Skip to main content
Molecular Oncology logoLink to Molecular Oncology
. 2014 Jun 10;8(8):1441–1457. doi: 10.1016/j.molonc.2014.05.013

A functional interplay between ZNF217 and Estrogen Receptor alpha exists in luminal breast cancers

Nhan T Nguyen 1,2,3,†, Julie A Vendrell 1,2,3,†, Coralie Poulard 2,3, Balázs Győrffy 4,5,6, Sophie Goddard-Léon 7, Ivan Bièche 8, Laura Corbo 2,3, Muriel Le Romancer 2,3, Thomas Bachelot 7, Isabelle Treilleux 3,7, Pascale A Cohen 1,2,3,✉
PMCID: PMC5528595  PMID: 24973012

Abstract

We aimed at highlighting the role of ZNF217, a Krüppel‐like finger protein, in Estrogen Receptor‐α (ERα)‐positive (ER+) and luminal breast cancers. Here we report for the first time that ZNF217 and ERα proteins bind to each other in both breast cancer cells and breast tumour samples, via the ERα hinge domain and the ZNF217 C‐terminal domain. ZNF217 enhances the recruitment of ERα to its estrogen response elements (ERE) and the ERα‐dependent transcription of the GREB1 estrogen‐regulated gene. The prognostic power of ZNF217 mRNA expression levels is most discriminatory in breast cancers classified with a “good prognosis”, particularly the Luminal‐A subclass. A new immunohistochemistry ZNF217 index, based on nuclear and cytoplasmic ZNF217 staining, also allowed the identification of intermediate/poor relapse‐free survivors in the Luminal‐A subgroup. ZNF217 confers tamoxifen resistance in ER+ breast cancer cells and is a predictor of relapse under endocrine therapy in patients with ER+ breast cancer. ZNF217 thus allows the re‐stratification of patients with ER+ breast cancers considered as cancers with good prognosis where no other biomarkers are currently available and widely used. Here we propose a model in ER+ breast cancer where ZNF217‐driven aggressiveness incorporates ZNF217 as a positive enhancer of ERα direct genomic activity and where ZNF217 possesses its highest discriminatory prognostic value.

Keywords: ZNF217, Estrogen Receptor‐α, Breast cancer, Estrogen signalling, Biomarker, Endocrine therapy resistance

Highlights

  • ZNF217 and ERα proteins bind to each other in breast cancer cells.

  • ZNF217 enhances the recruitment of ERα to its estrogen response elements.

  • ZNF217 increases the ERα‐dependent transcription of estrogen‐regulated gene.

  • ZNF217 is a predictor of relapse under endocrine therapy in ER+ breast cancers.

  • ZNF217 allows the re‐stratification of patients with luminal A breast cancers.


Abbreviations

KLF

Krüppel‐like factor

ERα

estrogen receptor alpha

ER+

ERα‐positive

E2

17β‐estradiol

IP

immunoprecipitation

PLA

proximity ligation assay

GST

glutathione S‐transferase

ERE

estrogen response element

ChIP

chromatin immunoprecipitation

RTQ‐PCR

real‐time quantitative PCR

IHC

immunohistochemistry

Tam

tamoxifen

OH‐Tam

4‐hydroxy‐tamoxifen

RFS

relapse‐free survival

OS

overall survival

1. Introduction

Breast cancer is the most frequently diagnosed cancer worldwide and is the leading cause of cancer death among women. ZNF217 is a candidate oncogene located on chromosome 20q13.2, a region frequently amplified in many tumours, including those of the breast (Quinlan et al., 2007). The first direct evidence for the role of ZNF217 in oncogenesis was the immortalization of finite life‐span human mammary epithelial cells or ovarian cells transduced with ZNF217 (Li et al., 2007; Nonet et al., 2001). ZNF217 was later shown to provide a selective advantage to cancer cells by inducing resistance to chemotherapy, in particular by interfering with survival pathways or by deregulating apoptotic signals (Huang et al., 2005; Thollet et al., 2010). High expression levels of ZNF217 have also been associated with invasion/migration both in vitro and in vivo (Littlepage et al., 2012; Vendrell et al., 2012). ZNF217 is also a new inducer of epithelial–mesenchymal transition (EMT) (Vendrell et al., 2012). Activation of the ERBB2/ERBB3/FAK pathway (Vendrell et al., 2012), activation of the Akt pathway (Huang et al., 2005), Aurora‐A overexpression (Thollet et al., 2010) or activation of the TGF‐β pathway (Vendrell et al., 2012) have also been associated with ZNF217 deleterious functions. Our group also recently reported that high levels of ZNF217 mRNA represents a new biomarker for poor prognosis associated with shorter relapse‐free survival (RFS) in breast cancer (Vendrell et al., 2012). However, whether ZNF217 expression adds significant value to the molecular classification of breast cancers (luminal, HER2+, Triple negative subclasses) has never been investigated.

ZNF217 is a Krüppel‐like finger (KLF) protein that contains eight zinc fingers (Collins et al., 1998), suggesting it acts as a transcription factor. Indeed, it has been shown that ZNF217 binds to specific DNA sequences to regulate target gene expression (Cowger et al., 2007). Although some studies have shown that ZNF217 can be part of a transcriptional repressor complex and consequently negatively regulates the transcription of target genes (Banck et al., 2009; Cowger et al., 2007; Quinlan et al., 2006), the role of ZNF217 in transcriptional regulation seems to be complex. Indeed, it has also been shown that ZNF217 can directly bind to the promoter of some genes and positively regulate their expression (Krig et al., 2007, 2010, 2008, 2012). Other models where ZNF217 can co‐operate with other transcription factors have also been proposed (Quinlan et al., 2007).

About 70–80% of breast cancers express estrogen receptor alpha (ERα). In these tumours, estrogens participate in the development and the progression of breast carcinoma (Pike et al., 1993), and measurement of ERα expression has allowed an accurate prediction of response to endocrine therapy (Burstein et al., 2010). The first aim of this work was to decipher whether a functional interplay exists between ZNF217 and ERα. We found that ZNF217 is able to bind to ERα, leading to the activation of the estrogen‐dependent transcriptional activity of ERα, to confer endocrine therapy resistance in ERα‐positive (ER+) breast cancer cell lines, and to represent a predictor of ER+ patient outcome in response to endocrine therapy. Altogether, this study strongly suggests that high expression levels of ZNF217 in ER+ breast tumours could lead to an aberrant activation of ERα signalling and contribute to relapse in patients with ER+ breast cancer. Thus, ZNF217 expression adds significant value to the molecular classification of breast cancer particularly for the Luminal subtype, which then enables the identification of patients with ER+ breast cancer that are prone to relapse that cannot be detected using the classical biomarkers currently available.

2. Materials and methods

2.1. Cell culture

All cell lines used were purchased from the American Type Culture Collection (ATCC) and cultured as recommended. MDA‐MB‐231‐pcDNA6, MDA‐MB‐231‐ZNF217, MVLN and CL6.7 cells have been previously described (Badia et al., 2000; Thollet et al., 2010). Cells were purged in DMEM without phenol red, supplemented with 3% steroid‐depleted, dextran‐coated and charcoal‐treated foetal calf serum (DCC medium) for 4 days prior to 17β‐estradiol (E2, Sigma, St Louis, MO, USA) treatment. The culture medium and treatment were changed every 2 days. pcDNA6 and pcDNA6‐ZNF217 plasmids used for transient transfection experiments have been previously described (Thollet et al., 2010).

2.2. Western‐blot analysis

Western‐blot experiments were performed as previously described (Vendrell et al., 2004). The antibodies used were: anti‐ZNF217 (Ab48133, 1/1000) and anti‐Sp1 (Ab77441, 1/1000, Abcam Ltd, Cambridge, UK); anti‐ERα (clone F‐10, 1/1000, Santa Cruz Biotechnology, Santa Cruz, CA, USA); anti‐Hsp90 (clone C45G5, 1/1000), anti‐phospho‐ser167‐ERα (clone 16J4, 1/1000) and anti‐phospho‐ser118‐ERα (clone D1A3, 1/1000, Cell Signaling, Beverly, MA, USA); anti‐α‐tubulin (clone DM1A, 1/5000, Sigma).

2.3. Breast cancer cohorts

Women with primary breast tumours and with known clinical follow‐up who had not received any therapy before surgery and who relapsed or not while receiving chemotherapy and/or endocrine therapy were recruited from the Centre de Ressources Biologiques of the Centre Léon Bérard (CRB1, CRB2, CRB3 cohorts, France, Lyon) or from the Centre René Huguenin (Huguenin cohort, France, St Cloud), (Supplementary Tables S1–S4). Informed consent was obtained from all patients, and the study was approved by the ethics committee of the institutions. The CRB1 and CRB2 cohorts were subdivided in breast cancer subtypes following the St Gallens recommendation (Gnant et al., 2011, 2013, 2011) using the immunohistological markers ER, the progesterone receptor (PR), HER2/neu/ERBB2 (receptor tyrosine kinase) and the Scarff‐Bloom‐Richardson (SBR) grade (indicative of proliferation) as following: Luminal (ER+ and/or PR+), Luminal‐A [ER+ and/or PR+, HER2–, low proliferation (SBR1 or SBR2)], Luminal‐B [ER+ and/or PR+, HER2+ and/or SBR3 (high proliferation)], HER2‐enriched (ER–, PR–, HER2+) and Triple negative (ER–, PR–, HER2–) subtypes. The KMP cohort investigation resulted from a meta‐analysis of gene‐expression profiles from 2978 primary breast cancer specimens who had not received any therapy before surgery and with known clinical follow‐up (Gyorffy and Schafer, 2009). In this cohort, breast tumour samples were again classified into molecular subtypes according to the St Gallen guidelines (Gnant et al., 2011, 2013, 2011) using previously published cut‐off values for ESR1, HER2 and MKI67 (proliferation index) (Gyorffy et al., 2012). All statistical analyses assessing the prognostic value of ZNF217 were performed using the SPSS™ Software. The data were divided at the median value of ZNF217 mRNA expression into two groups with either high or low expression.

2.4. Immunoprecipitation (IP)

IP experiments were performed as previously described (Ghayad et al., 2010) using an anti‐ZNF217 antibody (Ab48133, at 2 μg/ml).

2.5. Proximity Ligation Assay (PLA)

PLA experiments were performed as previously described (Poulard et al., 2012) using an anti‐ZNF217 antibody (Ab48133, 1/50), anti‐ERα antibody (1D5, 1/50, Dako). The Duolink II Fluorescence Revelation Kit and the Duolink II Brighfield Revelation Kit (Olink Bioscience, Uppsala, Sweden) were used respectively, for investigations in breast cancer cell lines and in primary breast tumour samples (TMA).

2.6. Gene silencing

Stealth™ siRNAs targeting ZNF217 (siRNA‐ZNF217‐A, leading to intermediate knock‐down of ZNF217 and siRNA‐ZNF217‐B, leading to total ZNF217 knock‐down) (Thollet et al., 2010), ESR1 and scrambled control RNA (Life Technologies, Paisley, UK) were transfected (5 × 10−9 M) as previously described (Thollet et al., 2010).

2.7. Subcellular fractionation

Briefly, 2 × 106 cells were lysed using the Subcellular Protein Fractionation Kit (Thermo Scientific, Waltham, MA, USA). For each cellular compartment, a quantity of protein corresponding to a constant number of cells was loaded onto an SDS‐PAGE gel and analysed by western‐blot.

2.8. Glutathione S‐transferase (GST) pull‐down assays

Different fragments of ERα (Sentis et al., 2005) or ZNF217 (Cowger et al., 2007) fused with GST were produced in E. coli BL21. S‐glutathione beads‐purified GST‐fused fragments were then incubated, with or without E2 (10−6 M), with in vitro‐translated ZNF217 or ERα (TnT® T7 Coupled Reticulocyte Lysate kit, Promega). The resulting complexes were eluted and subjected to detection by western‐blot analysis.

2.9. Luciferase activity assay

The ER+ cells were transfected with 150 ng estrogen response element (ERE) firefly luciferase reporter plasmid (ERE‐luc), 10 ng Renilla luciferase plasmid (pTK‐RL) and with either pcDNA6 or pcDNA6‐ZNF217. After transfection, cells were grown for 24 h in the presence of vehicle or 10−9 M E2, and luciferase activities were then assessed (Vendrell et al., 2007).

2.10. Chromatin immunoprecipitation (ChIP) experiments

MCF‐7 cells were transfected with an ERE‐Luc plasmid and with either pcDNA6 or pcDNA6‐ZNF217, then grown for 24 h in presence of vehicle or 10−9 M E2. ChIP experiments were carried out as previously described using an anti‐ERα antibody (clone HC‐20, Santa Cruz Biotechnology) or anti‐rabbit IgG (Ab46540, Abcam Ltd) as a negative control (Vendrell et al., 2012). Immunoprecipitated DNA was quantified by RTQ‐PCR using the 5′‐CGACTCTAGCGGAGGACTGT‐3′ and the 5′‐AACACCAGGGTGTGGCTCT‐3′ primers that hybridize onto the sequences flanking the ERE present in the ERE‐Luc plasmid and that do not lead to any genomic DNA amplification. The background signal obtained using the anti‐rabbit IgG was subtracted and values were expressed as the % of the input DNA quantified by RTQ‐PCR. ChIP experiments performed on the endogenous ERE present on the GREB1 promoter (ERE1, Sun et al., 2007) were conducted as above on MCF‐7 cells transfected with either pcDNA6, pcDNA6‐ZNF217, scrambled control RNA or siRNA‐ZNF217‐A and grown for 24 h in presence of vehicle or 10−9 M E2. Immunoprecipitated DNA was then quantified by using the 5′‐GTGGCAACTGGGTCATTCTGA‐3′ and the 5′‐CGACCCACAGAAATGAAAAGG‐3′ primers that hybridize onto the sequences flanking the ERE1. RTQ‐PCR measurements of GREB1 mRNA were performed on the same transfected cell cultures than those used for the GREB1 ChIP experiments.

2.11. Real‐time quantitative PCR (RTQ‐PCR)

Total RNA extraction, reverse transcription and RTQ‐PCR measurements were performed as described previously (Vendrell et al., 2012).

2.12. Soft‐agar colony‐formation assay

This experiment was performed as previously described (Stephenson et al., 1971) and the colonies were counted after 20 days.

2.13. Mammosphere assay

Single‐cell suspensions were seeded using non‐adherent mammosphere culturing conditions (Dontu et al., 2003). The media was replenished ever 2–3 days of culture and the mammospheres were counted after 7 days.

2.14. Cytotoxicity assay

24 h after transfection, 1.2 × 104 cells were plated into each well of a 96‐well plate and treated with or without OH‐Tam (10−8 to 10−6 M) (Sigma) in DMEM medium for 4 days. Cell viability was then assessed (Thollet et al., 2010).

2.15. Cell proliferation assay

After siRNA transfection, 8 × 103 cells were plated into each well of a 96‐well plate and treated with or without OH‐Tam (2 × 10−7 M) in DMEM medium for 5 days. Proliferating cells were analysed using a Cell Proliferation ELISA 5‐bromodeoxyuridine (BrdU) Kit (Roche, Meylan, France) (Vendrell et al., 2005).

2.16. Immunohistochemistry (IHC)

Experiments were carried out using the anti‐ZNF217 polyclonal rabbit antibody (Ab48133, 1/100, Abcam Ltd) (Vendrell et al., 2012). Sections were counterstained with haematoxylin and analysed independently by two investigators assessing the percentage of tumour cells displaying nuclear and cytoplasmic staining within invasive carcinoma. The median value of both nuclear and cytoplasmic staining was used to define an IHC ZNF217 index. The patients were then divided into two groups with either a high IHC ZNF217 index corresponding to samples with a high % of tumour cells displaying nuclear staining (>60%) and a high % of tumour cells displaying cytoplasmic staining (>70%); or a low IHC ZNF217 index corresponding to samples with a low % of tumour cells displaying nuclear staining (≤60%) and/or a low % of tumour cells displaying cytoplasmic staining (≤70%).

3. Results

3.1. ZNF217 and ERα protein interaction exists in both ER+ breast cancer cell lines and ER+ breast tumour samples

On investigating ZNF217 expression levels and ER status, we found that ZNF217 mRNA or protein levels were significantly higher in ER+ breast cancer cell lines compared with ER– cell lines (Supplementary Figures S1A‐C). Retrospective analysis of the genomic data also revealed that in at least 17 independent primary breast tumour cohorts, ZNF217 mRNA levels were again significantly higher in the ER+ groups compared with the ER− groups (Supplementary Table S5). In ER+ breast cancer patients from the KMP cohort, higher ZNF217 mRNA levels were again present compared with ER− breast cancer samples (p = 10−7, Supplementary Figure S1D).

To study whether the ZNF217 protein physically interacts with ERα, IP experiments were performed which highlighted the existence of a ZNF217/ERα interaction in MCF‐7 cells (Figure 1A). The Proximity Ligation Assay (PLA) technology which enables the in cellulo detection of protein–protein interactions visualized by red dots (Poulard et al., 2012), was used to investigate the ZNF217/ERα interaction: (i) in the MCF‐7 cell line (ER+/ZNF217+); (ii) in the MDA‐MB‐231 breast cancer cell line (ER– with low endogenous levels of ZNF217) stably transfected with either an empty vector (pcDNA6) or with the pcDNA6‐ZNF217 vector encoding for ZNF217 (Thollet et al., 2010) (Figure 1B). Figure 1C and 1D support the finding that a protein complex comprising endogenous ZNF217 and endogenous ERα exists in MCF‐7 cells. As a negative control, no/few dots were detected in the ER− MDA‐MB‐231 cells transfected or not with pcDNA6‐ZNF217 (Figures 1C and 1D). In MCF‐7 cells, when silencing the expression of ZNF217 or ERα (Figure 1E), the PLA signal was significantly decreased (Figures 1F and G), supporting the specificity of the ZNF217/ERα interaction. Finally, the existence of ZNF217/ERα complexes was also confirmed in two independent ER+/ZNF217+ breast cancer lines, BT‐474 and T‐47D (Supplementary Figure S2).

Figure 1.

Figure 1

ZNF217 and ERa proteins assemble into a complex in ER+ breast cancer cells. (A) IP of MCF‐7 cells with anti‐ZNF217 antibody followed by ZNF217 and ERa western‐blot. (B) Western‐blot of ZNF217 and ERa expression in MCF‐7 cells and MDA‐MB‐231 cells transfected with pcDNA6 or pcDNA6‐ZNF217. (C) In situ PLA detection of endogenous ZNF217/ERa complexes (red dots) in MCF‐7 and MDA‐MB‐231 cells transfected with pcDNA6 or pcDNA6‐ZNF217. The nuclei were counterstained with DAPI (blue). (D) Quantification of the number of dots per cell in Figure 1C. Results are the mean ± standard error of the mean (SEM). p determined by Student t‐test. Representative of independent experiments. (E) Western‐blot of ZNF217 and ERa expression in MCF‐7 cells non‐transfected or transfected with either scrambled RNA, siRNA‐ESR1 or siRNA‐ZNF217‐B. (F) ZNF217/ERa complexes analysed by PLA in MCF‐7 cells non‐transfected or transfected with either scrambled RNA, siRNA‐ESR1 or siRNA‐ZNF217‐B. (G) Quantification of the number of dots per cell in Figure 1F (as described in Figure 1D). (H) Localisation of the ZNF217/ERa complexes (indicated by arrows) in MCF‐7 cells visualised using confocal microscopy. (I) Western‐blot of ZNF217 expression in subcellular fractions of MCF‐7 cells. Hsp90 and Sp1 expression levels were used to control the subcellular fractionation (the cytoplasmic and nuclear fractions, respectively). Representative image from three independent sub‐cellular fractionations.

Confocal microscopy in MCF‐7 cells revealed that PLA dots (ZNF217/ERα interaction) were mainly located in the nucleus, which is in accordance with the known role of ZNF217 in the transcriptional regulation of target genes (Cowger et al., 2007; Krig et al., 2007), but were also present in the cytoplasm (Figure 1H). After sub‐cellular fractionation of MCF‐7 breast cancer cells followed by western‐blot analysis ZNF217 protein expression was found predominantly in the nuclear fractions (soluble nuclear and chromatin‐bound fractions), but also in the cytoplasmic fraction (Figure 1I). These new findings favour the existence of an unknown ZNF217 protein pool localised in the cytoplasm of breast cancer cells.

Using the IHC conditions previously set up by our group (Vendrell et al., 2012), the protein expression levels of ZNF217 were explored in a cohort (CRB1 cohort) composed of 162 primary breast tumour samples which were included in five tissue microarray (TMA) blocks. As previously observed (Rahman et al., 2011; Vendrell et al., 2012), no staining was observed in stromal cells and ZNF217 expression was mainly detected in the nucleus of the tumour cells (87% of the breast tumour samples) (Figure 2A). However, a specific cytoplasmic staining of the tumour cells was also present in a large number of breast tumour samples (∼70%; Figure 2A), confirming the existence of a ZNF217 cytoplasmic pool, in accordance with Figures 1H and I. Among the 162 primary breast tumour samples investigated, 60% displayed both nuclear and cytoplasmic staining, 27% displayed a nuclear staining only, 9% displayed cytoplasmic staining only and no staining could be detected in 4% of the samples.

Figure 2.

Figure 2

ZNF217 and ERα protein interaction occurs in primary ER+ breast tumour samples. (A) Illustrative examples of ZNF217 IHC staining in primary breast tumour samples. (B) Representative illustration of the detection of ZNF217/ERα complexes (brown dots) by PLA in primary breast tumour samples (ERα and ZNF217 status were stated by IHC). Some ZNF217/ERα complexes are indicated by arrows.

We used the PLA to evaluate the presence of any ZNF217/ERα complexes in a pilot series of 39 breast tumour samples from the CRB1 cohort. Interestingly, the ZNF217/ERα interaction was detected in 70% (23 out of 33 samples) of ER+/ZNF217+ breast tumour samples, but in none (0 out of 6 samples) of the ER+/ZNF217–, ER–/ZNF217+ or ER–/ZNF217− breast tumour samples (Figure 2B). Interestingly, the dots observed in the ER+/ZNF217+ breast tumour samples localise both in the nucleus and the cytoplasm of the tumour cells. Globally, the presence of the ZNF217/ERα complex is in accordance with the ZNF217 and ERα status in 88% of the breast tumour samples investigated.

Altogether, these findings provide strong evidence that: (i) a ZNF217/ERα interaction exists both in breast cancer cell lines and in breast tumour samples; (ii) ZNF217 proteins can localise in the nucleus and/or the cytoplasm of breast cancer cells.

3.2. The ZNF217/ERα interaction is estrogen‐independent and involves the hinge domain of ERα and the C‐terminal domain of ZNF217

IP and PLA experiments demonstrated that the binding of E2 to ERα is not necessary for the assembly of the ZNF217/ERα complex (Figure 3A and B). PLA experiments revealed that in the absence of E2 (steroid‐free medium), the ZNF217/ERα complex was already present in MCF‐7 cells, and persisted after 5 min, 15 min or 1 h of E2‐stimulation (Figure 3B and C). The decrease in the number of red dots detected after 24 h of E2‐treatment is most likely the consequence of a decrease in ERα expression following treatment with E2 (Supplementary Figure S3), which has been previously described (Saceda et al., 1988).

Figure 3.

Figure 3

ZNF217 directly interacts with ERα in an E2‐independent manner. (A) IP of MCF‐7 cells treated with vehicle (−) or E2 (10−8 M) for 24 h with an anti‐ZNF217 antibody followed by ZNF217 and ERα western‐blot. (B) In situ PLA detection of endogenous ZNF217/ERα complexes in MCF‐7 cells treated with vehicle (−) or E2 (10−8 M) over different times. (C) Quantification of the number of dots per cell (mean ± SEM; p determined by Student t‐test). (D) Schematic representation of the GST‐fused ERα deletion fragments produced in E. Coli. (E) Pull‐down of in vitro‐translated ZNF217 by different GST‐fused ERα fragments. ZNF217 western‐blot analysis of the resulting in vitro‐binding complexes (representative of three independent experiments). (F) Schematic representation of the GST‐fused ZNF217 deletion fragments produced in E. Coli. Black bars represented the position of the zinc fingers. (G) Pull‐down of in vitro‐translated ERα by different GST‐fused ZNF217 fragments. ERα western‐blot of the resulting in vitro‐binding complexes, representative of three independent experiments. Signal quantifications are presented in Supplementary Figure S4.

The GST pull‐down assays used in vitro translated ZNF217 proteins incubated with GST‐fused ERα fragments produced from E. coli (Figure 3D) and showed that ZNF217 interacts with the hinge domain of ERα, but with none of the other ERα fragments tested (Figure 3E). GST‐ER3, that contains the ligand‐binding domain of ERα, did not demonstrate any interaction with ZNF217, neither in the presence or absence of E2 (Figure 3E). GST‐fused ZNF217 fragments were produced in E. coli (Figure 3F) and incubated with in vitro translated ERα. Figure 3G and Supplementary Figure S4 revealed that: (i) the F4 domain, located in the carboxy terminus region of ZNF217, strongly interacts with ERα, and again, independently of the presence of E2; (ii) the F2 and F3 regions of ZNF217 show a very weak interaction with ERα, and it cannot be excluded that these domains might also be partially involved in the ZNF217/ERα interaction but to a lesser extent. Altogether, these molecular mapping assays demonstrated that ERα and ZNF217 interact directly at the hinge domain of ERα and at the carboxy terminus domain of ZNF217 in an E2‐independent manner.

3.3. ERα transcriptional activity and ERα recruitment on its EREs are enhanced in the presence of ZNF217

HEK‐293T cells (with low levels/no endogenous expression of ZNF217 and no ERα, Supplementary Figure S5A) were transfected with ERα‐ and/or ZNF217‐encoding expression plasmids and assessed using an ERE‐luciferase reporter gene assay. Supplementary Figure S5B illustrates that in these cells, the E2‐driven transcriptional activity of ERα was enhanced in a ZNF217 dose‐dependent manner. In the ER+/ZNF217+ MCF‐7 cell line (Figure 4A) the ectopic overexpression of ZNF217 was again associated with significantly enhanced E2‐driven transcriptional activity of ERα. In the absence of E2, cells displayed similar and low basal ERα transcriptional activity levels, independent of the presence or absence of ZNF217 (Figure 4A, Supplementary Figure S5B), thus ruling out that ZNF217 could contribute to any ligand‐independent activation of ERα transcriptional activity. ChIP assays were performed in MCF‐7 cells transfected with an ERE‐Luc plasmid and revealed that the E2‐dependent binding and recruitment of ERα to the ERE present within the plasmid was significantly enhanced when ZNF217 was overexpressed (Figure 4B). GREB1 is a well‐known E2‐regulated gene whose promoter contains typical ERE sites (Sun et al., 2007). Consistent with our model, overexpression of ZNF217 in MCF‐7 cells was associated with significantly enhanced E2‐dependent binding and recruitment of ERα to the GREB1 ERE (Figure 4C), and significantly enhanced E2‐induced GREB1 mRNA expression levels (Figure 4D). Silencing ZNF217 in MCF‐7 cells led to significantly decreased E2‐dependent binding and recruitment of ERα to the GREB1 ERE (Figure 4E), and significantly decreased E2‐induced GREB1 mRNA expression levels (Figure 4F). In an independent ER+ breast cancer cell line (BT‐474), we again validated that the ectopic overexpression of ZNF217 was associated with significantly enhanced E2‐driven transcriptional activity of ERα and significantly enhanced E2‐induced GREB1 mRNA expression levels (Supplementary Figure S6). We thus propose a model for ZNF217‐driven aggressiveness in ER+ breast cancer cells that incorporates ZNF217 as a positive enhancer of ERα direct genomic activity and ERα signalling.

Figure 4.

Figure 4

ZNF217 enhances the transcriptional activity of ERα and increases the recruitment of ERα on its EREs in MCF‐7 cells. (A) Relative luciferase activity of MCF‐7 cells transfected or not with pcDNA6‐ZNF217. Cells were treated with vehicle or E2 (10−9 M) for 24 h. Histograms represent the ratio of the firefly value normalised to the renilla value (mean ± SD of at least three independent experiments; p determined by Student t‐test). (B) ChIP assays using anti‐ERα antibody or human IgG as a control in MCF‐7 cells transfected with ERE‐Luc plasmid and pcDNA6 or pcDNA6‐ZNF217, then treated with vehicle or E2 (10−9 M) for 24 h. The amount of immunoprecipitated DNA fragments were quantified using RTQ‐PCR. Values, expressed as a % of the input DNA, are mean ± SD of three independent RTQ‐PCR experiments and representative of three independent ChIP experiments. (C) ChIP assays performed as in (B) on an endogenous GREB1 ERE in MCF‐7 cells transfected with either pcDNA6 or pcDNA6‐ZNF217, then treated with vehicle or E2 (10−9 M) for 24 h. Representative of three independent ChIP experiments. (D) GREB1 mRNA expression was explored by RTQ‐PCR using the same MCF‐7 transfected cells than in (C) (mean ± SD of independent RTQ‐PCR experiments; p determined by Student t‐test). (E) ChIP assays performed as in (C) in MCF‐7 cells transfected with either scrambled RNA or siRNA‐ZNF217‐A, then treated with vehicle or E2 (10−9 M) for 24 h. Representative of three independent ChIP experiments. (F) GREB1 mRNA expression was explored by RTQ‐PCR using the same MCF‐7 transfected cells than in (E).

3.4. ZNF217 overexpression confers aggressiveness and endocrine therapy resistance in ER+ breast cancer cell lines

To our knowledge, the biological impact of ZNF217 has never been explored in the context of human ER+/luminal breast cancer. In ER+/ZNF217+ MCF‐7 cells, we found that increasing the ZNF217 levels (after ZNF217 ectopic overexpression) led to two features of cancer aggressiveness: enhanced anchorage‐independent growth and increased mammosphere formation (Figure 5A and B).

Figure 5.

Figure 5

Overexpression of ZNF217 increases aggressiveness and confers OH‐Tam resistance in ER+ breast cancer cell lines. (A) Soft‐agar colony formation assay and (B) mammosphere formation assay of MCF‐7 cells non‐transfected or transfected with pcDNA6 or pcDNA6‐ZNF217 (mean ± SD of at least three independent experiments; p determined by Student t‐test). (C) Cytotoxicity activity of OH‐Tam on MCF‐7 cells non‐transfected or transfected with pcDNA6 or pcDNA6‐ZNF217. The histograms represent the percentage of non‐viable cells in OH‐Tam‐treated cells versus untreated cells (mean ± SD of at least three independent experiments; p determined by Student t‐test). (D) Cell proliferation (BrdU labeling) of MVLN and CL6.7 cells transfected with either scrambled RNA or siRNA‐ZNF217‐A, treated with or without OH‐Tam (2 × 10−7 M) (mean ± SD of three independent experiments; p determined by Student t‐test).

Tamoxifen (Tam) and OH‐Tam (active Tam metabolite) are the most widely used anti‐estrogens for treating hormone‐dependent premenopausal patients with breast cancer. Figure 5C illustrates that after ZNF217 ectopic overexpression, MCF‐7 cells displayed resistance to OH‐Tam (significant decrease in OH‐Tam cytotoxic activity). The reciprocal hypothesis was then tested using an in vitro cellular model of acquired OH‐Tam resistance (MVLN/CL6.7) and a siRNA strategy targeting ZNF217 (Supplementary Figure S7). The OH‐Tam‐resistant phenotype developed by the CL6.7 cells was characterized after treatment with OH‐Tam by the loss of the OH‐Tam cytostatic activity that was detectable in the sensitive MVLN cells and the occurrence of stimulation of CL6.7 cell proliferation (estrogen‐like effect) (Figure 6E and Ghayad et al., 2010). Combining a siRNA strategy targeting ZNF217 with OH‐Tam treatment led to a significant increase in the sensitivity to endocrine therapy in the sensitive MVLN cell line and to the reversion of endocrine‐resistance in the CL6.7 cell line (Figure 5D). Interestingly, the level of inhibition of cell proliferation observed in the resistant cells when combining endocrine therapy with a siRNA‐ZNF217 was significantly greater than that observed in the presence of the siRNA‐ZNF217 alone (p = 0.003; Figure 5D), suggesting that the reversion of endocrine resistance is actually the consequence of the combination of a siRNA‐ZNF217 with endocrine therapy and not only of the intrinsic activity of the siRNA‐ZNF217.

Figure 6.

Figure 6

High levels of ZNF217 possess a high and discriminatory prognostic value associated with shorter RFS in ER+, Luminal and Luminal‐A breast tumour samples. Kaplan–Meier analyses of ZNF217 mRNA expression levels (log‐rank test) for RFS are shown: (A) in all primary breast tumour samples from the CRB2 cohort; (B) in the ER+ primary breast tumour samples from the CRB2 cohort; (C) in the Luminal subgroup of the CRB2 cohort; (D) in the Luminal‐A subgroup of the CRB2 cohort; (E) in all primary breast tumour samples from the KMP cohort; (F) in the Luminal subgroup of the KMP cohort; (G) in the Luminal‐A subgroup of the KMP cohort. (H) Kaplan–Meier analysis of IHC ZNF217 index (log‐rank test) for RFS in the Luminal‐A subgroup of the CRB1 cohort.

3.5. The prognostic power of ZNF217 mRNA expression levels is most discriminatory for the ER+, Luminal and Luminal‐A breast cancer subclasses

We aimed at highlighting the prognostic value of ZNF217 mRNA expression levels (RTQ‐PCR) in the molecular classification of breast cancers using a cohort of 113 primary breast tumour samples (CRB2 cohort). In accordance with what we have previously observed in an independent cohort (Vendrell et al., 2012), high ZNF217 mRNA levels were associated with shorter RFS (p = 0.015; Table 1 and Figure 6A) and shorter overall survival (OS, p = 0.037; Table 1 and Supplementary Figure S8). The prognostic value of ZNF217 associated with RFS or OS was observed in the ER+ and in the ER+/HER2− subclasses, but was not informative in the ER– subgroup (Table 1). The ZNF217 prognostic value for RFS was even higher in the ER+ and ER+/HER2– subclasses than that observed in the whole cohort (p = 0.002 and p = 0.001, respectively, compared with p = 0.015, Table 1). Figure 6B illustrates the Kaplan–Meier analysis of ZNF217 mRNA expression levels in the ER+ subclass. All breast tumour samples of the CRB2 cohort were then classified into Luminal, Luminal‐A, Luminal‐B, HER2‐enriched and Triple negative subtypes according to the St Gallen recommendation (see Material and methods). Interestingly, high levels of ZNF217 mRNA expression were significantly associated with shorter RFS in Luminal breast cancers (p = 0.006; Table 1 and Figure 6C) but were not informative in HER2‐enriched or Triple negative subtypes (Table 1). In the Luminal‐A subclass, 54% of patients whose tumours expressed high levels of ZNF217 mRNA expression did relapse before 10 years compared with 20% in low ZNF217 expressing tumours (p = 0.02; Table 1 and Figure 6D), while in the Luminal‐B subclass, ZNF217 was not prognostic (Table 1). With regards to OS, similar observations were made, i.e. ZNF217 expression was prognostic for ER+, ER+/HER2− and Luminal subgroups but not informative for ER−, HER2‐enriched and Triple negative subgroups (Table 1). In the Luminal‐A group, significance was almost reached (p = 0.06, Table 1, univariate analysis in relation to OS), but was totally absent in the Luminal‐B subtype (p = 0.37, Table 1). The most striking results arose from the retrospective analysis of gene‐expression array data for 2978 breast cancer patients (KMP cohort). Again, high levels of ZNF217 mRNA expression were strongly and significantly associated with shorter RFS in the entire cohort (p = 3 × 10−9; Table 2 and Figure 6E) and in the Luminal subgroup (p = 2.2 × 10−5; Table 2 and Figure 6F), but were not prognostic in HER2‐enriched or Triple negative subclasses (Table 2). Again, the most powerful prognostic value of ZNF217 was observed in the Luminal‐A subgroup (p = 3.3 × 10−4; Table 2 and Figure 6G), compared with the Luminal‐B subclass (p = 0.07; Table 2). Altogether, the prognostic power of ZNF217 mRNA expression levels are most discriminatory in specific breast cancer subpopulations, particularly in cases which are considered as having a good/favourable prognosis by the current conventional markers, i.e. the ER+, ER+/HER2−, Luminal and Luminal‐A breast cancer subclasses. ZNF217 expression levels thus allow the re‐stratification of patients with breast cancers considered to have a good prognosis, where no other widely used biomarkers are currently available.

Table 1.

Univariate analysis of the ZNF217 gene expression in relation to relapse‐free survival (RFS) and overall survival (OS) in different subclasses of the 113 breast cancer samples from the CRB2 cohort.

n RFS OS
HRa 95% CIb p c HR 95% CI p
All breast tumour samples 113 5.86 1.17–6.73 0.015 4.34 1.03–5.97 0.037
ER+ subclass 68 9.63 1.61–96.69 0.002 5.20 1.08–22.59 0.023
ER− subclass 45 0.001 0.34–3.03 NS (0.97) 0.22 0.42–4.14 NS (0.64)
ER+/HER2− subclass 57 11.95 N/Ae 0.001 6.74 1.19–74.62 0.009
Luminal subclass (ER+ and/or PR+)d 76 7.42 1.38–17.04 0.006 4.80 1.07–10.05 0.028
HER2‐enriched sublass (ER−, PR−, HER2+)d 16 0.08 0.27–5.82 NS (0.78) 0.74 0.27–25.10 NS (0.39)
Triple negative subclass (ER−, PR−, HER2−)d 21 0.003 0.07–17.30 NS (0.96) 0.18 0.05–6.66 NS (0.67)
Luminal‐A subclass (ER+ and/or PR+, HER2−, SBR1 or SBR2)d 35 5.38 0.99–65.86 0.020 3.36 0.69–48.24 NS (0.06)
Luminal‐B subclass (ER+ and/or PR+, HER2+ and/or SBR3)d 39 1.21 0.47–12.57 NS (0.27) 0.82 0.47–7.52 NS (0.37)
a

HR, Hazard ratio; n, Number of samples.

b

95% CI, 95% confidence interval.

c

p was considered significant when p < 0.05. NS, not significant.

d

subclasses of breast cancer were determined using immunohistological (ER, PR, HER2) and SBR grading according to the St Gallen recommendation (Gnant et al., 2011; Goldhirsch et al., 2013, 2011).

e

N/A, Not applicable as all the cases are censored in the low ZNF217 mRNA level group.

Table 2.

Univariate analysis of the ZNF217 gene expression in relation to relapse‐free survival (RFS) in different subclasses of the 2978 breast cancer samples from the KMP cohort.

n RFS
HRa 95% CIb p c
All breast tumour samples 2978 1.39 1.27–1.51 3.0 × 10−9
Luminal subclassd 2308 1.38 1.23–1.51 2.2 × 10−5
HER2‐enriched subclassd 175 1.52 1.05–1.99 NS (0.08)
Triple negative subclassd 495 1.23 0.95–1.52 NS (0.14)
Luminal‐A subclassd 1410 1.45 1.25–1.65 3.3 × 10−4
Luminal‐B subclassd 898 1.23 1.01–1.45 NS (0.07)
a

HR, Hazard ratio; n, Number of samples.

b

95% CI, 95% confidence interval.

c

p was considered significant when p < 0.05. NS, not significant.

d

breast cancer subclasses were based on the St Gallen recommendation (Gnant et al., 2011; Goldhirsch et al., 2013, 2011) using ESR1, HER2 and MKI67 (Gyorffy et al., 2012).

Gene‐expression profiling has also led to a molecular classification of breast cancers characterized by different molecular subtypes, each with different clinical outcomes (Hu et al., 2006, 2006, 2001, 2003). While not fully overlapping with the breast cancer classification of using widely used clinical biomarkers (ER, PR, HER2, KI67 or SBR) (Cuzick et al., 2011; Dunkler et al., 2007; Gnant et al., 2011; Guiu et al., 2012), this molecular classification has also subdivided the Luminal subtype into two Luminal subtypes being that the Luminal‐B subtype exhibits a lower expression of ER‐related genes, a higher expression of proliferative genes and a poorer outcome compared with the Luminal‐A subtype (Hu et al., 2006, 2001, 2003). The PAM50 gene signature identified from previous gene‐expression studies (Hu et al., 2006, 2000, 2006, 2001, 2003) also allowed the identification of intrinsic breast cancer subtypes (Nielsen et al., 2010; Parker et al., 2009). When applying the PAM50 gene signature to the KMP cohort, we again validated that ZNF217 mRNA expression levels are more discriminatory in the Luminal‐A subtype than in the Luminal‐B subtype (Supplementary Figure S9). Altogether, ZNF217 expression adds significant value to the molecular classification of breast cancers particularly for the Luminal‐A subtype, where ZNF217 expression differentiated between excellent and intermediate/poor Luminal‐A relapse‐free survivors.

3.6. Establishment of a novel immunohistochemistry (IHC) ZNF217 index that demonstrated an association with shorter RFS in Luminal‐A breast tumour samples

In order to assess the prognostic value of ZNF217 protein expression in the CRB1 cohort, an IHC ZNF217 index was established allowing the stratification of patients into two groups: patients with a high IHC ZNF217 index and patients with a low IHC ZNF217 index. We tested the IHC ZNF217 index with respect to RFS, and found that while the IHC ZNF217 index did not demonstrate any prognostic value in the entire cohort, a trend was found in the ER+ breast cancers (p = 0.08; Table 3). The low number of breast tumour samples belonging to the HER2‐enriched (n = 5) or Triple negative (n = 14) subclasses enabled the univariate analysis in these two subgroups. Interestingly, while the IHC ZNF217 index did not display any prognostic value in the Luminal‐B subgroup (p = 0.67; Table 3), it was significantly associated with shorter RFS in the Luminal‐A subgroup (p = 0.01; Figure 6H and Table 3). Indeed in the Luminal‐A subclass, 42% of patients whose tumours expressed high levels of ZNF217 relapsed before 12 years compared with 13% in low ZNF217 expressing tumours (Figure 6H). Overall, these data reveal for the first time that: (i) assessing ZNF217 protein levels by IHC demonstrates a prognostic value in relation to RFS in breast tumour samples when considering both nuclear and cytoplasmic ZNF217 stainings; (ii) the ZNF217 IHC index also allows the identification of intermediate/poor relapse‐free survivors in the Luminal‐A subgroup.

Table 3.

Univariate analysis of the IHC ZNF217 index in relation to relapse‐free survival (RFS) in different subclasses of the 162 breast cancer samples from the CRB1 cohort.

n RFS
HRa 95% CIb p c
All breast tumour samples 162 1.09 0.66–3.88 NS (0.30)
ER+ subclass 139 2.96 0.87–5.56 NS (0.08)
ER+/HER2− subclass 126 2.83 0.86–5.62 NS (0.09)
Luminal subclass (ER+ and/or PR+)d 142 2.69 0.84–5.31 NS (0.10)
Luminal‐A subclass (ER+ and/or PR+, HER2−, SBR1 or SBR2)d 97 6.03 1.21–12.02 0.01
Luminal‐B subclass (ER+ and/or PR+, HER2+ and/or SBR3)d 42 0.18 0.20–12.37 NS (0.67)
a

HR, Hazard ratio; n, Number of samples.

b

95% CI, 95% confidence interval.

c

p was considered significant when p < 0.05. NS, not significant.

d

subclasses of breast cancer were determined by using immunohistological (ER, PR, HER2) and SBR grading according to the St Gallen recommendation (Gnant et al., 2011; Goldhirsch et al., 2013, 2011).

3.7. High levels of ZNF217 expression in human ER+ primary breast cancer tumours are predictor of earlier relapse under endocrine therapy

The clinical relevance of ZNF217 mRNA levels was demonstrated in two independent ER+ breast cancer cohorts treated with Tam only, where high levels of ZNF217 mRNA (RTQ‐PCR) were prognostic for poor RFS (Figure 7A and 7B). Retrospective analysis of the gene‐expression array data from the GUYT2 cohort (n = 77, Loi et al., 2008) and the Chanrion's cohort (n = 147, Chanrion et al., 2008) again revealed that high levels of ZNF217 mRNA expression were significantly associated with shorter RFS in ER+ patients treated with Tam only (Supplementary Figure S10). Interestingly, a high IHC ZNF217 index was also associated with failure in endocrine therapy response in the ER+ breast tumours of the CRB1 cohort treated with endocrine therapy only (n = 46, p = 0.02, χ 2 test, Supplementary Table S6). Univariate analysis applied to these tumours also suggested that tumours with a low IHC ZNF217 index responded better to endocrine therapy compared with tumours with a high IHC ZNF217 index (p = 0.05; Figure 7C). Finally, in a pilot series of 17 patients with ER+ breast cancer that all relapsed before five years under Tam only (CRB3 cohort), a high IHC ZNF217 index was associated with a significantly earlier relapse than in tumours possessing a lower IHC ZNF217 index (p = 0.01; Figure 7D). Altogether, tumours that responded better to endocrine therapy treatment expressed less ZNF217 compared with non‐responsive tumours suggesting that ZNF217 could represent a new predictor of earlier relapse under endocrine therapy.

Figure 7.

Figure 7

High expression levels of ZNF217 are associated with shorter RFS in ER+ primary breast tumour patients treated with endocrine therapy only. Kaplan–Meier analyses of ZNF217 expression (log‐rank test) for RFS in ER+ primary breast tumour samples from patients treated with endocrine therapy alone are shown: (A) after RTQ‐PCR assays for the ZNF217 expression levels in the cohort from Vendrell and colleagues (Vendrell et al., 2008); (B) after RTQ‐PCR assays for the ZNF217 expression levels in the Huguenin cohort; (C) by applying the IHC ZNF217 index on the ER+ primary breast tumour samples of patients treated with endocrine therapy only in the CRB1 cohort; (D) by applying the IHC ZNF217 index on the primary breast tumour samples from the CRB3 cohort (patients with ER+ breast cancer who all relapsed under Tam only).

4. Discussion

The first main finding of our study is that a new interaction between ERα and ZNF217 exists both in ER+ breast cancer cell lines and in ER+ breast tumour samples. Our study highlights for the first time that ZNF217 is capable of enhancing ERα ligand‐dependent classical genomic activity, at least in part, by increasing the recruitment of ERα to its EREs. Strikingly, by focussing on the ER‐target gene GREB1, we validated at the endogenous level, that overexpression of ZNF217 is associated with significantly enhanced E2‐dependent binding and recruitment of ERα to the ERE present in the GREB1 promoter and significantly enhanced E2‐induced GREB1 transcription. GREB1 encodes a protein which acts as a growth promoter in breast and ovarian cancers (Laviolette et al., in press; Liu et al., 2012). We thus propose a model for ZNF217‐driven deleterious functions in ER+ breast cancer cells involving interference with and enhancement of ERα signalling, at least via the direct genomic activity of ERα. Several KLF proteins have been previously shown to modulate the ERα signalling pathway. In particular, KLF4, KLF5 and KLF9 are negative regulators of ligand‐dependent ERα signalling by inhibiting the recruitment of ER to the promoter of its target genes (Akaogi et al., 2009; Guo et al., 2010; Velarde et al., 2007). ZNF217 would thus be the first KLF protein described as a positive regulator of ERα signalling.

Unexpectedly, this study also found that ZNF217 protein localises in both the nuclear and cytoplasmic cellular compartments, as demonstrated by IHC, the subcellular fractionation assay and PLA studies. In previous studies, ZNF217 has been predominantly described as being located in the nucleus (Banck et al., 2009; Collins et al., 2001), which is in accordance with its known transcriptional regulatory activity, but the cellular localisation of ZNF217 may also depend on the proliferation status of the cells: nuclear in stationary or senescent cells and cytoplasmic in proliferating cells (Li et al., 2007). Our data thus suggest that ZNF217 may also possess unknown cytoplasmic functions. Interestingly, besides the ERα nuclear fraction involved in the genomic activity of ERα, the cytoplasmic existence of a methylated ERα pool has recently been described to be involved in the activation of the estrogen non‐genomic pathway (Le Romancer et al., 2010; Poulard et al., 2012). Future work is thus needed to investigate whether the cytoplasmic ERα/ZNF217 complexes identified by our study also involve methylated ERα/ZNF217 complexes.

Our work highlights that the hinge region of ERα and the C‐terminus region of ZNF217 are involved in the ERα/ZNF217 interaction. The C‐terminus region of ZNF217 is known to be involved in the ZNF217 negative regulation of transcription (Cowger et al., 2007; Quinlan et al., 2006) but also contains a proline‐rich transcription activation domain (Collins et al., 1998) of which the function has not yet been deciphered. Interestingly, a protein belonging to a new family of prolin‐rich co‐activators has been reported to be involved in the binding to ERα and in the enhancement of the E2‐dependent ERα transcriptional activity (Zhou et al., 2006). Regarding the hinge domain of ERα, it has previously been shown that the molecular events targeting this domain such as mutations, post‐translational modifications or interactions with other proteins, modulate the transcriptional activity and/or DNA binding of ERα. Indeed, mutations that prevent SUMO modification in the hinge region of ERα impairs ERα‐induced transcription (Sentis et al., 2005). Methylation at K302 is necessary for the efficient recruitment of ERα to its target genes and for their transactivation (Subramanian et al., 2008). K303R ERα mutants have demonstrated increased occupancy time on the promoter of the ERα‐target gene and increased binding to co‐activators (Herynk et al., 2010). The S305 ERα mutant, which mimicks the phosphorylation by PKA, has been shown to increase fixation to promoters of the target genes in the presence of estrogen (Tharakan et al., 2008). ERα transactivation is impaired in the presence of inhibitors of calmodulin, a protein that binds to the hinge region of ERα (Garcia Pedrero et al., 2002). Cyclin D1, which competes with BRCA1 for ERα binding within the hinge domain, enhances ERα recruitment to its ERE and leads to increased ERα transcriptional activity (Wang et al., 2005). Recently, the SUMO protease SENP2 and the IQGAP1 protein have been shown to both interact with the ERα hinge region and to modulate ERα transcriptional function and/or ERα signaling (Erdemir et al., 2014; Nait Achour et al., 2014). Altogether, our study provides evidence that ZNF217 is a new interacting and functional partner of the ERα hinge region and future work is necessary to decipher whether ZNF217‐mediated enhanced ERα transcriptional activity involves direct mechanisms or indirect events such as the prevention of the binding of other proteins or prevention of post‐translational modifications of this ERα domain.

Having demonstrated in vitro the existence of a functional interplay between ZNF217 and ERα leading to the enhancement of the ERα signaling, we aimed at investigating the clinical relevance of our finding by focussing on ZNF217 in the ER+/luminal context of breast tumours. The second main finding of this study is that high levels of ZNF217 mRNA are expressed in the ER+ context of breast cancers and that the prognostic power of ZNF217 mRNA expression levels is most discriminatory in ER+ breast cancer subpopulations, i.e. in ER+, ER+/HER2−, Luminal and Luminal‐A breast cancer subclasses. Remarkably, ZNF217 expression levels were lower in ER− samples and did not display any prognostic value for RFS in HER2‐enriched or Triple‐negative breast cancer subtypes. To our knowledge, this is the first study that has compared the prognostic value of ZNF217 mRNA expression levels in the molecular classification of breast cancers. ZNF217 thus allows the re‐stratification of patients with ER+/Luminal breast cancers which are considered to be cancers with a good prognosis where no other biomarkers are currently available and widely used. In breast tumours, amplification at the ZNF217 locus has been reported (for review, Quinlan et al., 2007), but ZNF217 amplification did not demonstrate any correlation/association with ER status (Letessier et al., 2006; Plevova et al., 2010), nor with PR‐positive status in breast cancers (Letessier et al., 2006; Plevova et al., 2010). Therefore, the expression levels and prognostic value of ZNF217 mRNA levels in ER+/Luminal breast tumours is more likely not to be attributable to any amplification at the ZNF217 locus, and most likely more informative than investigating ZNF217 amplification only. Our work also describes for the first time a new IHC ZNF217 index based both on cytoplasmic and nuclear staining that was demonstrated to display a prognostic value in luminal‐A breast cancers. Remarkably, a previous study which investigated ZNF217 in ovarian carcinoma using IHC nuclear staining only did not reveal any association with poor prognosis in relation to progression‐free survival (Rahman et al., 2011), again supporting the importance of considering all ZNF217‐positive sub‐cellular fractions.

Strikingly, our data also highlights that the prognostic power of ZNF217 mRNA or protein expression levels are most discriminatory in the Luminal‐A subtype compared with the Luminal‐B subtype. In the Luminal‐A subtype which is considered to have the most favourable prognosis, ZNF217 thus may help in the identification of patients with an excellent outcome that would benefit from endocrine therapy only. Conversely, high expression levels of ZNF217 may be used to direct treatments towards the intermediate/poor relapse‐free survivors in the Luminal‐A subtype (e.g. chemotherapy in addition to hormone therapy). The Luminal‐A subtype is also known to exhibit a higher expression of the ESR1 gene, ERα and ER‐related genes and also a lower expression of proliferative genes and a lower proliferative index (low Ki67 or SBR1‐2) compared with the Luminal‐B subtype (Brenton et al., 2005, 2011, 2013, 2011, 2001, 2003). Overall, these data suggest that the prognostic value of ZNF217 is most powerful in the breast tumour subtype where ERα expression and ERα signalling are more prominent, which may reflect the impact of ZNF217 in modulating existing active ERα signalling, as deciphered by our in vitro studies.

The importance of the interplay between ZNF217 and ER signalling is also supported by the observation that deregulated expression of ZNF217 is associated in vitro with altered responses to endocrine therapy and that in ER+ breast tumours, ZNF217 expression levels (mRNA or IHC ZNF217 index) are predictors of earlier relapse under endocrine therapy. We suggest that ZNF217 physically bound to ERα leads to an altered response to the Selective Estrogen Receptor Modulator OH‐Tam, or that, in the presence of high levels of ZNF217 expression, the ZNF217‐enhanced estrogen signalling may overcome the anti‐estrogenic action of OH‐Tam. As our study also highlights that overexpression of ZNF217 in ER+ breast cancer cells triggers cancer stem cell (CSC) enrichment (mammosphere formation), and as CSC have been recently associated with endocrine therapy resistance (Gilani et al., 2012; Vilquin et al., 2013), we cannot exclude that the selection/emergence of such a cell subpopulation under ZNF217 overexpression could also be part of the molecular mechanisms involved in ZNF217‐induced resistance to endocrine therapy.

5. Conclusions

Overall, our new findings have important medical applications: (i) among the ZNF217‐driven mechanisms which lead to aggressiveness in breast cancer the ZNF217/ERα interplay is one of the mechanisms specifically developed by ZNF217 in the luminal context; (ii) high expression levels of ZNF217 in ER+/luminal breast cancer samples are associated with altered estrogen signalling and altered endocrine therapy responses; (iii) ZNF217 physically binds to ERα both in vitro and in vivo and enhances the ligand‐dependent driven direct genomic activity of ERα; (iv) ZNF217 expression levels add significant value to the molecular classification of breast cancers especially for the Luminal‐A subtype, where ZNF217 expression differentiated between excellent and intermediate/poor Luminal‐A relapse‐free survivors; (v) ZNF217 is predictor of earlier relapse under endocrine therapy.

ZNF217 mRNA or protein‐expression levels in ER+ breast tumours are thus informative and provide a novel and powerful biomarker that could aid clinicians in their therapeutic decisions. Finally, clinical strategies to counteract ZNF217‐mediated effects represent a potentially valuable approach to the management of ER+ breast cancers that express high levels of ZNF217.

Conflict of interest

The authors declare that they have no conflict of interest.

Supporting information

The following is the supplementary data related to this article:

Supplementary data

Acknowledgements

We would like to thank the Centers of Ressources Biologiques from the Centre Léon Bérard and the Centre René Huguenin. We would also like to thank A. Colombe for technical support and Dr. Kabani and AngloScribe for edition. This work was supported by PRES/Lyon Science Transfert (LST607, Université Lyon 1), the Cancéropôle Lyon Auvergne Rhône‐Alpes (CLARA, Grant 2012/Oncostarter), the Department of the Rhône (Bernardin Award) and the Ligue Nationale Contre le Cancer (Comité 69). Nhan T. Nguyen was supported by the USTH PhD fellowship program, the Rhône‐Alpes region (CMIRA grant) and the CLARA.

Supplementary data 1.

1.1.

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.molonc.2014.05.013.

Nguyen Nhan T., Vendrell Julie A., Poulard Coralie, Győrffy Balázs, Goddard-Léon Sophie, Bièche Ivan, Corbo Laura, Le Romancer Muriel, Bachelot Thomas, Treilleux Isabelle, Cohen Pascale A., (2014), A functional interplay between ZNF217 and Estrogen Receptor alpha exists in luminal breast cancers, Molecular Oncology, 8, doi: 10.1016/j.molonc.2014.05.013.

References

  1. Akaogi, K. , Nakajima, Y. , Ito, I. , Kawasaki, S. , Oie, S.H. , Murayama, A. , Kimura, K. , Yanagisawa, J. , 2009. KLF4 suppresses estrogen-dependent breast cancer growth by inhibiting the transcriptional activity of ERalpha. Oncogene. 28, 2894–2902. [DOI] [PubMed] [Google Scholar]
  2. Badia, E. , Duchesne, M.J. , Semlali, A. , Fuentes, M. , Giamarchi, C. , Richard-Foy, H. , Nicolas, J.C. , Pons, M. , 2000. Long-term hydroxytamoxifen treatment of an MCF-7-derived breast cancer cell line irreversibly inhibits the expression of estrogenic genes through chromatin remodeling. Cancer Res. 60, 4130–4138. [PubMed] [Google Scholar]
  3. Banck, M.S. , Li, S. , Nishio, H. , Wang, C. , Beutler, A.S. , Walsh, M.J. , 2009. The ZNF217 oncogene is a candidate organizer of repressive histone modifiers. Epigenetics. 4, 100–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brenton, J.D. , Carey, L.A. , Ahmed, A.A. , Caldas, C. , 2005. Molecular classification and molecular forecasting of breast cancer: ready for clinical application?. J. Clin. Oncol. 23, 7350–7360. [DOI] [PubMed] [Google Scholar]
  5. Burstein, H.J. , Prestrud, A.A. , Seidenfeld, J. , Anderson, H. , Buchholz, T.A. , Davidson, N.E. , Gelmon, K.E. , Giordano, S.H. , Hudis, C.A. , Malin, J. , 2010. American Society of Clinical Oncology clinical practice guideline: update on adjuvant endocrine therapy for women with hormone receptor-positive breast cancer. J. Clin. Oncol. 28, 3784–3796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chanrion, M. , Negre, V. , Fontaine, H. , Salvetat, N. , Bibeau, F. , Mac Grogan, G. , Mauriac, L. , Katsaros, D. , Molina, F. , Theillet, C. , 2008. A gene expression signature that can predict the recurrence of tamoxifen-treated primary breast cancer. Clin. Cancer Res. 14, 1744–1752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Collins, C. , Rommens, J.M. , Kowbel, D. , Godfrey, T. , Tanner, M. , Hwang, S.I. , Polikoff, D. , Nonet, G. , Cochran, J. , Myambo, K. , 1998. Positional cloning of ZNF217 and NABC1: genes amplified at 20q13.2 and overexpressed in breast carcinoma. Proc. Natl. Acad. Sci. USA. 95, 8703–8708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Collins, C. , Volik, S. , Kowbel, D. , Ginzinger, D. , Ylstra, B. , Cloutier, T. , Hawkins, T. , Predki, P. , Martin, C. , Wernick, M. , 2001. Comprehensive genome sequence analysis of a breast cancer amplicon. Genome Res. 11, 1034–1042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cowger, J.J. , Zhao, Q. , Isovic, M. , Torchia, J. , 2007. Biochemical characterization of the zinc-finger protein 217 transcriptional repressor complex: identification of a ZNF217 consensus recognition sequence. Oncogene. 26, 3378–3386. [DOI] [PubMed] [Google Scholar]
  10. Cuzick, J. , Dowsett, M. , Pineda, S. , Wale, C. , Salter, J. , Quinn, E. , Zabaglo, L. , Mallon, E. , Green, A.R. , Ellis, I.O. , 2011. Prognostic value of a combined estrogen receptor, progesterone receptor, Ki-67, and human epidermal growth factor receptor 2 immunohistochemical score and comparison with the Genomic Health recurrence score in early breast cancer. J. Clin. Oncol. 29, 4273–4278. [DOI] [PubMed] [Google Scholar]
  11. Dontu, G. , Abdallah, W.M. , Foley, J.M. , Jackson, K.W. , Clarke, M.F. , Kawamura, M.J. , Wicha, M.S. , 2003. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253–1270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dunkler, D. , Michiels, S. , Schemper, M. , 2007. Gene expression profiling: does it add predictive accuracy to clinical characteristics in cancer prognosis?. Eur. J. Cancer. 43, 745–751. [DOI] [PubMed] [Google Scholar]
  13. Erdemir, H.H. , Li, Z. , Sacks, D.B. , 2014. IQGAP1 binds to estrogen receptor-alpha and modulates its function. J. Biol. Chem. 289, 9100–9112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Garcia Pedrero, J.M. , Del Rio, B. , Martinez-Campa, C. , Muramatsu, M. , Lazo, P.S. , Ramos, S. , 2002. Calmodulin is a selective modulator of estrogen receptors. Mol. Endocrinol. 16, 947–960. [DOI] [PubMed] [Google Scholar]
  15. Ghayad, S.E. , Vendrell, J.A. , Ben Larbi, S. , Dumontet, C. , Bieche, I. , Cohen, P.A. , 2010. Endocrine resistance associated with activated ErbB system in breast cancer cells is reversed by inhibiting MAPK or PI3K/Akt signaling pathways. Int. J. Cancer. 126, 545–562. [DOI] [PubMed] [Google Scholar]
  16. Gilani, R.A. , Kazi, A.A. , Shah, P. , Schech, A.J. , Chumsri, S. , Sabnis, G. , Jaiswal, A.K. , Brodie, A.H. , 2012. The importance of HER2 signaling in the tumor-initiating cell population in aromatase inhibitor-resistant breast cancer. Breast Cancer Res. Treat. 135, 681–692. [DOI] [PubMed] [Google Scholar]
  17. Gnant, M. , Harbeck, N. , Thomssen, C. , 2011. St. Gallen 2011: summary of the consensus discussion. Breast Care (Basel). 6, 136–141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Goldhirsch, A. , Winer, E.P. , Coates, A.S. , Gelber, R.D. , Piccart-Gebhart, M. , Thurlimann, B. , Senn, H.J. , 2013. Personalizing the treatment of women with early breast cancer: highlights of the St Gallen International Expert Consensus on the Primary Therapy of Early Breast Cancer 2013. Ann. Oncol. 24, 2206–2223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Goldhirsch, A. , Wood, W.C. , Coates, A.S. , Gelber, R.D. , Thurlimann, B. , Senn, H.J. , 2011. Strategies for subtypes–dealing with the diversity of breast cancer: highlights of the St. Gallen International Expert Consensus on the Primary Therapy of Early Breast Cancer 2011. Ann. Oncol. 22, 1736–1747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Guiu, S. , Michiels, S. , Andre, F. , Cortes, J. , Denkert, C. , Di Leo, A. , Hennessy, B.T. , Sorlie, T. , Sotiriou, C. , Turner, N. , 2012. Molecular subclasses of breast cancer: how do we define them? The IMPAKT 2012 Working Group Statement. Ann. Oncol. 23, 2997–3006. [DOI] [PubMed] [Google Scholar]
  21. Guo, P. , Dong, X.Y. , Zhao, K.W. , Sun, X. , Li, Q. , Dong, J.T. , 2010. Estrogen-induced interaction between KLF5 and estrogen receptor (ER) suppresses the function of ER in ER-positive breast cancer cells. Int. J. Cancer. 126, 81–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gyorffy, B. , Benke, Z. , Lanczky, A. , Balazs, B. , Szallasi, Z. , Timar, J. , Schafer, R. , 2012. RecurrenceOnline: an online analysis tool to determine breast cancer recurrence and hormone receptor status using microarray data. Breast Cancer Res. Treat. 132, 1025–1034. [DOI] [PubMed] [Google Scholar]
  23. Gyorffy, B. , Schafer, R. , 2009. Meta-analysis of gene expression profiles related to relapse-free survival in 1,079 breast cancer patients. Breast Cancer Res. Treat. 118, 433–441. [DOI] [PubMed] [Google Scholar]
  24. Herynk, M.H. , Hopp, T. , Cui, Y. , Niu, A. , Corona-Rodriguez, A. , Fuqua, S.A. , 2010. A hypersensitive estrogen receptor alpha mutation that alters dynamic protein interactions. Breast Cancer Res. Treat. 122, 381–393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hu, Z. , Fan, C. , Oh, D.S. , Marron, J.S. , He, X. , Qaqish, B.F. , Livasy, C. , Carey, L.A. , Reynolds, E. , Dressler, L. , 2006. The molecular portraits of breast tumors are conserved across microarray platforms. BMC Genomics. 7, 96 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Huang, G. , Krig, S. , Kowbel, D. , Xu, H. , Hyun, B. , Volik, S. , Feuerstein, B. , Mills, G.B. , Stokoe, D. , Yaswen, P. , 2005. ZNF217 suppresses cell death associated with chemotherapy and telomere dysfunction. Hum. Mol. Genet. 14, 3219–3225. [DOI] [PubMed] [Google Scholar]
  27. Krig, S.R. , Jin, V.X. , Bieda, M.C. , O'Geen, H. , Yaswen, P. , Green, R. , Farnham, P.J. , 2007. Identification of genes directly regulated by the oncogene ZNF217 using chromatin immunoprecipitation (ChIP)-chip assays. J. Biol. Chem. 282, 9703–9712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Krig, S.R. , Miller, J.K. , Frietze, S. , Beckett, L.A. , Neve, R.M. , Farnham, P.J. , Yaswen, P.I. , Sweeney, C.A. , 2010. ZNF217, a candidate breast cancer oncogene amplified at 20q13, regulates expression of the ErbB3 receptor tyrosine kinase in breast cancer cells. Oncogene. 29, 5500–5510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Laviolette, L.A. , Hodgkinson, K.M. , Minhas, N. , Perez-Iratxeta, C. , Vanderhyden, B.C. , 2014. 17beta-estradiol upregulates GREB1 and accelerates ovarian tumour progression in vivo. Int. J. Cancer. (in press) [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Le Romancer, M. , Treilleux, I. , Bouchekioua-Bouzaghou, K. , Sentis, S. , Corbo, L. , 2010. Methylation, a key step for nongenomic estrogen signaling in breast tumors. Steroids. 75, 560–564. [DOI] [PubMed] [Google Scholar]
  31. Letessier, A. , Sircoulomb, F. , Ginestier, C. , Cervera, N. , Monville, F. , Gelsi-Boyer, V. , Esterni, B. , Geneix, J. , Finetti, P. , Zemmour, C. , 2006. Frequency, prognostic impact, and subtype association of 8p12, 8q24, 11q13, 12p13, 17q12, and 20q13 amplifications in breast cancers. BMC Cancer. 6, 245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Li, P. , Maines-Bandiera, S. , Kuo, W.L. , Guan, Y. , Sun, Y. , Hills, M. , Huang, G. , Collins, C.C. , Leung, P.C. , Gray, J.W. , 2007. Multiple roles of the candidate oncogene ZNF217 in ovarian epithelial neoplastic progression. Int. J. Cancer. 120, 1863–1873. [DOI] [PubMed] [Google Scholar]
  33. Littlepage, L.E. , Adler, A.S. , Kouros-Mehr, H. , Huang, G. , Chou, J. , Krig, S.R. , Griffith, O.L. , Korkola, J.E. , Qu, K. , Lawson, D.A. , 2012. The transcription factor ZNF217 is a prognostic biomarker and therapeutic target during breast cancer progression. Cancer Discov. 2, 638–651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Liu, M. , Wang, G. , Gomez-Fernandez, C.R. , Guo, S. , 2012. GREB1 functions as a growth promoter and is modulated by IL6/STAT3 in breast cancer. PLoS One. 7, e46410 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  35. Loi, S. , Haibe-Kains, B. , Desmedt, C. , Wirapati, P. , Lallemand, F. , Tutt, A.M. , Gillet, C. , Ellis, P. , Ryder, K. , Reid, J.F. , 2008. Predicting prognosis using molecular profiling in estrogen receptor-positive breast cancer treated with tamoxifen. BMC Genomics. 9, 239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Nait Achour, T. , Sentis, S. , Teyssier, C. , Philippat, A. , Lucas, A. , Corbo, L. , Cavailles, V. , Jalaguier, S. , 2014. Transcriptional repression of estrogen receptor alpha signaling by SENP2 in breast cancer cells. Mol. Endocrinol. 28, 183–196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Nielsen, T.O. , Parker, J.S. , Leung, S. , Voduc, D. , Ebbert, M. , Vickery, T. , Davies, S.R. , Snider, J. , Stijleman, I.J. , Reed, J. , 2010. A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor-positive breast cancer. Clin. Cancer Res. 16, 5222–5232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Nonet, G.H. , Stampfer, M.R. , Chin, K. , Gray, J.W. , Collins, C.C. , Yaswen, P. , 2001. The ZNF217 gene amplified in breast cancers promotes immortalization of human mammary epithelial cells. Cancer Res. 61, 1250–1254. [PubMed] [Google Scholar]
  39. Parker, J.S. , Mullins, M. , Cheang, M.C. , Leung, S. , Voduc, D. , Vickery, T. , Davies, S. , Fauron, C. , He, X. , Hu, Z. , 2009. Supervised risk predictor of breast cancer based on intrinsic subtypes. J. Clin. Oncol. 27, 1160–1167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Perou, C.M. , Sorlie, T. , Eisen, M.B. , van de Rijn, M. , Jeffrey, S.S. , Rees, C.A. , Pollack, J.R. , Ross, D.T. , Johnsen, H. , Akslen, L.A. , 2000. Molecular portraits of human breast tumours. Nature. 406, 747–752. [DOI] [PubMed] [Google Scholar]
  41. Perreard, L. , Fan, C. , Quackenbush, J.F. , Mullins, M. , Gauthier, N.P. , Nelson, E. , Mone, M. , Hansen, H. , Buys, S.S. , Rasmussen, K. , 2006. Classification and risk stratification of invasive breast carcinomas using a real-time quantitative RT-PCR assay. Breast Cancer Res. 8, R23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Pike, M.C. , Spicer, D.V. , Dahmoush, L. , Press, M.F. , 1993. Estrogens, progestogens, normal breast cell proliferation, and breast cancer risk. Epidemiol. Rev. 15, 17–35. [DOI] [PubMed] [Google Scholar]
  43. Plevova, P. , Cerna, D. , Balcar, A. , Foretova, L. , Zapletalova, J. , Silhanova, E. , Curik, R. , Dvorackova, J. , 2010. CCND1 and ZNF217 gene amplification is equally frequent in BRCA1 and BRCA2 associated and non-BRCA breast cancer. Neoplasma. 57, 325–332. [DOI] [PubMed] [Google Scholar]
  44. Poulard, C. , Treilleux, I. , Lavergne, E. , Bouchekioua-Bouzaghou, K. , Goddard-Leon, S. , Chabaud, S. , Tredan, O. , Corbo, L. , Le Romancer, M. , 2012. Activation of rapid oestrogen signalling in aggressive human breast cancers. EMBO Mol. Med. 4, 1200–1213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Quinlan, K.G. , Nardini, M. , Verger, A. , Francescato, P. , Yaswen, P. , Corda, D. , Bolognesi, M. , Crossley, M. , 2006. Specific recognition of ZNF217 and other zinc finger proteins at a surface groove of C-terminal binding proteins. Mol. Cell Biol. 26, 8159–8172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Quinlan, K.G. , Verger, A. , Yaswen, P. , Crossley, M. , 2007. Amplification of zinc finger gene 217 (ZNF217) and cancer: when good fingers go bad. Biochim. Biophys. Acta. 1775, 333–340. [DOI] [PubMed] [Google Scholar]
  47. Rahman, M.T. , Nakayama, K. , Rahman, M. , Nakayama, N. , Ishikawa, M. , Katagiri, A. , Iida, K. , Nakayama, S. , Otsuki, Y. , Shih Ie, M. , 2011. Prognostic and therapeutic impact of the chromosome 20q13.2 ZNF217 locus amplification in ovarian clear cell carcinoma. Cancer. 118, 2846–2857. [DOI] [PubMed] [Google Scholar]
  48. Saceda, M. , Lippman, M.E. , Chambon, P. , Lindsey, R.L. , Ponglikitmongkol, M. , Puente, M. , Martin, M.B. , 1988. Regulation of the estrogen receptor in MCF-7 cells by estradiol. Mol. Endocrinol. 2, 1157–1162. [DOI] [PubMed] [Google Scholar]
  49. Sentis, S. , Le Romancer, M. , Bianchin, C. , Rostan, M.C. , Corbo, L. , 2005. Sumoylation of the estrogen receptor alpha hinge region regulates its transcriptional activity. Mol. Endocrinol. 19, 2671–2684. [DOI] [PubMed] [Google Scholar]
  50. Sorlie, T. , Perou, C.M. , Tibshirani, R. , Aas, T. , Geisler, S. , Johnsen, H. , Hastie, T. , Eisen, M.B. , van de Rijn, M. , Jeffrey, S.S. , 2001. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad. Sci. USA. 98, 10869–10874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Sorlie, T. , Tibshirani, R. , Parker, J. , Hastie, T. , Marron, J.S. , Nobel, A. , Deng, S. , Johnsen, H. , Pesich, R. , Geisler, S. , 2003. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc. Natl. Acad. Sci. USA. 100, 8418–8423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Stephenson, J.R. , Axelrad, A.A. , McLeod, D.L. , Shreeve, M.M. , 1971. Induction of colonies of hemoglobin-synthesizing cells by erythropoietin in vitro. Proc. Natl. Acad. Sci. USA. 68, 1542–1546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Subramanian, K. , Jia, D. , Kapoor-Vazirani, P. , Powell, D.R. , Collins, R.E. , Sharma, D. , Peng, J. , Cheng, X. , Vertino, P.M. , 2008. Regulation of estrogen receptor alpha by the SET7 lysine methyltransferase. Mol. Cell. 30, 336–347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sun, J. , Nawaz, Z. , Slingerland, J.M. , 2007. Long-range activation of GREB1 by estrogen receptor via three distal consensus estrogen-responsive elements in breast cancer cells. Mol. Endocrinol. 21, 2651–2662. [DOI] [PubMed] [Google Scholar]
  55. Tharakan, R. , Lepont, P. , Singleton, D. , Kumar, R. , Khan, S. , 2008. Phosphorylation of estrogen receptor alpha, serine residue 305 enhances activity. Mol. Cell Endocrinol. 295, 70–78. [DOI] [PubMed] [Google Scholar]
  56. Thillainadesan, G. , Isovic, M. , Loney, E. , Andrews, J. , Tini, M. , Torchia, J. , 2008. Genome analysis identifies the p15ink4b tumor suppressor as a direct target of the ZNF217/CoREST complex. Mol. Cell Biol. 28, 6066–6077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Thollet, A. , Vendrell, J.A. , Payen, L. , Ghayad, S.E. , Ben Larbi, S. , Grisard, E. , Collins, C. , Villedieu, M. , Cohen, P.A. , 2010. ZNF217 confers resistance to the pro-apoptotic signals of paclitaxel and aberrant expression of Aurora-A in breast cancer cells. Mol. Cancer. 9, 291 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Velarde, M.C. , Zeng, Z. , McQuown, J.R. , Simmen, F.A. , Simmen, R.C. , 2007. Kruppel-like factor 9 is a negative regulator of ligand-dependent estrogen receptor alpha signaling in Ishikawa endometrial adenocarcinoma cells. Mol. Endocrinol. 21, 2988–3001. [DOI] [PubMed] [Google Scholar]
  59. Vendrell, J.A. , Bieche, I. , Desmetz, C. , Badia, E. , Tozlu, S. , Nguyen, C. , Nicolas, J.C. , Lidereau, R. , Cohen, P.A. , 2005. Molecular changes associated with the agonist activity of hydroxy-tamoxifen and the hyper-response to estradiol in hydroxy-tamoxifen-resistant breast cancer cell lines. Endocr. Relat. Cancer. 12, 75–92. [DOI] [PubMed] [Google Scholar]
  60. Vendrell, J.A. , Ghayad, S. , Ben-Larbi, S. , Dumontet, C. , Mechti, N. , Cohen, P.A. , 2007. A20/TNFAIP3, a new estrogen-regulated gene that confers tamoxifen resistance in breast cancer cells. Oncogene. 26, 4656–4667. [DOI] [PubMed] [Google Scholar]
  61. Vendrell, J.A. , Magnino, F. , Danis, E. , Duchesne, M.J. , Pinloche, S. , Pons, M. , Birnbaum, D. , Nguyen, C. , Theillet, C. , Cohen, P.A. , 2004. Estrogen regulation in human breast cancer cells of new downstream gene targets involved in estrogen metabolism, cell proliferation and cell transformation. J. Mol. Endocrinol. 32, 397–414. [DOI] [PubMed] [Google Scholar]
  62. Vendrell, J.A. , Robertson, K.E. , Ravel, P. , Bray, S.E. , Bajard, A. , Purdie, C.A. , Nguyen, C. , Hadad, S.M. , Bieche, I. , Chabaud, S. , 2008. A candidate molecular signature associated with tamoxifen failure in primary breast cancer. Breast Cancer Res. 10, R88 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Vendrell, J.A. , Thollet, A. , Nguyen, N.T. , Ghayad, S.E. , Vinot, S. , Bieche, I. , Grisard, E. , Josserand, V. , Coll, J.L. , Roux, P. , 2012. ZNF217 is a marker of poor prognosis in breast cancer that drives epithelial-mesenchymal transition and invasion. Cancer Res. 72, 3593–3606. [DOI] [PubMed] [Google Scholar]
  64. Vilquin, P. , Villedieu, M. , Grisard, E. , Larbi, S.B. , Ghayad, S.E. , Heudel, P.E. , Bachelot, T. , Corbo, L. , Treilleux, I. , Vendrell, J.A. , 2013. Molecular characterization of anastrozole resistance in breast cancer: pivotal role of the Akt/mTOR pathway in the emergence of de novo or acquired resistance and importance of combining the allosteric Akt inhibitor MK-2206 with an aromatase inhibitor. Int. J. Cancer. 133, (7) 1589–1602. [DOI] [PubMed] [Google Scholar]
  65. Wang, C. , Fan, S. , Li, Z. , Fu, M. , Rao, M. , Ma, Y. , Lisanti, M.P. , Albanese, C. , Katzenellenbogen, B.S. , Kushner, P.J. , 2005. Cyclin D1 antagonizes BRCA1 repression of estrogen receptor alpha activity. Cancer Res. 65, 6557–6567. [DOI] [PubMed] [Google Scholar]
  66. Zhou, D. , Ye, J.J. , Li, Y. , Lui, K. , Chen, S. , 2006. The molecular basis of the interaction between the proline-rich SH3-binding motif of PNRC and estrogen receptor alpha. Nucleic Acids Res. 34, 5974–5986. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

The following is the supplementary data related to this article:

Supplementary data


Articles from Molecular Oncology are provided here courtesy of Wiley

RESOURCES