed (Figure 1D). These results suggest that WF‐210 activates procaspase‐3 through relief of zinc‐mediated inhibition.

3.2. WF‐210 induces cancer cell death in vitro

The MTT method was used to measure the ability of PAC‐1 or WF‐210 to induce death of human malignant cell lines (leukemia, lung cancer, hepatoma, gastric cancer, breast cancer, glioma, prostate cancer, colon cancer, gallbladder carcinoma), human peripheral blood lymphocytes (PBL), human umbilical vein endothelial cells (HUVEC), human immortalized liver cell lines (L‐02) and human immortalized mammary epithelial cell lines (MCF 10A) after 72 h of continuous treatment. As shown in Figure 2A and Supplementary Table 1, PAC‐1 induced leukemia cell death with an IC50 value of 4.03 μM, which is consistent with the values reported by other investigators (Putt et al., 2006). PAC‐1 treatment also resulted in death of other malignant cells in a concentration‐dependent manner with IC50 values ranging from 4.03 to 53.44 μM. Interestingly, MCF‐7 cells, which are deficient in procaspase‐3, were also killed by PAC‐1, which suggests that other mechanisms are also involved in PAC‐1‐induced cell death. Compared to PAC‐1, WF‐210 was a more potent inducer of cancer cell death, with IC50 values ranging from 0.08 to 2.8 μM. The overall mean IC50 value in the fifteen malignant cell lines was 0.88 μM for WF‐210 and 19.40 μM for PAC‐1 (Figure 2B). The malignant cell lines were highly sensitive to WF‐210, which was approximately 22‐fold more potent than PAC‐1. In contrast, the sensitivity of the normal human cells (PBL, L‐02, HUVEC and MCF 10A) to WF‐210 was 2.6‐fold lower (mean IC50 = 412.34 μM) than PAC‐1 (mean IC50 = 158.29 μM). To compare the cytotoxic effects of PAC‐1 and WF‐210 on malignant cells and normal cells, we calculated the selectivity index (SI) from the IC50 values for the two drugs and found that the SI of PAC‐1 (SI = 8.15) was much lower than that of WF‐210 (SI = 468.57, Figure 2B and Supplementary Table 1). Taken together, these data suggest that compared with PAC‐1, WF‐210 is more cytotoxic to human malignant cell lines but is less cytotoxic to normal human cells.

Figure 2.

Figure 2

Cytotoxicity study of PAC‐1 and WF‐210 in diverse cancerous cell lines and normal cells. (A) Survival curves, determined by MTT assay, of various cancerous cells (color) and normal cells (black) treated with increasing concentrations (0.08, 0.4, 2, 10, 50, and 100 μM) of PAC‐1 (left) and WF‐210 (right). (B) The mean IC50 values of PAC‐1 and WF‐210 in cancerous cell lines and normal cells. SI: the selectivity index. All error bars are S.E.M.

3.3. WF‐210 induces apoptosis in HL‐60 and U‐937 cells via a caspase‐dependent pathway

To determine whether the WF‐210‐induced death in malignant cells was associated with induction of apoptosis, we selected two cancer cell lines that overexpress procaspase‐3, HL‐60 and U‐937 (see Supplementary Figure 3), and assessed the number of apoptotic cells after treatment with PAC‐1 or WF‐210, as described above. Exposure of HL‐60 and U‐937 cells to WF‐210 for 24 h resulted in a significant concentration‐dependent increase in the number of cells staining positive for Annexin V, which recognizes phosphatidylserine on the surface of apoptotic cells (Figure 3A, B). Similar patterns were obtained with PAC‐1, but a higher concentration was required.

Figure 3.

Figure 3

PAC‐1‐ and WF‐210‐induced apoptosis in HL‐60 and U‐937 cells via activation of caspases. A and B, phosphatidylserine exposure (as measured by Annexin V staining and propidium iodide (PI) counterstaining) in HL‐60 (A) and U‐937 (B) cell lines after treatment for 24 h with 2, 10, and 50 μM PAC‐1 or WF‐210. C and D, the inhibitory effect of the pan‐caspase inhibitor Z‐VAD‐FMK, the caspase‐3 inhibitor Z‐DEVD‐FMK, the caspase‐8 inhibitor Z‐IETD‐FMK, and the caspase‐9 inhibitor Z‐LEHD‐FMK on phosphatidylserine exposure induced by PAC‐1 and WF‐210 in HL‐60 (C) and U‐937 (D) cell lines. (E) The cleavage of caspase family proteins and PARP in HL‐60 and U‐397 cells treated with PAC‐1 (50 μM) and WF‐210 (10 μM) for different times was measured by western blotting. β‐actin was used as a loading control. All error bars are S.E.M. * P < 0.05 compared with PAC‐1 or WF‐210 alone group.

To determine whether caspases are involved in WF‐210‐induced apoptosis, we measured the level of apoptotic cells in the presence or absence of the pan‐caspase inhibitor Z‐VAD‐FMK, the caspase‐3‐specific inhibitor Z‐DEVD‐FMK, the caspase‐8‐specific inhibitor Z‐IEDT‐FMK, and the caspase‐9‐specific inhibitor Z‐LEHD‐FMK. All four inhibitors decreased the level of PAC‐1‐ or WF‐210‐induced apoptosis (Figure 3C, D), but the decrease was much more dramatic with Z‐VAD‐FMK (pan‐caspase) or Z‐DEVD‐FMK (caspase‐3) than with Z‐IEDT‐FMK (caspase‐8) or Z‐LEHD‐FMK (caspase‐9). In order to validate the PAC‐1 and WF‐210‐induced caspase‐3 dependent apoptosis effect, staurosporine, a PKC inhibitor, and MG132, a proteasome degradation inhibitor, were used as positive controls. Our results indicate that staurosporine and MG132 could induce apoptosis in HL‐60 cells. However, unlike PAC‐1 and WF‐210, the pan‐caspase inhibitor only partially suppressed staurosporine‐ and MG132‐induced apoptosis. More importantly, co‐treatment with the specific caspase‐3 inhibitor did not result in obvious inhibition of apoptosis when compared with caspase‐8 and ‐9 inhibitors (see Supplementary Figure 4). Taken together, our observations suggest that PAC‐1‐ or WF‐210‐induced apoptosis in HL‐60 and U‐937 cells might be mainly caspase‐3‐dependent, although a contribution of caspase‐8 or ‐9 dependent pathways and caspase‐independent pathways cannot be excluded.

Intrachain cleavage is considered as the hallmark of caspase activation (Shi, 2004). Thus, in order to further confirm the roles of caspases in WF‐210‐induced cell apoptosis, we used western blotting to investigate the levels of procaspase and caspase‐cleaved fragments. When HL‐60 cells were treated with WF‐210 (10 μM) or PAC‐1 (50 μM), cleavage of caspase‐8 and caspase‐9 appeared after 2 h, but caspase‐3 and PARP, which is considered to be a biomarker of caspase‐dependent apoptosis, were cleaved after 1 h (Figure 3E). High‐content analysis confirmed that caspase‐3 was activated after 1 h of drug treatment (Supplementary Figure 5). Similar patterns were obtained when U‐937 cells were treated with PAC‐1 and WF‐210 (Figure 3E). Moreover, caspase activity assays, which are based on measuring specific substrates of caspases, were used to further confirm the activation time sequence of caspase‐3, ‐8 or ‐9. Etoposide, which induces apoptosis through the intrinsic pathway, was used as control. As shown in Supplementary Figure 6, when HL‐60 cells were treated with PAC‐1 or WF‐210, activation of caspase‐3 was detected first (1 h), followed by activation of caspase‐8 and caspase‐9 (4 h). However, when cells were incubated with etoposide, caspase‐3 and caspase‐9 were both activated at the same time (4 h), followed by caspase‐8 (6 h). This suggests that PAC‐1/WF‐210 and etoposide induce apoptosis through different mechanisms. Overall, these observations suggest that caspase‐3, ‐8 and ‐9 are all activated by treatment with PAC‐1 or WF‐210, but there is a clear time‐sequence with caspase‐3 activated first, then caspase‐8 and caspase‐9.

3.4. WF‐210‐induced apoptosis is mainly mediated by procaspase‐3 activation

Next, we used knockdown assays to further confirm whether procaspase‐3 activation is responsible for WF‐210‐induced apoptosis. When HL‐60 cells were transiently transfected with procaspase‐3 siRNA, the silencing efficiency was found to be more than 60% by western blotting (Figure 4A). Knockdown of procaspase‐3 expression resulted in a significant reduction of WF‐210‐induced cytotoxicity, activation of caspase‐3, and cleavage of PARP (Figure 4B, C). Similar results were observed in PAC‐1‐treated HL‐60 cells (Figure 4B, C). Furthermore, we restored caspase‐3 expression to caspase‐3‐deficient MCF‐7 cells through transient transfection of the pIRES2‐EGFP‐procaspase‐3 plasmid (Figure 4D). Restoration of procaspase‐3 in MCF‐7 cells contributed to an obvious increase in WF‐210‐ or PAC‐1‐induced cytotoxicity, accompanied by elevated caspase‐3 activation and PARP cleavage (Figure 4E, F). In addition, we also tested the effects of traditional apoptosis inducers, including staurosporine, etoposide, FAS ligand and MG132, on cell viability and cleavage of procaspase‐3 and PARP in procaspase‐3 silenced and restored cells. Our data showed that, in contrast to PAC‐1 and WF‐210, neither knockdown nor restoration of procaspase‐3 had an obvious effect on the cytotoxicity and apoptosis‐related proteolysis caused by these traditional apoptosis inducers (see Supplementary Figures 7, 8). These results suggest a key role of procaspase‐3 in PAC‐1 and WF‐210‐induced apoptosis.

Figure 4.

Figure 4

Procaspase‐3 activation is required for PAC‐1‐ and WF‐210‐induced apoptosis. (A) Western blot showing the silencing efficiency of procaspase‐3 siRNA (Cas3) transfected into HL‐60 cells. The control (Sham) is scramble siRNA. (B) The effects of procaspase‐3 knockdown on PAC‐1‐ and WF‐210‐induced cytotoxicity. HL‐60 cells were treated for 24 h with 0.08, 0.4, 2, 10, 50, and 100 μM of each compound. (C) The effects of procaspase‐3 knockdown on PAC‐1 and WF‐210‐induced cleavage of procaspase‐3 and PARP. HL‐60 cells were treated for 24 h with 2, 10, and 50 μM of each compound. (D) Transfection of procaspase‐3‐deficient MCF‐7 cells with a procaspase‐3 plasmid (Procas3) restored procaspase‐3 expression in MCF‐7 cells. Empty vector was used as the control (Ctrl). (E) The effects of procaspase‐3 overexpression on the cytotoxic effect induced by PAC‐1 and WF‐210. Transfected MCF‐7 cells were treated for 24 h with 0.08, 0.4, 2, 10, 50, and 100 μM of each compound. (F) Western blot analyses of cleavage of procaspase‐3 and PARP induced by PAC‐1 and WF‐210. Transfected MCF‐7 cells were treated for 24 h with 2, 10, and 50 μM of each compound.

3.5. WF‐210 downregulates expression of IAPs through the proteasome pathway

It has been demonstrated that the expression levels of proapoptotic and antipoptotic proteins are important for the survival of malignant cells and their resistance to chemotherapeutic drugs (Johnstone et al., 2002). We therefore assessed the change in expression of Bcl‐2 family members after exposure of malignant cells to WF‐210 or PAC‐1. As shown in Supplementary Figure 9, the levels of the antiapoptotic proteins Bcl‐2 and Bcl‐XL were not altered significantly in HL‐60 and U‐937 cells after treatment with WF‐210 or PAC‐1 for 24 h. Similarly, expression of the proapoptotic proteins Bax and Bid was unchanged following 24 h of drug treatment. These data suggest that Bcl‐2 family members are unlikely to play a significant role in PAC‐1‐ or WF‐210‐induced apoptosis of malignant tumor cells.

The Inhibitors of Apoptosis (IAP) family of proteins also play critical roles in the regulation of apoptosis (Schimmer, 2004). We examined the expression of two IAP family proteins, Survivin and XIAP (cross‐linked inhibitor of apoptosis), by western blotting in malignant tumor cells exposed to WF‐210 or PAC‐1 for 24 h. As the concentrations of WF‐210 or PAC‐1 increased, the levels of Survivin and XIAP decreased (Supplementary Figure 10A). This indicates that IAP family members are involved in WF‐210‐ or PAC‐1‐induced apoptosis. It was previously reported that some IAP members, for example XIAP (Zou et al., 2003), are also substrates of caspase‐3. Therefore, to explore the mechanism by which Survivin and XIAP are downregulated, we tested whether siRNA‐silencing of procaspase‐3 could block the WF‐210‐ and PAC‐1‐induced decrease in Survivin and XIAP levels. Our data showed that silencing of procaspase‐3 did not prevent the reduction in Survivin and XIAP levels induced by PAC‐1 and WF‐210 (Supplementary Figure 10B). This result was further confirmed using the caspase‐3 inhibitor Z‐DEVD‐FMK and the pan‐caspase inhibitor Z‐VAD‐FMK (Supplementary Figure 10C). Thus, the downregulation of Survivin and XIAP by PAC‐1 and WF‐210 is independent of caspase activation. Next, we examined the effects of WF‐210 and PAC‐1 on mRNA expression of Survivin and XIAP in HL‐60 cells. As shown in Supplementary Figure 10D, no reduction of Survivin and XIAP mRNA levels was found after treatment with either compound. Considering that proteasome‐dependent degradation is the primary pathway by which Survivin and XIAP are downregulated, we next tested whether PAC‐1 or WF‐210 promoted ubiquitin‐proteasomal degradation of XIAP and Survivin. As shown in Supplementary Figure 10E, co‐treatment with MG132 inhibited PAC‐1‐ or WF‐210‐mediated downregulation of XIAP and Survivin. More importantly, we confirmed that the downregulation of XIAP and Survivin is mediated by ubiquitination. To further explore the mechanism underlying the downregulation of XIAP and Survivin, we investigated the effect of zinc on the expression of these proteins. Our data showed that the addition of zinc reversed the decrease in XIAP and Survivin protein levels induced by PAC‐1 or WF‐210 (Supplementary Figure 10F). These results support the hypothesis that PAC‐1 and WF‐210 might decrease XIAP and Survivin by chelating zinc and subsequently activating the ubiquitin‐proteasomal pathway.

3.6. Treatment with WF‐210 activates procaspase‐3, reduces IAPs, and inhibits tumor growth in breast, liver, and gallbladder xenograft tumor models

To evaluate the in vivo effect of WF‐210 on the growth of malignant tumors, we examined the ability of WF‐210 to suppress tumor growth in mouse Hep3B and MDA‐MB‐435 xenograft models. These two cell lines express procaspase‐3 at relatively high levels (Supplementary Figure 2). Tumors induced by xenografts of the liver cancer cell Hep3B were allowed to develop and grow to a size of 100 mm3, after which WF‐210 (2.5 mg/kg) or PAC‐1 (5.0 mg/kg) was given daily for two weeks by intravenous (i.v.) administration. As shown in Figure 5A, both PAC‐1 and WF‐210 significantly inhibited the growth of Hep3B tumor xenografts. Consistent with the in vitro findings, WF‐210 showed greater therapeutic effect in vivo compared with PAC‐1. Similarly, in the MDA‐MB‐435 xenograft model, WF‐210 inhibited tumor growth more strongly than PAC‐1. However, neither PAC‐1 nor WF‐210 showed an anti‐tumor effect in MCF‐7 (procaspase‐3‐deficient) xenograft mice, demonstrating a procaspase‐3‐dependent anti‐tumor effect of these compounds. To comprehensively study the effects of WF‐210, we also assessed the in vivo antitumor activities of WF‐210 given by intragastric (i.g.) administration in mouse GBC‐SD and MDA‐MB‐435 xenograft models. The results showed that WF‐210 significantly inhibited tumor growth (Figure 5A). Moreover, based on observations of body weight, WF‐210 did not cause any observable toxic effects (Supplementary Figure 11A).

Figure 5.

Figure 5

Anti‐tumor efficiency and toxicity profiles of WF‐210 in vitro and in vivo. (A) Relative tumor volumes in Hep‐3B, MDA‐MB‐435, GBC‐SD and MCF‐7 xenograft mice treated with WF‐210 or PAC‐1. (B) Western blot analyses of apoptosis‐related proteins in Hep‐3B, MDA‐MB‐435 and MCF‐7 xenografts from mice treated with WF‐210 (2.5 mg/kg, i.v.) or PAC‐1 (5 mg/kg, i.v.). Tumor tissues from each mouse in the same group were pooled and total protein was extracted. β‐actin was used as a loading control. (C) Comet assay of DNA damage in SH‐SY5Y cells treated with PAC‐1 or WF‐210 for 24 h. The average tail moment of DNA damage is shown. Two‐hundred cells were examined in duplicate for each treatment, and the percentage of tail moment is expressed as the mean ± S.E.M. (D) Neurotoxicity of PAC‐1 and WF‐210 in Swiss mice. The balance beam test was carried out after 15 days of drug administration. All error bars are S.E.M. * P < 0.05 compared with control group.

To determine whether the changes in expression of apoptosis‐related proteins induced by WF‐210 in vitro also occurred in vivo, we examined protein levels in Hep‐3B, MDA‐MB‐435 and MCF‐7 xenograft tissue samples from animals treated with WF‐210 (i.v.). We found that activated caspase‐3 and cleaved PARP were increased in tumor tissues from compound‐treated Hep‐3B and MDA‐MB‐435 xenograft mice, but not from compound‐treated MCF‐7 xenograft mice. Consistent with the therapeutic effects in vivo, WF‐210 exhibited an enhanced ability to induce the cleavage of procaspase‐3 and PARP when compared to PAC‐1. Meanwhile, Survivin and XIAP were decreased in tumor tissues from compound‐treated Hep‐3B and MDA‐MB‐435 xenograft animals (Figure 5B). Taken together, these results suggest that the in vivo anti‐tumor effect of WF‐210 is related to its capacity to activate procaspase‐3, downregulate IAPs, and subsequently induce apoptosis. In addition, immunohistochemical staining indicated that compared with vehicle control, WF‐210 treatment (i.g.) resulted in obvious activation of procaspase‐3 (enhanced nuclear expression), but had no effect on the expression of p53 (a cell cycle biomarker), PCNA (a cell proliferation biomarker), and MMP‐2 (a biomarker of tumor invasion and metastasis) (Supplementary Figure 11B). Collectively, these results demonstrate that WF‐210 effectively inhibits the growth of breast, liver and gallbladder xenograft tumors in mice by activating procaspase‐3 and reducing IAPs.

3.7. WF‐210 is less neurotoxic than PAC‐1 in vitro and in vivo

The clinical application of PAC‐1 is limited due to its neurotoxicity, so we evaluated the effect of WF‐210 on SH‐SY5Y cells, which are often used as an in vitro model of neuronal function. WF‐210 was much less cytotoxic (IC50: 31.2 μM for WF‐210 vs. IC50: 3.1 μM for PAC‐1), and resulted in a lower level of apoptosis in SH‐SY5Y cells (Supplementary Figure 12), In addition, the comet assay showed that a high concentration of PAC‐1 (50 μM) induced DNA damage in SH‐SY5Y cells, but 50 μM WF‐210 had no obvious effect (Figure 5C). We also used a balance beam test to assess whether PAC‐1 and WF‐210 caused ataxia in Swiss mice. Animals treated with PAC‐1 at doses of 2.5 mg/kg and 10 mg/kg took significantly more time to cross the balance beam compared with the vehicle‐treated group. However, WF‐210 treatment (2.5 mg/kg to 10 mg/kg) only resulted in a moderate increase in crossing time (no significant difference to the vehicle‐treated controls, see Figure 5D). Furthermore, WF‐210 had no effect on locomotor activity (data not shown). These results suggest that WF‐210 is less neurotoxic than PAC‐1.

4. Discussion

PAC‐1, the first synthetic activator of procaspase‐3, was reported as a potent anticancer compound when it was discovered in 2006 (Putt et al., 2006). However, the effectiveness of PAC‐1 may be limited by its weak anti‐tumor activity and its toxicity (Peterson et al., 2010). These considerations led to intensive efforts to develop novel procaspase‐3 activators. In this article, we provide biochemical, cellular, and in vivo evidence that WF‐210 is a potent activator of procaspase‐3 and is mechanistically and functionally superior to PAC‐1.

Like PAC‐1, the cytotoxicity of WF‐210 is associated with its ability to induce apoptosis. Both compounds induced apoptosis with similar kinetics, which suggests that WF‐210 and PAC‐1 share a similar mechanism of action. However, further studies were necessary to confirm whether WF‐210 shares a common molecular target with PAC‐1. Therefore, we performed western blot assays to detect the effects of PAC‐1 and WF‐210 on the expression of caspase‐3 and its substrate PARP. Our data indicated that in U‐937 and HL‐60 cells treated with PAC‐1 and WF‐210 for 1 h, activation of procaspase‐3 was accompanied by cleavage of PARP. The flow cytometry data showed that the apoptosis induced by PAC‐1 or WF‐210 in U‐937 and HL‐60 cells was obviously decreased in the presence of a specific caspase‐3 inhibitor. In addition, we found that silencing procaspase‐3 markedly inhibited WF‐210‐induced apoptosis in HL‐60 cells, whereas expressing procaspase‐3 in caspase‐3‐deficient MCF‐7 cells enhanced the apoptotic effect of WF‐210. Importantly, we found that WF‐210 activated procaspase‐3 in tumor tissues of several xenograft mouse models. Taken together, these data suggest that WF‐210 induces apoptosis by activating procaspase‐3.

Although caspase‐3 is best known as an executioner caspase, accumulating evidence now suggests an “apical” function of caspase‐3. Our finding that procaspase‐8 and procaspase‐9 are activated after procaspase‐3 indicates that caspase‐3 acts as an upstream factor in a mini‐cascade of these three caspases during PAC‐1‐ or WF‐210‐induced apoptosis. In fact, several reports have demonstrated that caspase‐3 mediates feedback activation of caspase‐8 and ‐9. Previous in vitro studies have shown that activated caspase‐3 not only directly cleaves procaspase‐9, but also enhances autocleavage of procaspase‐9 (Zou et al., 2003; Hell et al., 2003). Additionally, Yang and colleagues found that caspase‐8 cleavage/activation is enhanced by activated caspase‐3 in TNF‐α‐ and doxorubicin‐induced apoptosis (Yang et al., 2006). Collectively, these data demonstrate that, besides acting as an “executioner”, caspase‐3 can also act as an “initiator”, mediating feedback cleavage/activation of the apical caspases ‐8 and ‐9. This feedback activation amplifies the apoptosis signal and further precipitates apoptosis.

The Inhibitors of Apoptosis (IAP) are a family of functionally‐ and structurally‐related proteins, which serve as endogenous inhibitors of apoptosis (Gyrd‐Hansen and Meier, 2010; Schimmer, 2004). The best characterized IAPs are XIAP and Survivin, which inhibit caspase activation, thereby negatively regulating apoptosis (Kashkar, 2010; Altieri, 2010). Our results showed that PAC‐1 and WF‐210 can decrease the expression levels of XIAP and Survivin by the proteasome degradation pathway in vitro and in vivo. Thus, PAC‐1 and WF‐210 may induce apoptosis by downregulating IAPs as well as by activating procaspase‐3. All IAPs contain 1‐3 BIR motifs, which can fold into functionally independent structures that bind zinc (Liston et al., 2003). Many IAPs, including XIAP, contain RING finger Zn‐binding domains which have E3 ligase activity (Schimmer and Dalili, 2005, 2009). In previous reports, Zn‐chelators were found to result in varying degrees of XIAP depletion and induction of apoptosis in PC‐3 and MDA‐MB‐231 cells (Zuo et al., 2012; Makhov et al., 2008). In addition, zinc addition caused the upregulation of Survivin in prostate cells (Yun et al., 2010). Therefore, we tested whether zinc was involved in the PAC‐1‐ and WF‐210‐induced downregulation of XIAP and Survivin. Our results indicate that zinc treatment could indeed block the decrease of XIAP and Survivin induced by PAC‐1 and WF‐210, suggesting that the PAC‐1‐ and WF‐210‐induced decrease in XIAP is mediated by chelating zinc and subsequently promoting proteasome degradation.

Many anti‐cancer drugs are known to cause significant neurotoxicity, which can result in the early cessation of treatment (James et al., 2008). Previous studies reported that PAC‐1 kills cerebellar granule neurons in vitro and causes neurotoxicity in vivo (Peterson et al., 2010; Aziz et al., 2010). Here we found that, compared with PAC‐1, WF‐210 displayed relatively weak cytotoxicity and DNA damage effects in neuron cell lines, and more importantly exhibited a tolerable neurotoxicity in experimental mice. These differences could be explained by the following facts: Firstly, WF‐210 possesses clear tumor cell selectivity with a SI of 468.57, compared to 8.15 for PAC‐1. Secondly, WF‐210 has a relatively high molecular weight of 791.85, compared to 392.45 for PAC‐1. It is possible that WF‐210 does not cross the blood–brain barrier as easily as PAC‐1. Overall, our toxicity results suggest that WF‐210 is suitable for clinical evaluation.

In conclusion, WF‐210, a novel procaspase‐3 activator, was found to induce cell death in cultured human cancer cell lines with IC50 values in the submicromolar to nanomolar range, but showed little cytotoxicity towards normal cells. Furthermore, WF‐210 effectively induced apoptosis of the human leukemia cell lines HL‐60 and U‐937 by activating procaspase‐3 and down‐regulating the expression levels of XIAP and Survivin. Finally, WF‐210 showed superior in vivo efficacy and safety characteristics compared with PAC‐1. Considering the critical roles of caspase‐3 in apoptosis pathways and the potent effect of WF‐210 on procaspase‐3 activation, WF‐210 represents an ideal compound for clinical trials.

Conflict of interest

There are no conflicts of interest in this study.

Supporting information

The following are the supplementary data related to this article:

Supplementary data

Supplementary data

Supplementary data

Supplementary Figure 2 The effects of time, temperature and procaspase‐3 concentration on procaspase‐3 activation by PAC‐1 and WF‐210. (A) The effects of PAC‐1 and WF‐210 on the activation of procaspase‐3 after 0.5 h, 1 h, 2 h, and 12 h. (B) The effects of PAC‐1 and WF‐210 on the activation of 1.0 μM procaspase‐3 at 25 °C, 37 °C and 42 °C and of 0.15 μM procaspase‐3 at 37 °C. (C) Comparison of procaspase‐3 activity at different times, temperatures, and procaspase‐3 concentrations.

Supplementary Figure 3 Expression level of procaspase‐3 in human malignant and normal immortalized cell lines. Western blot analysis of procaspase‐3 levels in different cell lines. β‐actin was used as a loading control. MDA‐MB‐435 (435), COLO205 (COLO).

Supplementary Figure 4 Staurosporine and MG132‐induced apoptosis in HL‐60 cells co‐treated with different caspase inhibitors. Phosphatidylserine exposure was measured by Annexin V staining and propidium iodide (PI) counterstaining in HL‐60 cells after treatment for 24 h with 10 μM Staurosporine or 50 μM MG132 in the presence of 50 μM pan‐caspase inhibitor Z‐VAD‐FMK, the caspase‐3 inhibitor Z‐DEVD‐FMK, the caspase‐8 inhibitor Z‐IETD‐FMK, or the caspase‐9 inhibitor Z‐LEHD‐FMK.

Supplementary Figure 5 WF‐210 and PAC‐1 activate procaspase‐3 to caspase‐3. (A) WF‐210 and PAC‐1 induce cleavage of procaspase‐3 to give active caspase‐3 in HL‐60 and U‐937 cells, as detected with an antibody against cleaved caspase‐3 (green). Nuclei are labeled with Hoechst 3342 (blue). Arrows indicate caspase‐3‐positive cells (nuclei with both Hoechst and FITC staining). (B) The procaspase‐3 activation rate (FITC‐positive cells/total cells) in HL‐60 and U‐937 cells treated with increasing concentrations of WF‐210 and PAC‐1 for different times.

Supplementary Figure 6 Caspase‐3, caspase‐8 and caspase‐9 activity in HL‐60 cells. The activities of caspase‐3, caspase‐8 and caspase‐9 were measured in HL‐60 cells after treatment with PAC‐1 (50 μM), WF‐210 (10 μM) and etoposide (20 μM) for 0.5, 1, 2, 4, 6, 12 and 24 h.

Supplementary Figure 7 The effects of procaspase‐3 knockdown on cytoxicity, procaspase‐3 cleavage and PARP cleavage induced by staurosporine (A), FAS ligand (B), etoposide (C) and MG‐132 (D). CellTiter‐Glo kit was used to detect the cytotoxicity of compounds in HL‐60 cells that were treated for 72 h with 0.08, 0.4, 2, 10, 50, and 100 μM (or ng/ml) of each compound. Western blotting was used to measure the compound‐induced cleavage of procaspase‐3 and PARP in HL‐60 cells that were treated for 24 h with 2, 10, and 50 μM (or ng/ml) of each compound. The control (Sham) is scramble siRNA.

Supplementary Figure 8 The effects of procaspase‐3 overexpression on cytoxicity, procaspase‐3 cleavage and PARP cleavage induced by staurosporine (A), FAS ligand (B), etoposide (C) and MG‐132 (D). CellTiter‐Glo kit was used to detect the cytotoxicity of compounds in MCF‐7 cells that were treated for 72 h with 0.08, 0.4, 2, 10, 50, and 100 μM (or ng/ml) of each compound. Western blotting was used to measure the compound‐induced cleavage of procaspase‐3 and PARP in MCF‐7 cells that were treated for 24 h with 2, 10, and 50 μM (or ng/ml) of each compound.

Supplementary Figure 9 PAC‐1 and WF‐210 have no effect on the expression of Bcl‐2 family proteins. Western blot analyses of Bcl‐2 family proteins, including Bcl‐2, Bax, Bcl‐xl, and Bid, in HL‐60 and U‐937 cells treated for 24 h with PAC‐1 and WF‐210 at 2, 10, and 50 μM. β‐actin expression was used as a loading control.

Supplementary Figure 10 WF‐210 downregulates IAP family proteins through the ubiquitination–proteasome pathway. (A) Western blot analyses of the IAP proteins Survivin and XIAP in HL‐60 and U‐937 cells treated with 2, 10, and 50 μM of PAC‐1 and WF‐210 for 24 h. β‐actin was used as a loading control. (B) Western blot showing the effects of procaspase‐3 knockdown on Survivin and XIAP levels in HL‐60 cells treated with PAC‐1 and WF‐210 at 2, 10, and 50 μM for 24 h. β‐actin was used as a loading control. (C) Western blot analyses of Survivin and XIAP in HL‐60 cells treated with 10 μM WF‐210 or 50 μM PAC‐1 in the presence of 50 μM Ac‐DEVD‐FMK (caspase‐3 inhibitor) and Ac‐VAD‐FMK (pan‐caspase inhibitor). (D) Real‐time PCR analysis of Survivin and XIAP mRNA levels in HL‐60 cells treated with 2, 10, and 50 μM WF‐210 or PAC‐1 for 24 h. (E) The ubiquitination of XIAP and Survivin in cells treated with PAC‐1 or WF‐201 in the presence or absence of MG132 (5 μM) was determined by immunoprecipitation of XIAP or Survivin and immunobloting with ubiquitin antibody. (F) Western blot analyses of Survivin and XIAP in HL‐60 cells treated with 10 μM WF‐210 or 50 μM PAC‐1 in the presence of 5 or 10 μM ZnSO4.

Supplementary Figure 11 The effects of PAC‐1 and WF‐210 on body weight and levels of tumor‐related proteins in vivo. (A) Body weights of Hep‐3B, MDA‐MB‐435, GBC‐SD and MCF‐7 xenograft mice treated with WF‐210 or PAC‐1. (B) Immunohistochemical analysis of tumor‐related proteins (p53, caspase‐3, PCNA, MMP‐2) in GBC‐SD and MDA‐MB‐435 xenograft mice treated with WF‐210 (100 mg/kg, i.g.).

Supplementary Figure 12 The cytotoxic effects of PAC‐1 and WF‐210 on SH‐SY5Y cells. (A) Viability of SH‐SY5Y cells was measured with the MTT assay after 72 h of incubation with 0.08, 0.4, 2, 10, 30, 50, and 100 μM PAC‐1 or WF‐210. (B) DNA ladder assay to detect apoptotic fragmentation of DNA in SH‐SY5Y cells after treatment with PAC‐1 or WF‐210 for 24 h. (C) Images of TUNEL staining of SH‐SY5Y cells after treatment with PAC‐1 or WF‐210 for 24 h. (D) Quantitation of TUNEL staining of SH‐SY5Y cells after treatment with PAC‐1 or WF‐210 for 24 h. The analysis was performed using a high content assay system.

Supplementary Figure 1 The structure of WF‐210 confirmed by 1H‐NMR.

Acknowledgments

We are grateful to Dr. Yongshan Zhao and Dr. Jian Wang (Shenyang Pharmaceutical University, PR China) for their help in the target research. The authors gratefully acknowledge financial support from the National High Technology Research and Development Program of China (863 Program) (No. 2012AA020305), National Natural Science Foundation of China (No. 81102470), National Key Scientific Project for New Drug Discovery and Development of China (No. 2010ZX09401), Liaoning Science and Technology Program (No. 2011412004‐3; No.2013020225) and Shenyang Science and Technology Development Funds (No. F11‐151‐9‐00).

Appendix A. Supplementary data 1.

1.1.

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.molonc.2014.06.015.

Wang Fangyang, Wang Lihui, Zhao Yanfang, Li Yi, Ping Guanfang, Xiao Shu, Chen Kang, Zhu Wufu, Gong Ping, Yang Jingyu, Wu Chunfu, (2014), A novel small‐molecule activator of procaspase‐3 induces apoptosis in cancer cells and reduces tumor growth in human breast, liver and gallbladder cancer xenografts, Molecular Oncology, 8, doi: 10.1016/j.molonc.2014.06.015.

Contributor Information

Ping Gong, Email: gongpinggp@126.com.

Jingyu Yang, Email: yangjingyu2006@gmail.com.

Chunfu Wu, Email: wucf@syphu.edu.cn, Email: chunfuw@gmail.com.

References

  1. Altieri, D.C. , 2010. Survivin and IAP proteins in cell-death mechanisms. Biochem. J. 430, 199–205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aziz, G. , Akselsen, Ø.W. , Hansen, T.V. , Paulsen, R.E. , 2010. Procaspase-activating compound 1 induces a caspase-3-dependent cell death in cerebellar granule neurons. Toxicol. Appl. Pharmacol. 247, 238–242. [DOI] [PubMed] [Google Scholar]
  3. Crawford, E.D. , Wells, J.A. , 2011. Caspase substrates and cellular remodeling. Annu. Rev. Biochem. 80, 1055–1087. [DOI] [PubMed] [Google Scholar]
  4. Fink, D. , Schlagbauer-Wadl, H. , Selzer, E. , Lucas, T. , Wolff, K. , Pehamberger, H. , 2001. Elevated procaspase levels in human melanoma. Melanoma Res. 11, 385–393. [DOI] [PubMed] [Google Scholar]
  5. Green, D.R. , 2000. Apoptotic pathways: paper wraps stone blunts scissors. Cell 102, 1–4. [DOI] [PubMed] [Google Scholar]
  6. Guo, L. , Wang, L.H. , Sun, B.S. , Zhao, Y.Q. , Dong, Y.X. , Wu, C.F. , 2007. Direct in vivo evidence of protective effects of grape seed procyanidin fractions and other antioxidants against ethanol-induced oxidative DNA damage in mouse brain cells. J Agric. Food Chem. 55, 5881–5891. [DOI] [PubMed] [Google Scholar]
  7. Gyrd-Hansen, M. , Meier, P. , 2010. IAPs: from caspase inhibitors to modulators of NF-kappaB, inflammation and cancer. Nat. Rev. Cancer 10, 561–574. [DOI] [PubMed] [Google Scholar]
  8. Hell, K. , Saleh, M. , Crescenzo, G.D. , O'Connor-McCourt, M.D. , Nicholson, D.W. , 2003. Substrate cleavage by caspases generates protein fragments with Smac/Diablo-like activities. Cell Death Differ. 10, 1234–1239. [DOI] [PubMed] [Google Scholar]
  9. Hengartner, M.O. , 2000. The biochemistry of apoptosis. Nature 407, 770–776. [DOI] [PubMed] [Google Scholar]
  10. Hou, Y. , Wu, C.F. , Yang, J.Y. , Guo, T. , 2006. Differential effects of haloperidol, clozapine and olanzapine on learning and memory functions in mice. Prog. Neuropsychopharmacol. Biol. Psychiatry 30, 1486–1495. [DOI] [PubMed] [Google Scholar]
  11. Izban, K.F. , Wrone-Smith, T. , His, E.D. , Schnitzer, B. , Quevedo, M.E. , Alkan, S. , 1999. Characterization of the interleukin-1beta-converting enzyme/ced-3-family protease, caspase-3/CPP32, in Hodgkin's disease: lack of caspase-3 expression in nodular lymphocyte predominance Hodgkin's disease. Am. J. Pathol. 154, 1439–1447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. James, S.E. , Burden, H. , Burgess, R. , Xie, Y. , Yang, T. , Massa, S.M. , 2008. Anti-cancer drug induced neurotoxicity and identification of Rho pathway signaling modulators as potential neuroprotectants. Neurotoxicology 29, (4) 605–612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Johnstone, R.W. , Ruefli, A.A. , Lowe, S.W. , 2002. Apoptosis: a link between cancer genetics and chemotherapy. Cell 108, 153–164. [DOI] [PubMed] [Google Scholar]
  14. Kashkar, H. , 2010. X-linked inhibitor of apoptosis: a chemoresistance factor or a hollow promise. Clin. Cancer Res. 16, 4496–4502. [DOI] [PubMed] [Google Scholar]
  15. Krepela, E. , Prochazka, J. , Liul, X. , Fiala, P. , Kinkor, Z. , 2004. Increased expression of Apaf-1 and procaspase-3 and the functionality of intrinsic apoptosis apparatus in non-small cell lung carcinoma. Biol. Chem. 385, 153–168. [DOI] [PubMed] [Google Scholar]
  16. Liston, P. , Fong, W.G. , Korneluk, R.G. , 2003. The inhibitors of apoptosis: there is more to life than Bcl2. Oncogene 22, 8568–8580. [DOI] [PubMed] [Google Scholar]
  17. Mishra, M.K. , Gupta, A.K. , Negi, S. , Bhatt, Meenakshi , 2010. Synthesis of some new oxadiazole with antimicrobial activity. Int. J. Pharm. Sci. Res. 1, 172–177. [Google Scholar]
  18. Makhov, P. , Golovine, K. , Uzzo, R.G. , Rothman, J. , Crispen, P.L. , Shaw, T. , Scoll, B.J. , Kolenko, V.M. , 2008. Zinc chelation induces rapid depletion of the X-linked inhibitor of apoptosis and sensitizes prostate cancer cells to TRAIL-mediated apoptosis. Cell Death Differ. 15, (11) 1745–1751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Nakagawara, A. , Nakamura, Y. , Ikeda, H. , Hiwasa, T. , Kuida, K. , Su, M.S. , 1997. High levels of expression and nuclear localization of interleukin-1 beta converting enzyme (ICE) and CPP32 in favorable human neuroblastomas. Cancer Res. 57, 4578–4584. [PubMed] [Google Scholar]
  20. O'Donovan, N. , Crown, J. , Stunell, H. , Hill, A.D. , McDermott, E. , O'Higgins, N. , 2003. Caspase 3 in breast cancer. Clin. Cancer Res. 9, 738–742. [PubMed] [Google Scholar]
  21. Persad, R. , Liu, C. , Wu, T.T. , Houlihan, P.S. , Hamilton, S.R. , Diehl, A.M. , 2004. Overexpression of caspase-3 in hepatocellular carcinomas. Mod. Pathol. 17, 861–867. [DOI] [PubMed] [Google Scholar]
  22. Peterson, Q.P. , Hsu, D.C. , Novotny, C.J. , West, D.C. , Kim, D. , Schmit, J.M. , 2010. Discovery and canine preclinical assessment of a nontoxic procaspase-3-activating compound. Cancer Res. 70, 7232–7241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Peterson, Q.P. , Hsu, D.C. , Goode, D.R. , Novotny, C.J. , Totten, R.K. , Hergenrother, P.J. , 2009. Procaspase-3 activation as an anti-cancer strategy: structure-activity relationship of procaspase-activating compound 1 (PAC-1) and its cellular co-localization with caspase-3. J. Med. Chem. 52, 5721–5731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Peterson, Q.P. , Goode, D.R. , West, D.C. , Ramsey, K.N. , Lee, J.J.Y. , Hergenrother, P.J. , 2009. PAC-1 activates procaspase-3 in vitro through relief of zinc-mediated inhibition. J. Mol. Biol. 388, 144–158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Pop, C. , Salvesen, G.S. , 2009. Human caspases: activation, specificity, and regulation. J. Biol. Chem. 284, 21777–21781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Putt, K.S. , Chen, G.W. , Pearson, J.M. , Sandhorst, J.S. , Hoagland, M.S. , Kwon, J.T. , 2006. Small-molecule activation of procaspase-3 to caspase-3 as a personalized anticancer strategy. Nat. Chem. Biol. 2, 543–550. [DOI] [PubMed] [Google Scholar]
  27. Schimmer, A.D. , 2004. Inhibitor of apoptosis proteins: translating basic knowledge into clinical practice. Cancer Res. 64, 7183–7190. [DOI] [PubMed] [Google Scholar]
  28. Schimmer, A.D. , Dalili, S. , 2005. Targeting the IAP family of caspase inhibitors as an emerging therapeutic strategy. Hematology Am. Soc. Hematol. Educ. Program 2005, 215–219. [DOI] [PubMed] [Google Scholar]
  29. Shi, Y. , 2004. Caspase activation: revisiting the induced proximity model. Cell 117, 855–858. [DOI] [PubMed] [Google Scholar]
  30. Srivastav, S. , Pandeya, S.N. , 2011. Various approaches for synthesis of oxadiazole derivatives. IJRAP 2, 459–468. [Google Scholar]
  31. Storey, S. , 2008. Targeting apoptosis: selected anticancer strategies. Nat. Rev. Drug Discov. 7, 971–972. [DOI] [PubMed] [Google Scholar]
  32. Yang, S. , Thor, A.D. , Edgerton, S. , Yang, X. , 2006. Caspase-3 mediated feedback activation of apical caspases in doxorubicin and TNF-alpha induced apoptosis. Apoptosis 11, 1987–1997. [DOI] [PubMed] [Google Scholar]
  33. Yang, H. , Zonder, J.A. , Dou, Q.P. , 2009. Clinical development of novel proteasome inhibitors for cancer treatment. Expert Opin. Investig. Drugs 18, 957–971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Yun, Y.J. , Li, S.H. , Cho, Y.S. , Park, J.W. , Chun, Y.S. , 2010. Survivin mediates prostate cell protection by HIF-1alpha against zinc toxicity. Prostate 70, (11) 1179–1188. [DOI] [PubMed] [Google Scholar]
  35. Zhang, H. , Yang, J.Y. , Zhou, F. , Wang, L.H. , Zhang, W. , Sha, S. , 2011. Seed oil of brucea javanica induces apoptotic death of acute myeloid leukemia cells via both the death receptors and the mitochondrial-related pathways. Evid. Based Complement Alternat. Med. 2011, 965016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zheng, L. , Yang, W. , Zhang, C. , Ding, W.J. , Zhu, H. , Lin, N.M. , Wu, H.H. , 2011. GDC-0941 sensitizes breast cancer to ABT-737 in vitro and in vivo through promoting the degradation of Mcl-1. Cancer Lett. 309, 27–36. [DOI] [PubMed] [Google Scholar]
  37. Zou, H. , Yang, R. , Hao, J. , Wang, J. , Sun, C. , Fesik, S.W. , 2003. Regulation of the Apaf-1/caspase-9 apoptosome by caspase-3 and XIAP. J. Biol. Chem. 278, (10) 8091–8098. [DOI] [PubMed] [Google Scholar]
  38. Zuo, J. , Schmitt, S.M. , Zhang, Z. , Prakash, J. , Fan, Y. , Bi, C. , Kodanko, J.J. , Dou, Q.P. , 2012. Novel polypyridyl chelators deplete cellular zinc and destabilize the X-linked inhibitor of apoptosis protein (XIAP) prior to induction of apoptosis in human prostate and breast cancer cells. J. Cell Biochem. 113, (8) 2567–2575. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

The following are the supplementary data related to this article:

Supplementary data

Supplementary data

Supplementary data

Supplementary Figure 2 The effects of time, temperature and procaspase‐3 concentration on procaspase‐3 activation by PAC‐1 and WF‐210. (A) The effects of PAC‐1 and WF‐210 on the activation of procaspase‐3 after 0.5 h, 1 h, 2 h, and 12 h. (B) The effects of PAC‐1 and WF‐210 on the activation of 1.0 μM procaspase‐3 at 25 °C, 37 °C and 42 °C and of 0.15 μM procaspase‐3 at 37 °C. (C) Comparison of procaspase‐3 activity at different times, temperatures, and procaspase‐3 concentrations.

Supplementary Figure 3 Expression level of procaspase‐3 in human malignant and normal immortalized cell lines. Western blot analysis of procaspase‐3 levels in different cell lines. β‐actin was used as a loading control. MDA‐MB‐435 (435), COLO205 (COLO).

Supplementary Figure 4 Staurosporine and MG132‐induced apoptosis in HL‐60 cells co‐treated with different caspase inhibitors. Phosphatidylserine exposure was measured by Annexin V staining and propidium iodide (PI) counterstaining in HL‐60 cells after treatment for 24 h with 10 μM Staurosporine or 50 μM MG132 in the presence of 50 μM pan‐caspase inhibitor Z‐VAD‐FMK, the caspase‐3 inhibitor Z‐DEVD‐FMK, the caspase‐8 inhibitor Z‐IETD‐FMK, or the caspase‐9 inhibitor Z‐LEHD‐FMK.

Supplementary Figure 5 WF‐210 and PAC‐1 activate procaspase‐3 to caspase‐3. (A) WF‐210 and PAC‐1 induce cleavage of procaspase‐3 to give active caspase‐3 in HL‐60 and U‐937 cells, as detected with an antibody against cleaved caspase‐3 (green). Nuclei are labeled with Hoechst 3342 (blue). Arrows indicate caspase‐3‐positive cells (nuclei with both Hoechst and FITC staining). (B) The procaspase‐3 activation rate (FITC‐positive cells/total cells) in HL‐60 and U‐937 cells treated with increasing concentrations of WF‐210 and PAC‐1 for different times.

Supplementary Figure 6 Caspase‐3, caspase‐8 and caspase‐9 activity in HL‐60 cells. The activities of caspase‐3, caspase‐8 and caspase‐9 were measured in HL‐60 cells after treatment with PAC‐1 (50 μM), WF‐210 (10 μM) and etoposide (20 μM) for 0.5, 1, 2, 4, 6, 12 and 24 h.

Supplementary Figure 7 The effects of procaspase‐3 knockdown on cytoxicity, procaspase‐3 cleavage and PARP cleavage induced by staurosporine (A), FAS ligand (B), etoposide (C) and MG‐132 (D). CellTiter‐Glo kit was used to detect the cytotoxicity of compounds in HL‐60 cells that were treated for 72 h with 0.08, 0.4, 2, 10, 50, and 100 μM (or ng/ml) of each compound. Western blotting was used to measure the compound‐induced cleavage of procaspase‐3 and PARP in HL‐60 cells that were treated for 24 h with 2, 10, and 50 μM (or ng/ml) of each compound. The control (Sham) is scramble siRNA.

Supplementary Figure 8 The effects of procaspase‐3 overexpression on cytoxicity, procaspase‐3 cleavage and PARP cleavage induced by staurosporine (A), FAS ligand (B), etoposide (C) and MG‐132 (D). CellTiter‐Glo kit was used to detect the cytotoxicity of compounds in MCF‐7 cells that were treated for 72 h with 0.08, 0.4, 2, 10, 50, and 100 μM (or ng/ml) of each compound. Western blotting was used to measure the compound‐induced cleavage of procaspase‐3 and PARP in MCF‐7 cells that were treated for 24 h with 2, 10, and 50 μM (or ng/ml) of each compound.

Supplementary Figure 9 PAC‐1 and WF‐210 have no effect on the expression of Bcl‐2 family proteins. Western blot analyses of Bcl‐2 family proteins, including Bcl‐2, Bax, Bcl‐xl, and Bid, in HL‐60 and U‐937 cells treated for 24 h with PAC‐1 and WF‐210 at 2, 10, and 50 μM. β‐actin expression was used as a loading control.

Supplementary Figure 10 WF‐210 downregulates IAP family proteins through the ubiquitination–proteasome pathway. (A) Western blot analyses of the IAP proteins Survivin and XIAP in HL‐60 and U‐937 cells treated with 2, 10, and 50 μM of PAC‐1 and WF‐210 for 24 h. β‐actin was used as a loading control. (B) Western blot showing the effects of procaspase‐3 knockdown on Survivin and XIAP levels in HL‐60 cells treated with PAC‐1 and WF‐210 at 2, 10, and 50 μM for 24 h. β‐actin was used as a loading control. (C) Western blot analyses of Survivin and XIAP in HL‐60 cells treated with 10 μM WF‐210 or 50 μM PAC‐1 in the presence of 50 μM Ac‐DEVD‐FMK (caspase‐3 inhibitor) and Ac‐VAD‐FMK (pan‐caspase inhibitor). (D) Real‐time PCR analysis of Survivin and XIAP mRNA levels in HL‐60 cells treated with 2, 10, and 50 μM WF‐210 or PAC‐1 for 24 h. (E) The ubiquitination of XIAP and Survivin in cells treated with PAC‐1 or WF‐201 in the presence or absence of MG132 (5 μM) was determined by immunoprecipitation of XIAP or Survivin and immunobloting with ubiquitin antibody. (F) Western blot analyses of Survivin and XIAP in HL‐60 cells treated with 10 μM WF‐210 or 50 μM PAC‐1 in the presence of 5 or 10 μM ZnSO4.

Supplementary Figure 11 The effects of PAC‐1 and WF‐210 on body weight and levels of tumor‐related proteins in vivo. (A) Body weights of Hep‐3B, MDA‐MB‐435, GBC‐SD and MCF‐7 xenograft mice treated with WF‐210 or PAC‐1. (B) Immunohistochemical analysis of tumor‐related proteins (p53, caspase‐3, PCNA, MMP‐2) in GBC‐SD and MDA‐MB‐435 xenograft mice treated with WF‐210 (100 mg/kg, i.g.).

Supplementary Figure 12 The cytotoxic effects of PAC‐1 and WF‐210 on SH‐SY5Y cells. (A) Viability of SH‐SY5Y cells was measured with the MTT assay after 72 h of incubation with 0.08, 0.4, 2, 10, 30, 50, and 100 μM PAC‐1 or WF‐210. (B) DNA ladder assay to detect apoptotic fragmentation of DNA in SH‐SY5Y cells after treatment with PAC‐1 or WF‐210 for 24 h. (C) Images of TUNEL staining of SH‐SY5Y cells after treatment with PAC‐1 or WF‐210 for 24 h. (D) Quantitation of TUNEL staining of SH‐SY5Y cells after treatment with PAC‐1 or WF‐210 for 24 h. The analysis was performed using a high content assay system.

Supplementary Figure 1 The structure of WF‐210 confirmed by 1H‐NMR.


Articles from Molecular Oncology are provided here courtesy of Wiley

RESOURCES