Skip to main content
Molecular Oncology logoLink to Molecular Oncology
. 2014 Feb 14;8(3):704–716. doi: 10.1016/j.molonc.2014.02.001

CPSF4 activates telomerase reverse transcriptase and predicts poor prognosis in human lung adenocarcinomas

Wangbing Chen 1,†, Lijun Qin 2,†, Shusen Wang 1,✉, Mei Li 1, Dingbo Shi 1, Yun Tian 1, Jingshu Wang 1, Lingyi Fu 1, Zhenglin Li 3, Wei Guo 3, Wendan Yu 3, Yuhui Yuan 3, Tiebang Kang 1, Wenlin Huang 1,4,✉, Wuguo Deng 1,4,✉
PMCID: PMC5528626  PMID: 24618080

Abstract

The elevated expression and activation of human telomerase reverse transcriptase (hTERT) is associated with the unlimited proliferation of cancer cells. However, the excise mechanism of hTERT regulation during carcinogenesis is not well understood. In this study, we discovered cleavage and polyadenylation specific factor 4 (CPSF4) as a novel tumor‐specific hTERT promoter‐regulating protein in lung cancer cells and identified the roles of CPSF4 in regulating lung hTERT and lung cancer growth. The ectopic overexpression of CPSF4 upregulated the hTERT promoter‐driven report gene expression and activated the endogenous hTERT mRNA and protein expression and the telomerase activity in lung cancer cells and normal lung cells. In contrast, the knockdown of CPSF4 by siRNA had the opposite effects. CPSF4 knockdown also significantly inhibited tumor cell growth in lung cancer cells in vitro and in a xenograft mouse model in vivo, and this inhibitory effect was partially mediated by decreasing the expression of hTERT. High expression of both CPSF4 and hTERT proteins were detected in lung adenocarcinoma cells by comparison with the normal lung cells. Tissue microarray immunohistochemical analysis of lung adenocarcinomas also revealed a strong positive correlation between the expression of CPSF4 and hTERT proteins. Moreover, Kaplan‐Meier analysis showed that patients with high levels of CPSF4 and hTERT expression had a significantly shorter overall survival than those with low CPSF4 and hTERT expression levels. Collectively, these results demonstrate that CPSF4 plays a critical role in the regulation of hTERT expression and lung tumorigenesis and may be a new prognosis factor in lung adenocarcinomas.

Keywords: CPSF4, Telomerase, hTERT, Promoter, Lung cancer

Highlights

  • We discover and identify CPSF4 as a novel hTERT promoter‐regulating factor in lung cancer cells.

  • CPSF4 upregulates hTERT promoter activity, hTERT expression and telomerase activity.

  • Knockdown of CPSF4 inhibits lung cancer growth by downregulating hTERT expression and activity.

  • CPSF4 and hTERT are highly expressed in lung cancer cells and adenocarcinoma tumor tissues.

  • CPSF4 and hTERT overexpression is associated with poor progonsis in lung adenocarcinoma patient.

1. Introduction

Telomerase activation and the maintenance of telomeres are critical steps in the unlimited proliferation of cancer cells. Telomeres are composed of tandem repeat arrays of TTAGGG nucleotide DNA sequences and serve as protective “caps” at the ends of human chromosomes, protecting them from DNA degradation and unwanted repair (Blackburn, 2005; Blackburn et al., 2006; Harley, 2008; Tian et al., 2010). In normal somatic cells, telomeres are progressively lost at each cell division due to the inability of the linear DNA replication machinery to replicate the telomere ends; this phenomenon leads to the loss of approximately 50–200 bp of telomeric DNA in each cell division cycle (Chiu and Harley, 1997; Liu, 1999). The loss of telomeres beyond a critical length can elicit DNA‐damage responses, activate cell cycle check points and lead to cell senescence and apoptosis (Saretzki et al., 1999). Thus, the progressive loss of the terminal nucleotides of chromosomes with each cell division limits the replicative capacity of eukaryotic cells. However, cancer cells can activate telomere maintenance mechanisms (TMMs) to overcome this limitation and are thus able to proliferate indefinitely (Colgin and Reddel, 1999). Telomerase is a reverse transcriptase that adds telomeric repeats to chromosomal ends; the addition of telomere repeats is the most thoroughly studied TMM (Bryan and Cech, 1999). Telomerase‐independent mechanisms, which are referred to as alternative lengthening of telomeres, may also maintain the length of telomeres in cancer cells (Bryan et al., 1997).

Telomerase is a ribonucleoprotein enzyme consisting of human telomerase RNA (hTR), telomerase‐associated protein 1 (TEP1) and human telomerase reverse transcriptase (hTERT), the catalytic unit (Cohen et al., 2007; Feng et al., 1995; Nakamura et al., 1997; Weinrich et al., 1997). Telomerase activity is often directly correlated with the uncontrolled growth of cells, which is an established hallmark of cancer (Harley, 2008; Shay and Keith, 2008). Telomerase (specifically its catalytic subunit hTERT) is overactive in 85–90% of cancers but is present at very low or almost undetectable levels in normal cells (Bisoffi et al., 2006; Ruden and Puri, 2013). hTERT is a major oncoprotein involved in aberrant cell proliferation, immortalization, metastasis and the maintenance of stemness in the majority of tumors (Lu et al., 2012). The overexpression of hTERT in cancer cells can be achieved by gene amplification (Zhang et al., 2000), but most studies have focused on the transcriptional regulation of hTERT expression. The transcriptional activity of the hTERT promoter is selectively up‐regulated in tumors but silent in most normal cells (Ducrest et al., 2002; Takakura et al., 1999). This observation is largely attributed to several key transcription factors in tumor cells that can up‐regulate hTERT transcription (Kyo et al., 2008). However, the factors that have been identified so far do not completely account for the cancer‐specific expression of hTERT. To identify these potentially critical unknown factors, we have successfully established a screening system that combines a streptavidin‐agarose pulldown assay and high‐throughput proteomics (Deng et al., 2007). One of the proteins that we identified using this systematic approach is cleavage and polyadenylation specific factor 4 (CPSF4), which was significantly over‐represented in the hTERT promoter probe‐protein complexes in nuclear proteins prepared from telomerase positive lung cancer cells compared to telomerase negative normal cells.

CPSF4 is a member of the cleavage and polyadenylation specificity factor (CPSF) complex, whose other components are CPSF160, CPSF100, CPSF73 and Fip1 (Kiefer et al., 2009). In addition to the evidence suggesting that CPSF4 functions as a 3′ mRNA processing factor that participates in the maturation of mRNA 3′ ends (Barabino et al., 1997; de Vries et al., 2000; Kaufmann et al., 2004; Nemeroff et al., 1998), the role of CPSF4 as a transcriptional coactivator has also been described (Rozenblatt‐Rosen et al., 2009). We considered the hypothesis that the differential expression of CPSF4 in cancer cells and normal cells may be associated with the tumor‐specific activation of hTERT transcription.

In this study, we showed that the overexpression of CPSF4 activates the hTERT promoter, which in turn increases hTERT expression and activates telomerase. These results support the hypothesis that CPSF4 may be an important regulator of telomerase activity and cell growth in lung adenocarcinomas. As hTERT expression is closely related to tumorigenesis and strictly controlled at the transcription level, our findings indicate the role of CPSF4 as a tumor‐specific hTERT promoter regulator to promote hTERT gene expression in human lung cancers and a potential novel therapeutic target for the treatment of lung cancers.

2. Materials and methods

2.1. Cell lines and cell culture

Telomerase positive three human adenocarcinoma cell lines (H1299, A549 and H322) were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and cultured in RPMI‐1640 medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum. Human lung fibroblasts WI‐38 and normal human bronchial epithelial (HBE) cells, which express very low levels of hTERT because of promoter repression (Milyavsky et al., 2003) were cultured in Dulbecco's Modified Eagle Medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum. All cells were maintained in a humidified atmosphere and 5% CO2 at 37 °C.

2.2. Streptavidin‐agarose pulldown assay

The binding of transactivators to hTERT promoter DNA was assayed by streptavidin‐agarose pulldown as described previously (Deng et al., 2006). Briefly, cell lines were grown to 80–90% confluence in 150‐cm2 flasks, and nuclear extracts were prepared. A biotin‐labeled double‐stranded DNA probe corresponding to nucleotides −378 to +60 of the hTERT promoter sequence was synthesized by Sigma (Sigma–Aldrich, St. Louis, MO). The binding assay was performed by mixing 1 mg of nuclear protein extract, 10 μg of DNA probe, and 100 μl of streptavidin‐agarose beads (Sigma–Aldrich). The mixture was incubated at room temperature for 2 h with agitation and then centrifuged at 500 × g to pulldown the DNA‐protein complex. The bound proteins were eluted with cold phosphate‐buffered saline (PBS) for further analysis.

2.3. Identification of hTERT promoter‐binding proteins

The potential transactivators of hTERT promoter DNA were analyzed using a mass spectrometry. Briefly, the bound proteins were separated by 10% SDS‐PAGE and visualized by coomassie blue staining. The protein bands of interest were cut out and digested with sequencing‐grade trypsin solution. The identification of digested samples was performed using a mass spectrometry. The identities of the proteins of interest were verified via available databases and software.

2.4. Chromatin immunoprecipitation assay (ChIP)

The ChIP assay was performed using the ChIP IT Express kit (Active Motif, Rixensart, Belgium) according to the manufacturer's instructions. Briefly, the cells were fixed with 1% formaldehyde and sonicated on ice to shear the DNA into 200 to 500 bp fragments. One third of the total cell lysate was used as the DNA input control. The remaining two thirds of the lysate was subjected to immunoprecipitation with anti‐CPSF4 antibodies or non‐immune rabbit IgG (Proteintech Group, Inc., Chicago, USA). A 438‐bp region (−378 to +60 bp) of the hTERT promoter was amplified by PCR using the primers (5′‐ TGGCCCCTCCCTCGGGTTAC‐3′ and 5′‐ CCAGGGCTTCCCACGTGCGC‐3′). The PCR products were resolved electrophoretically on a 2% agarose gel and visualized by ethidium bromide staining.

2.5. Plasmid vectors

A fragment of the hTERT promoter (−400 to +60) was amplified by PCR and inserted into the SacI and SmaI sites of the luciferase reporter vector pGL3‐Basic (Promega Corp., Madison, WI) to generate the hTERT promoter luciferase plasmid pGL3‐hTERT‐400. A GFP reporter vector (driven by a CMV or an hTERT promoter) was constructed as previously described (Deng et al., 2007). The CPSF4 and hTERT overexpression vectors pcDNA3.1‐CPSF4 and pcDNA3.1‐hTERT and the control vector pcDNA3.1 were designed and synthesized by Cyagen (Cyagen Biosciences Inc., United States).

2.6. Transient transfection of lung cancer cells

To overexpress CPSF4, WI‐38 and HBE and H322 cells were transfected with a pcDNA3.1‐CPSF4 vector or a pcDNA3.1 control vector using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). To inhibit CPSF4 expression, A549 and H1299 cells were transfected with CPSF4‐specific siRNA oligonucleotide (50 nmol/L) with the sequences of the human CPSF4‐specific siRNA were 5′‐CAU GCA CCC UCG AUU UGA ATT‐3′ (siRNA‐1) and 5′‐GGU CAC CUG UUA CAA GUG UTT‐3′ (siRNA‐2); the sequence of the nonspecific siRNA was 5′‐UUC UCC GAA CGU GUC ACG UTT‐3′ (50 nmol/L). CPSF4 siRNA and nonspecific siRNA were purchased from Shanghai GenePharma Co. (Shanghai China). Forty‐eight hours after transfection, RNA and protein were isolated, and RT‐PCR, telomerase activity and western blot analyses were carried out as described below.

2.7. Promoter reporters and dual‐luciferase assay

Cells (2 × 105 cells/well) were seeded into six‐well plates, cultured overnight, and transfected with the hTERT promoter‐luciferase plasmids or the GFP reporter vector (driven by a CMV or an hTERT promoter) (1 μg per well of plasmid) with Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Meanwhile, cells were co‐transfected with either a CPSF4 overexpression vector (pcDNA3.1‐CPSF4 or the control vector pcDNA3.1) or a CPSF4‐specific siRNA (CPSF4‐specific siRNA or a nonspecific siRNA control). The amount of co‐transfected CPSF4 overexpression vector or CPSF4‐specific siRNA was as indicated in the figures. For dual‐luciferase assay, the transfection efficiency was normalized by cotransfection with Renilla luciferase reporter. For GFP reporter assay, the transfection efficiency was normalized by cotransfection with red fluorescent protein (RFP) expressing plasmid vector. The transfection efficiency was approximately 50–65% in these cell lines. Forty‐eight hours after transfection, the cells were assayed for luciferase activity using a Dual‐Luciferase Reporter assay system (Promega Corp., Madison, WI). The expression of GFP was examined under a fluorescence microscopy. The cells were assayed for the percentage of the GFP‐positive cell population and the fluorescence intensity of the GFP protein using flow cytometry.

2.8. Telomerase activity assays

Telomerase activity was analyzed by a telomerase PCR enzyme‐linked immunosorbent assay kit (Roche Applied Science).

2.9. Cell viability assay

Cell viability was determined using an MTT assay kit (Roche Diagnosis, Indianapolis, IN) according to the manufacturer's protocol. Briefly, A549 and H1299 cells plated in 96‐well plates (2000 cells/well) were treated with CPSF4 siRNA or control siRNA (50 nmol/L). At 48 h hours after treatment, cells were transfected with hTERT overexpression vector (pcDNA3.1‐hTERT). Forty‐eight hours after pcDNA3.1‐hTERT transfection, the viability of the cells was determined.

2.10. Western blot analysis

Western blot analyses of the cell lysates were performed with antibodies against CPSF4 (Proteintech Group, Inc., Chicago, USA), hTERT (Epitomics), general transcription factor IIB (TFIIB) and GAPDH (Cell Signaling Technology, Beverly, MA). Immunoreactive protein bands were detected using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech, Piscataway, NJ) according to the manufacturer's instructions.

2.11. RT‐PCR

Total cellular RNA extraction and first strand cDNA synthesis were performed as described previously (Deng et al., 2007). Reverse transcription–polymerase chain reaction (RT–PCR) was performed using EF‐Taq polymerase (SolGent, Korea) to amplify hTERT. The primers for hTERT were as follows: 5′‐GTCGAGCTGCTCAGGTCTT‐3′ and 5′‐AGTGCTGTCTGATTCCAATGCTT‐3′. The PCR products were visualized under ultraviolet light and the band density was measured by Quantity One software (Bio‐Rad).

2.12. In vivo tumor model and tissue processing

Animal experiments were carried out in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals, with the approval of the Animal Research Committee of Sun Yat‐sen University Cancer Center, Guangzhou. Cholesterol‐conjugated CPSF4 siRNA and negative control siRNA for in vivo delivery were obtained from Shanghai GenePharma Co. (Shanghai China). The knockdown efficiency of these siRNAs was validated in vitro. To investigate the effect of CPSF4 inhibition on lung cancer cell growth in vivo, A549 cells (2 × 106) were inoculated subcutaneously into the flank of the nude mice. Treatment began 2 weeks after the injection of the tumor cells. Mice were randomly divided into 2 groups (5 mice per group): (a) CPSF4 siRNA and (b) control siRNA. For delivery of cholesterol‐conjugated siRNA, 10 nmol RNA in 0.1 ml saline buffer was injected intratumorally twice a week for 3 weeks (Hou et al., 2011). The tumor volume was calculated as V = (width2 × length)/2 using digital calipers. Three weeks later, the mice were sacrificed, and the tumor weight was recorded. Tumor specimens were fixed in formalin and embedded in paraffin for CPSF4 and hTERT protein expression analysis. The immunohistochemical staining was performed as described below.

To confirm the effect of CPSF4 knockdown on tumor cell growth in a xenograft mouse model in vivo, the A549 cell lines stably expressing CPSF4 short‐hairpin RNA (shRNA) or the scrambled non‐target control shRNA were established and used. The lentivirus for shRNAs were obtained from Santa Cruz Biotechnology Inc. To rescue hTERT expression, an hTERT‐expressing lentivirus was used to co‐infect A549 cells stably expressing CPSF4 shRNA. Four stable A549 cell lines (2 × 106) were respectively inoculated subcutaneously into the flank of the nude mice (5 mice per group): (1) CPSF4 shRNA; (2) non‐target control shRNA; (3) CPSF4 shRNA + hTERT; (4) CPSF4 shRNA + Control empty vector (EV). Once palpable tumors were observed, tumor volume measurements were taken every 3 days using calipers.

2.13. Human lung adenocarcinoma specimens

The human lung adenocarcinoma tissue microarray used for immunostaining analysis of CPSF4 and hTERT protein expression was purchased from Shanghai Outdo Biotech (Shanghai, China) and contains 171 lung adenocarcinomas and their corresponding adjacent non‐malignant lung tissues. These tissue samples had been obtained before anti‐cancer treatment and with prior written consent from patients. The overall survival (OS) for the corresponding patients was calculated from the day of surgery to the day of death or to the last follow‐up.

2.14. Immunohistochemistry (IHC) staining

The tissue microarray (TMA) slides were deparaffinized in xylene and rehydrated through graded alcohol. Antigen retrieval was performed by incubating samples with citrate buffer (0.1 mol/L, pH 6.0) for 90 min (for hTERT detection) and with Target Retrieval Solution (pH 9; DakoCytomation) for 15 min (for CPSF4 detection) using a pressure cooker. The slides were then immersed in methanol containing 3% hydrogen peroxide for 20 min to block endogenous peroxidase activity. After pre‐incubation in 2.5% blocking serum to reduce nonspecific binding, the sections were incubated overnight with a primary antibody, either anti‐CPSF4 (1:50 dilution), or anti‐hTERT antibody (1:50 dilution), in a humidified container at 4 °C. The TMA slides were processed with horseradish peroxidase immunochemistry according to the manufacturer's recommendations (DakoCytomation). As a negative control, the staining procedure was performed in parallel with the primary antibody replaced by a normal rabbit IgG.

CPSF4 and hTERT proteins were mainly detected in the nuclei of the cancer cells. Nuclear staining intensity was graded as follows: absent staining as 0, weak as 1, moderate as 2, and strong as 3. The percentage of stained cells was graded as follows: 0 (no positive cells), 1 (<25% positive cells), 2 (25%–50% positive cells), 3 (50%–75% positive cells), and 4 (>75% positive cells). The score for each tissue was calculated by multiplying the intensity and the percentage value (the range of this calculation was therefore 0–12). The receiver operating characteristic (ROC) curve analysis was employed to determine cutoff score for tumor “high expression” by using the 0, 1‐criterion. Briefly, the sensitivity and specificity for the patient outcome being studied at each score was plotted to generate a ROC curve. The score was selected as the cutoff value, which was closest to the point with both maximum sensitivity and specificity. Tumors designated as “low expression” for CPSF4 and hTERT were those with scores below or equal to the cutoff value, while “high expression” tumors were those with scores above the value. To facilitate ROC curve analysis, the clinicopathologic features were dichotomized: survival status (death due to lung adenocarcinomas or censored).

2.15. Statistical analysis

Student's t‐tests were used to compare two independent groups of data. ROC curve analysis was utilized to define the cutoff score for high expression of CPSF4 and hTERT. Pearson's correlation test was applied to analyze the association between the abundance of CPSF4 and hTERT. Survival curves were constructed using the Kaplan–Meier method and were compared using the log‐rank test. Statistical analyses were performed using the SPSS 16.0 software. The results were reported as the mean ± SE. Values of P < 0.05 were considered to be statistically significant.

3. Results

3.1. Identification of proteins with differential hTERT promoter binding in telomerase positive lung adenocarcinoma cells and telomerase negative normal lung cells

Previously, we reported that the streptavidin‐agarose bead pulldown assay is a useful and feasible approach to detect and discover promoter‐binding proteins, such as transactivators, general transcription factors and coactivators (Deng et al., 2007, 2006). In this study, to screen and identify novel regulators of the hTERT promoter in lung adenocarcinomas, a 5′‐biotinylated 438‐bp DNA probe corresponding to nucleotides −378 to +60 of the hTERT promoter sequence was generated, and a streptavidin‐agarose bead pulldown method was used. Three human adenocarcinoma cell lines (H1299, A549 and H322) are telomerase positive (Deng et al., 2007). WI‐38 is an excellent telomerase negative control cell line since it express very low levels of hTERT because of promoter repression (Milyavsky et al., 2003). First, nuclear protein extracts harvested from human lung adenocarcinoma cells (H1299, A549 and H322) and normal lung cell lines (WI‐38) were incubated with the hTERT promoter probe and streptavidin–agarose beads. Next, the candidate regulators that specifically bound to the hTERT promoter probe were pulled down, separated by SDS‐PAGE, and visualized by coomassie blue staining. As shown in Figure 1A (arrow), one of the protein bands (at approximately 30 kDa) was significantly elevated in the lung cancer cells in comparison with the normal lung cells.

Figure 1.

Figure 1

Detection and identification of hTERT promoter‐binding proteins that differ between telomerase positive lung adenocarcinoma cells and telomerase negative normal lung cells. (A) The potential hTERT promoter‐binding proteins were pulled down, separated by the SDS‐PAGE, and coomassie blue stained. A representative SDS‐PAGE image is shown, and the arrow indicates the candidate hTERT promoter‐binding protein. (B) Binding of CPSF4 to a biotinylated hTERT promoter probe (−378 to +60) or a nonspecific probe (NSP). CPSF4 proteins in the nuclear protein‐hTERT probe‐streptavidin bead complexes was detected by Western blot using anti‐CPSF4 antibody. (C) Chromatin immunoprecipitation assays were carried out using the hTERT promoter from normal lung cells and various lung adenocarcinoma cells. PCR products were separated on 2% agarose gels. (D) The expression of CPSF4 proteins in cell nuclear extracts were analyzed by Western blot. The general transcription factor IIB (TFIIB) was used as loading controls.

To identify the candidate tumor cell‐elevated hTERT promoter‐binding protein, a proteomics approach using MALDI‐TOF/TOF MS was utilized. The candidate hTERT promoter‐binding protein (Figure 1A, arrow) was predicted to be the cleavage and polyadenylation specific factor 4 (CPSF4).

3.2. Validation of the interaction between CPSF4 protein and the hTERT promoter

To verify that CPSF4 is a novel hTERT promoter‐binding protein in lung cancer cells, we pulled down the CPSF4 in nuclear protein extracts using a 5′‐biotinylated hTERT promoter probe and a streptavidin‐agarose bead, and then detected the CPSF4 proteins on the complexes consisting of nuclear proteins, hTERT promoter and streptavidin‐agarose beads by Western blot using anti‐CPSF4 antibody. As shown in Figure 1B, the high levels of CPSF4 proteins which bound to the hTERT promoter probe were detected in lung cancer cell lines H1299, A549 and H322. However, the CPSF4 proteins binding to the hTERT promoter probe were very low in normal lung cell lines WI‐38 and HBE. To further confirm that CPSF4 is a novel hTERT promoter‐binding protein, a ChIP assay was performed in lung cancer cell lines and normal lung cell lines. As shown in Figure 1C, CPSF4 protein bound to the endogenous hTERT promoter in all cell lines. More importantly, a very weak CPSF4 binding was observed in normal lung cell lines HBE and WI‐38, but a strong CPSF4 binding on hTERT promoter was shown in all three lung cancer cell lines H1299, A549 and H322 (Figure 1C). These results suggest that CPSF4 is recruited to the endogenous hTERT promoter during transcription and that more CPSF4 protein is bound to hTERT promoter in lung cancer cells. Therefore, we hypothesized that CPSF4, the tumor cell‐elevated hTERT promoter binding protein, drives the transcription of hTERT in lung cancer cells.

We also detected the expression of CPSF4 in the nuclear extracts of lung cancer cell lines and norma lung cells by Western blot analysis. As shown in Figure 1D, lung cancer H1299 and A549 cells had higher CPSF4 expression than H322 cells, while the expression of CPSF4 proteins in normal lung cell lines WI‐38 and HBE were almost undetectable.

3.3. CPSF4 protein activates the hTERT promoter in lung cancer cell lines

To test this hypothesis, we next determined the effect of CPSF4 on hTERT promoter activity. We performed the overexpression experiments in H322 and HBE cells, which have lower expression of CPSF4, and the knocking down experiments in A549 and H1299 cells, which have high expression of CPSF4. A GFP reporter and luciferase reporter assay were first performed. We co‐transfected H322, HBE, A549 and H1299 cells with a GFP reporter driven by the hTERT or CMV promoter. As shown in Figure 2A and B, overexpression of CPSF4 upregulated hTERT promoter‐mediated GFP expression in H322 and HBE cells co‐transfected with an expression vector encoding CPSF4 (pcDNA3.1‐CPSF4) and hTERT‐GFP plasmids by comparison with those cells co‐transfected with a control vector lacking CPSF4 (pcDNA3.1) and hTERT‐GFP plasmids. Overexpression of CPSF4 protein significantly increased the GFP‐positive cell population and the fluorescence intensity of the GFP protein in H322 and HBE cells (Figure 2A and B). In contrast, exogenous expression of CPSF4 did not alter CMV promoter‐driven GFP expression in H322 and HBE cells (Figure 2A and B). Inhibition of CPSF4 expression by CPSF4‐specific siRNA (siCPSF4) attenuated hTERT promoter‐driven GFP expression and dramatically decreased the GFP‐positive cell population and the fluorescence intensity of the GFP protein in A549 and H1299 cells (Figure 2C and D). Similarly, knockdown of CPSF4 expression did not affect CMV promoter‐driven GFP expression in A549 and H1299 cells (Figure 2C and D).

Figure 2.

Figure 2

CPSF4 protein activates the hTERT promoter in lung cancer cells. A, B, activation of hTERT promoter‐driven GFP gene expression by CPSF4 overexpression. H322 and HBE cells were co‐transfected with pCDNA3.1‐CPSF4 and hTERT or CMV promoter‐driven GFP‐expressing plasmids for 48 h, and the expression of GFP was analyzed by fluorescence microscopy (40× magnification). pCDNA3.1 empty vector was used as a negative control. The percentage of the GFP‐positive cell population (A) and the fluorescence intensity (B) of the GFP protein derived from 5000 cells were determined by flow cytometry analysis (*, P < 0.05,**, P < 0.01). C, D, inhibition of hTERT promoter‐driven GFP gene expression by CPSF4_ knockdown. A549 and H1299 cells were co‐transfected with CPSF4‐specific siRNA (siCPSF4) and hTERT or CMV promoter‐driven GFP‐expressing plasmids for 48 h, and the expression of GFP was analyzed by fluorescence microscopy (40× magnification). Nonspecific control small interfering RNA (siCtrl) was used as a negative control. The percentage of the GFP‐positive cell population (C) and the fluorescence intensity (D) of the GFP protein derived from 5000 cells were determined by flow cytometry analysis (*, P < 0.05,**, P < 0.01). (E) H322 and HBE were co‐transfected with 1 μg of hTERT‐400‐luciferase and the indicated doses of pCDNA3.1 empty vector or pCDNA3.1‐CPSF4 for 48 h. Luciferase activity was measured using a dual‐luciferase assay. The activation of luciferase was calculated relative to cells transfected with empty vector. All of the measurements represent the means ± SE of three independent experiments (*, P < 0.05). (F) A549 and H1299 were co‐transfected with 1 μg of hTERT‐400‐luciferase and the indicated doses of CPSF4 siRNA or a nonspecific control siRNA for 48 h. Luciferase activity was measured using a dual‐luciferase assay. The inhibition of luciferase was calculated as a percentage relative to cells transfected with control siRNA. All of the measurements represent the means ± SE of three independent experiments (*, P < 0.05).

Next, to further confirm the role of CPSF4 in regulating the activity of the hTERT promoter, H322 and HBE cells were co‐transfected with the hTERT promoter‐luciferase construct pGL3‐hTERT‐400 and increasing concentrations of pcDNA3.1‐CPSF4. Using the pTK‐RL vector as a control to normalize for transfection efficiency, we showed that luciferase activity driven by the hTERT promoter was activated by CPSF4 in a dose‐dependent manner in H322 and HBE cell lines (Figure 2E). Conversely, to assess the effect of decreased CPSF4 expression on the activity of the hTERT promoter, we knocked down CPSF4 expression by co‐transfecting A549 and H1299 cells with siCPSF4 and the hTERT promoter‐luciferase construct. The knockdown of CPSF4 by CPSF4‐specific siRNA decreased the luciferase activity driven by the hTERT promoter in a dose‐dependent manner in A549 and H1299 cells (Figure 2F). Taken together, our results suggest that CPSF4 upregulates hTERT promoter activity.

3.4. CPSF4 protein promotes the expression of hTERT and telomerase activity in lung cancer cell lines

To verify the role of CPSF4 in regulating the transcription of hTERT, we evaluated the effect of CPSF4 on endogenous hTERT mRNA expression in lung cancer cell lines. We found that the ectopic expression of CPSF4 using a CPSF4 expression plasmid significantly increased the level of hTERT mRNA in WI‐38, HBE and H322 cells (Figure 3A). By contrast, the inhibition of CPSF4 by CPSF4 siRNA significantly decreased the level of hTERT mRNA in A549 and H1299 cells (Figure 3C). These results indicate that CPSF4 is involved in hTERT transcription in lung cancer cells.

Figure 3.

Figure 3

CPSF4 protein promotes hTERT expression and telomerase activity in lung cancer cell lines. A, B, the up‐regulation of hTERT mRNA and protein expression and telomerase activity by CPSF4 overexpression. WI‐38 and HBE and H322 cells were transfected with pCDNA3.1 empty vector or pCDNA3.1‐CPSF4 for 48 h, and the expression of hTERT mRNA and protein was analyzed by RT‐PCR and Western blot (A). Telomerase activity was measured in WI‐38 and HBE and H322 cells using a telomeric repeat amplification protocol assay‐based TeloTAGGG telomerase PCR enzyme‐linked immunosorbent assay (**, P < 0.01) (B). C, D, down‐regulation of hTERT mRNA and protein expression and telomerase activity by CPSF4 knockdown. A549 and H1299 cells were transfected with 50 nmol/L of CPSF4 siRNA or nonspecific control siRNA for 48 h, and the expression of hTERT mRNA and protein was analyzed by RT‐PCR and Western blot (C). Telomerase activity was measured in A549 and H1299 cells by telomerase PCR enzyme‐linked immunosorbent assay (**, P < 0.01) (D).

The expression of the hTERT gene and the activation of telomerase are primarily regulated at the transcriptional level (Kyo et al., 2008). We then further illustrated the biological importance of CPSF4 in the regulation of hTERT expression by analyzing hTERT protein expression and hTERT activity. Our results showed that the ectopic expression of CPSF4 up‐regulated hTERT protein expression in WI‐38, HBE and H322 cells (Figure 3A). Furthermore, hTERT activity, as indicated by telomerase activity, was markedly increased (Figure 3B). In contrast, the blockade of CPSF4 expression by CPSF4 siRNA suppressed the expression of hTERT protein and telomerase activity in A549 and H1299 cells (Figure 3C and D). These findings suggest that CPSF4 plays a positive role in the regulation of hTERT expression and telomerase activity.

3.5. The silencing of CPSF4 suppresses tumor growth by downregulating hTERT expression in lung adenocarcinoma in vitro and in vivo

hTERT promotes the survival and proliferation of cancer cells and has become a very promising target for anticancer therapy. Because we observed that hTERT is directly regulated by CPSF4 (1, 2, 3), we reasoned that CPSF4 inhibition may be effective as a potential therapeutic strategy in lung adenocarcinoma treatment. To test this hypothesis and to examine the biologic effects of the CPSF4 knockdown on lung adenocarcinoma growth, we performed an in vitro proliferation assay and a tumorigenicity assay using a xenograft mouse model. As shown in Figure 4A–D, the knockdown of CPSF4 dramatically suppressed the growth of lung cancer cells. To further assess whether hTERT expression is involved in this tumor growth suppression by siRNA against CPSF4, we rescued hTERT expression using an hTERT‐expressing plasmid after CPSF4‐specific siRNA treatment. The CPSF4‐specific siRNA‐induced tumor inhibition was partially rescued by the ectopic expression of hTERT (Figure 4A). Moreover, as shown in Figure 4E, the knockdown of CPSF4 did decrease the hTERT protein levels in xenografts.

Figure 4.

Figure 4

The knockdown of CPSF4 inhibits tumor growth by downregulating hTERT expression. (A) A549 and H1299 cells were transfected with CPSF4 siRNA or nonspecific control siRNA. At 48 h after treatment, cells were transfected with an hTERT overexpression vector (pcDNA3.1‐hTERT) or an empty vector. Forty‐eight hours later, cell viability was measured using an MTT assay. The mean and SE obtained from three independent experiments are plotted. (B) A representative picture of nude mice comparing the sizes of tumor grafts in nude mice 21 days after intratumoral injection of nonspecific control siRNA or CPSF4‐specific siRNA. (C) Tumor volumes ± SE in nude mice. N = 5; ***, P < 0.001. (D) Mean tumor weights ± SE in nude mice. N = 5; ***, P < 0.001. (E) Immunohistochemistry of CPSF4 and hTERT from tumor xenografts in nonspecific control siRNA‐ and CPSF4‐specific siRNA‐treated nude mice (400× magnification). (F) The A549 stable cell lines were injected into the flanks of nude mice. The tumor volumes were measured and recorded every 3 days, and tumor growth curves were created for each group (n = 5). Dots represent the mean, while bars indicate the SEM. (*, P < 0.05; **, P < 0.01).

To confirm the inhibitory effect of CPSF4 knockdown on tumor cell growth in a xenograft mouse model in vivo, we established the A549 cell lines stably expressing CPSF4 short‐hairpin RNA (shRNA) or a scrambled non‐target control shRNA. To see whether the hTERT can rescue the tumor volume change induced by CPSF4 knockdown in mice, the A549 cells stably expressing CPSF4 shRNA were co‐infected with a hTERT‐expressing lentivirus. The results showed that the stable expression of CPSF4 shRNA considerably inhibited tumor volume by comparison with the control shRNA. However, the overexpression of hTERT in A549 cells stably expressing CPSF4 shRNA effectively rescued the tumor volume change induced by CPSF4 knockdown (Figure 4F). These results suggest that CPSF4 knockdown exerts its inhibitory effect on tumor cell growth partially through the downregulation of hTERT expression.

3.6. A positive correlation between the protein levels of CPSF4 and hTERT in lung adenocarcinoma tissues

To further determine the biological relevance of CPSF4‐mediated expression of hTERT, the expression of CPSF4 and hTERT was analyzed in 171 human lung adenocarcinoma tissues by IHC staining (Figure 5A). We quantified the immunohistochemical staining of CPSF4 and hTERT in the human lung adenocarcinoma specimens on the 0 to 12 scale and then analyzed the scores. We found that CPSF4 expression levels correlated positively with hTERT expression levels in lung adenocarcinoma samples (Pearson's correlation test r = 0.55; P < 0.001) (Figure 5B).

Figure 5.

Figure 5

There is a positive correlation between the protein levels of CPSF4 and hTERT in lung adenocarcinoma specimens. (A) Representative immunohistochemical staining examples of high or low CPSF4 and hTERT expression in the serial sections from the same tumor tissues are shown. Scale bar, 200 μm. Case 1 and 2 means two different patients. (B) The tissue sections were quantitatively scored according to the percentage of positive cells and staining intensity as described in Materials and Methods. The percentage and intensity scores were multiplied to obtain a total score (range, 0–12). CPSF4 expression levels correlated positively with hTERT expression levels in lung adenocarcinoma samples (Pearson's correlation test, r = 0.55; P < 0.001). (C) The expression of CPSF4 and hTERT proteins in the total cell lysates of lung normal cells and cancer cells were analyzed by Western blot.

We also detected the expression of CPSF4 and hTERT in the whole cell lysates of lung cancer cell lines and norma lung cells by Western blot analysis. The results showed that the lung cancer lines (H1299, A549 and H322) highly expressed CPSF4 and hTERT proteins, while the expression of CPSF4 and hTERT proteins in normal lung cell lines (WI‐38 and HBE) could not be detected (Figure 5C). These results suggest that CPSF4 expression is correlated with hTERT expression in human lung cancer cells.

3.7. High CPSF4 and hTERT protein expression are associated with a poor clinical outcome in patients with lung adenocarcinoma

As shown in Figure 6A, CPSF4 and hTERT protein were localized to the nucleus of cancer cells. CPSF4 and hTERT protein are highly expressed in tumor tissues compared to adjacent non‐malignant lung tissues (Figure 6A, D). The ROC curves for CPSF4 and hTERT (Figure 6B, C) clearly show the point on the curve closest to (0.0, 1.0) which maximizes both sensitivity and specificity for the OS. The CPSF4 and hTERT IHC cut‐off scores for OS were 5.0 (Figure 6B, C). Thus, the expression of CPSF4 and hTERT in each sample was subsequently classified as either high level (score > 5) or low level (score ≤ 5). Moreover, the lung adenocarcinoma patients with high CPSF4 and hTERT expression had a significantly shorter OS than those with low CPSF4 and hTERT expression (Figure 6E). Therefore, our results suggest that high CPSF4 and hTERT protein expression are associated with a poor clinical outcome in patients with lung adenocarcinoma.

Figure 6.

Figure 6

CPSF4 and hTERT protein are highly expressed in lung adenocarcinomas tissues compared to adjacent non‐malignant lung tissues and higher expression of CPSF4 and hTERT indicates a poor prognosis. (A) Immunohistochemical staining of CPSF4 and hTERT was performed in a tumor tissue microarray of samples from patients with lung adenocarcinomas. Representative examples of CPSF4 and hTERT staining in the tumor tissues and adjacent non‐malignant lung tissues are shown (200× magnification). B, C, ROC curve analysis was used to determine the cut‐off score for high expression of CPSF4 and hTERT protein in lung adenocarcinoma tissues. The sensitivity and specificity for OS were plotted: (B) CPSF4; p = 0.001 (C) hTERT; p = 0.008. (D) The protein level of CPSF4 correlates positively with the protein level of hTERT in lung adenocarcinoma tissues (P < 0.001, χ2 tests). (E) Kaplan–Meier analysis of overall survival with high or low CPSF4 and hTERT expression (p < 0.001, log‐rank test).

4. Discussion

Our study sought to discover and identify several potential hTERT promoter‐regulating proteins that are expected to be highly specific to malignant cells using a streptavidin‐agarose pulldown assay and high‐throughput proteomics. We observed that human lung adenocarcinoma cells expressed higher levels of CPSF4 proteins than normal lung cells. Moreover, we found that the promoter activity of hTERT was dependent on CPSF4. CPSF4 enhanced the expression of the hTERT promoter‐driven GFP reporter gene without affecting the expression of the CMV promoter‐driven GFP gene. The forced ectopic expression of CPSF4 by transfection with a CPSF4 expression vector significantly up‐regulated hTERT expression and telomerase activity of lung adenocarcinomas cell, whereas the inhibition of CPSF4 by transfection with CPSF4 siRNA did the opposite. Furthermore, our in vitro and in vivo results revealed that CPSF4 knockdown inhibited lung cancer cell growth by decreasing hTERT expression. Importantly, our results also show that the levels of CPSF4 expression are strongly correlated with the levels of hTERT expression in lung adenocarcinoma specimens. Thus, we have identified the overexpression of CPSF4 as a cause of deregulated hTERT expression in some lung adenocarcinomas.

We have previously demonstrated that the streptavidin‐agarose pulldown assay is an effective screening system to analyze the tumor‐specific transactivators and coactivators that regulate the promoters of carcinogenic genes COX‐2 and hTERT (Deng et al., 2007, 2006, 2003, 2004). These tumor‐specific transcriptional regulation factors may become valuable diagnostic and therapeutic target molecules for cancer. One example of these factors is AP‐2β, which exhibits tumor‐specific binding to the hTERT promoter in non‐small cell lung cancer (Deng et al., 2007), and, when overexpressed, predicts poor survival in patients with stage I non‐small cell lung cancer (Kim et al., 2011). In this study, we detected CPSF4 as a candidate hTERT promoter‐binding protein using streptavidin‐agarose pulldown technology. We then verified that CPSF4 regulates the promoter activity and expression of hTERT. CPSF4 may have an oncogenic function in lung adenocarcinomas, and CPSF4 is frequently overexpressed in lung adenocarcinoma samples and correlates with poor clinical outcome. Therefore, our results once again suggest that the streptavidin‐agarose pulldown assay will be a useful approach to identify potential molecular targets for the diagnosis and/or treatment of cancers.

hTERT overexpression is observed in approximately 90% of human cancers, including lung cancer, but the level of hTERT in most normal tissues is almost undetectable (Daniel et al., 2012; Lantuejoul et al., 2004; Toomey et al., 2001; Zhu et al., 2006). However, little is known about how hTERT is reactivated during tumorigenesis. Studies have indicated that hTERT gene amplification is one of the mechanisms for hTERT overexpression in non‐small‐cell lung cancer (Zhu et al., 2006). In this report, we provide both clinical and mechanistic evidence that an increase in the abundance of CPSF4 protein is another mechanism that may explain the up‐regulated hTERT expression in some lung adenocarcinomas. Interestingly, there were 29 tumors that contained high levels of hTERT and low levels of CPSF4 (Figure 6D), indicating that other factors, in addition to the CPSF4, may be involved in the regulation of hTERT expression in lung adenocarcinomas. For example, AP‐2β activates the expression of the hTERT in lung cancer, as we reported previously (Deng et al., 2007). The transcriptional regulation of the hTERT gene is the major mechanism for cancer‐specific activation of hTERT (Daniel et al., 2012; Kyo et al., 2008). Several studies have indicated that various cellular factors directly or indirectly regulate the hTERT promoter in lung cancer, including cellular transcriptional activators (c‐Myc, Sp1, HPV‐16 E6 oncoprotein, etc.) and repressors (p53, p73, etc) (Beitzinger et al., 2006; Cheng et al., 2008; Fujiki et al., 2007). Nevertheless, previous studies on the regulation of hTERT expression have revealed the diversity and complexity of hTERT transcriptional regulation (Daniel et al., 2012). Thus, our current study adds a new mechanism to the body of research on the transcriptional regulation of hTERT expression by providing evidence that hTERT is a direct transcriptional target of CPSF4 and that CPSF4 critically controls hTERT expression in lung adenocarcinomas cells.

CPSF4 belongs to the CPSF complex which cooperates with other 3′ mRNA‐processing factors participating in the maturation of the 3′ ends of mRNA (Barabino et al., 1997; de Vries et al., 2000; Kaufmann et al., 2004; Nemeroff et al., 1998). How these primary transcript‐processing factors regulate gene transcription is an interesting question. Recent studies have suggested that the transcriptional, splicing and cleavage‐polyadenylation factors assemble an mRNA 'factory' that carries out the coupled transcription, splicing and cleavage–polyadenylation of mRNA precursors. This 'factory' exists in place at the promoter and produces mature transcripts (Calvo and Manley, 2003; McCracken et al., 1997). Rozenblatt‐Rosen et al. (2009) found that CPSF4 interacted with transcriptional factors to form a complex that binds to promoters and regulates the transcription of target genes. Due to the lack of DNA‐binding domains in CPSF4 that are found in general transcription factors, we speculated that CPSF4 may execute its co‐activation effect on hTERT by recruiting the general transcription factors to assemble the hTERT transcriptional complex in the nucleus. However, we cannot rule out the possibility that CPSF4 may affect hTERT mRNA maturation, such as cleavage and polyadenylation of hTERT mRNA 3′ ends. Further detailed analyses are necessary to determine the effect of CPSF4 on hTERT mRNA maturation.

Recently, studies have described the role of some mRNA 3′ end‐processing factors in cancer, including FIP1L1, CSTF50, CSTF2 and Neo‐PAP (Aragaki et al., 2011; Cools et al., 2004; Gotlib et al., 2004; Kleiman and Manley, 2001; Topalian et al., 2001). For example, Aragaki and colleagues found that CSTF2 overexpression is an independent poor prognostic factor in non‐small‐cell lung cancer patients. In addition, the suppression of CSTF2 expression inhibited the growth of lung cancer cells, whereas the exogenous expression of CSTF2 promoted the growth and invasion of lung cancer cells (Aragaki et al., 2011). The results from our in vitro and in vivo experiments indicated that CPSF4 exerted its oncogenic function by regulating hTERT expression in lung adenocarcinoma cells, although the exact molecular mechanism responsible for CPSF4 overexpression in lung adenocarcinoma cells is still unknown.

In summary, CPSF4 upregulates hTERT promoter activity and thus transcriptionally activates the expression of hTERT in lung cancer cells. Lung adenocarcinoma patients with high expression levels of CPSF4 and hTERT protein had shorter survival periods. CPSF4 knockdown inhibited tumor growth in vitro and in vivo. CPSF4 may be a new therapeutic target in lung adenocarcinomas.

5. Disclosure of conflict of interest

The authors declare no conflicts of interest.

Acknowledgments

This work was supported by the funds from the National Natural Science Foundation of China (81272896, 81272195, 81071687, 81372133), the State “863 Program” of China (SS2012AA020403), the State “973 Program” of China (2014CB542005), the Doctoral Programs Foundation of Ministry of Education of China (20110171110077), and the State Key Laboratory of Oncology in South China (W Deng).

Chen Wangbing, Qin Lijun, Wang Shusen, Li Mei, Shi Dingbo, Tian Yun, Wang Jingshu, Fu Lingyi, Li Zhenglin, Guo Wei, Yu Wendan, Yuan Yuhui, Kang Tiebang, Huang Wenlin and Deng Wuguo, (2014), CPSF4 activates telomerase reverse transcriptase and predicts poor prognosis in human lung adenocarcinomas, Molecular Oncology, 8, doi: 10.1016/j.molonc.2014.02.001.

Contributor Information

Shusen Wang, Email: wangshs@sysucc.org.cn.

Wenlin Huang, Email: huangwl@sysucc.org.cn.

Wuguo Deng, Email: dengwg@sysucc.org.cn.

References

  1. Aragaki, M. , Takahashi, K. , Akiyama, H. , Tsuchiya, E. , Kondo, S. , Nakamura, Y. , Daigo, Y. , 2011. Characterization of a cleavage stimulation factor, 3' pre-RNA, subunit 2, 64 kDa (CSTF2) as a therapeutic target for lung cancer. Clin. Cancer Res. An Official J. Am. Assoc. Cancer Res.. 17, 5889–5900. [DOI] [PubMed] [Google Scholar]
  2. Barabino, S.M. , Hubner, W. , Jenny, A. , Minvielle-Sebastia, L. , Keller, W. , 1997. The 30-kD subunit of mammalian cleavage and polyadenylation specificity factor and its yeast homolog are RNA-binding zinc finger proteins. Genes Dev.. 11, 1703–1716. [DOI] [PubMed] [Google Scholar]
  3. Beitzinger, M. , Oswald, C. , Beinoraviciute-Kellner, R. , Stiewe, T. , 2006. Regulation of telomerase activity by the p53 family member p73. Oncogene. 25, 813–826. [DOI] [PubMed] [Google Scholar]
  4. Bisoffi, M. , Heaphy, C.M. , Griffith, J.K. , 2006. Telomeres: prognostic markers for solid tumors. Int. J. Cancer. 119, 2255–2260. Journal International du Cancer [DOI] [PubMed] [Google Scholar]
  5. Blackburn, E.H. , 2005. Telomerase and Cancer: Kirk A. Landon–AACR prize for basic cancer research lecture. Mol. cancer Res. : MCR. 3, 477–482. [DOI] [PubMed] [Google Scholar]
  6. Blackburn, E.H. , Greider, C.W. , Szostak, J.W. , 2006. Telomeres and telomerase: the path from maize, Tetrahymena and yeast to human cancer and aging. Nat. Med.. 12, 1133–1138. [DOI] [PubMed] [Google Scholar]
  7. Bryan, T.M. , Cech, T.R. , 1999. Telomerase and the maintenance of chromosome ends. Curr. Opin. Cell Biol.. 11, 318–324. [DOI] [PubMed] [Google Scholar]
  8. Bryan, T.M. , Englezou, A. , Dalla-Pozza, L. , Dunham, M.A. , Reddel, R.R. , 1997. Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat. Med.. 3, 1271–1274. [DOI] [PubMed] [Google Scholar]
  9. Calvo, O. , Manley, J.L. , 2003. Strange bedfellows: polyadenylation factors at the promoter. Genes Dev.. 17, 1321–1327. [DOI] [PubMed] [Google Scholar]
  10. Cheng, Y.W. , Wu, T.C. , Chen, C.Y. , Chou, M.C. , Ko, J.L. , Lee, H. , 2008. Human telomerase reverse transcriptase activated by E6 oncoprotein is required for human papillomavirus-16/18-infected lung tumorigenesis. Clin. cancer Res. : An Official J. Am. Assoc. Cancer Res.. 14, 7173–7179. [DOI] [PubMed] [Google Scholar]
  11. Chiu, C.P. , Harley, C.B. , 1997. Replicative senescence and cell immortality: the role of telomeres and telomerase. Proc. Soc. Exp. Biol. Med.. 214, 99–106. [DOI] [PubMed] [Google Scholar]
  12. Cohen, S.B. , Graham, M.E. , Lovrecz, G.O. , Bache, N. , Robinson, P.J. , Reddel, R.R. , 2007. Protein composition of catalytically active human telomerase from immortal cells. Science. 315, 1850–1853. [DOI] [PubMed] [Google Scholar]
  13. Colgin, L.M. , Reddel, R.R. , 1999. Telomere maintenance mechanisms and cellular immortalization. Curr. Opin. Gen. Dev.. 9, 97–103. [DOI] [PubMed] [Google Scholar]
  14. Cools, J. , Stover, E.H. , Wlodarska, I. , Marynen, P. , Gilliland, D.G. , 2004. The FIP1L1-PDGFRalpha kinase in hypereosinophilic syndrome and chronic eosinophilic leukemia. Curr. Opin. Hematol.. 11, 51–57. [DOI] [PubMed] [Google Scholar]
  15. Daniel, M. , Peek, G.W. , Tollefsbol, T.O. , 2012. Regulation of the human catalytic subunit of telomerase (hTERT). Gene. 498, 135–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. de Vries, H. , Ruegsegger, U. , Hubner, W. , Friedlein, A. , Langen, H. , Keller, W. , 2000. Human pre-mRNA cleavage factor II(m) contains homologs of yeast proteins and bridges two other cleavage factors. EMBO J.. 19, 5895–5904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Deng, W.G. , Jayachandran, G. , Wu, G. , Xu, K. , Roth, J.A. , Ji, L. , 2007. Tumor-specific activation of human telomerase reverses transcriptase promoter activity by activating enhancer-binding protein-2beta in human lung cancer cells. J. Biol. Chem.. 282, 26460–26470. [DOI] [PubMed] [Google Scholar]
  18. Deng, W.G. , Tang, S.T. , Tseng, H.P. , Wu, K.K. , 2006. Melatonin suppresses macrophage cyclooxygenase-2 and inducible nitric oxide synthase expression by inhibiting p52 acetylation and binding. Blood. 108, 518–524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Deng, W.G. , Wu, K.K. , 2003. Regulation of inducible nitric oxide synthase expression by p300 and p50 acetylation. J. Immunol.. 171, 6581–6588. [DOI] [PubMed] [Google Scholar]
  20. Deng, W.G. , Zhu, Y. , Wu, K.K. , 2004. Role of p300 and PCAF in regulating cyclooxygenase-2 promoter activation by inflammatory mediators. Blood. 103, 2135–2142. [DOI] [PubMed] [Google Scholar]
  21. Ducrest, A.L. , Szutorisz, H. , Lingner, J. , Nabholz, M. , 2002. Regulation of the human telomerase reverse transcriptase gene. Oncogene. 21, 541–552. [DOI] [PubMed] [Google Scholar]
  22. Feng, J. , Funk, W.D. , Wang, S.S. , Weinrich, S.L. , Avilion, A.A. , Chiu, C.P. , Adams, R.R. , Chang, E. , Allsopp, R.C. , Yu, J. , 1995. The RNA component of human telomerase. Science. 269, 1236–1241. [DOI] [PubMed] [Google Scholar]
  23. Fujiki, T. , Miura, T. , Maura, M. , Shiraishi, H. , Nishimura, S. , Imada, Y. , Uehara, N. , Tashiro, K. , Shirahata, S. , Katakura, Y. , 2007. TAK1 represses transcription of the human telomerase reverse transcriptase gene. Oncogene. 26, 5258–5266. [DOI] [PubMed] [Google Scholar]
  24. Gotlib, J. , Cools, J. , Malone, J.M. , Schrier, S.L. , Gilliland, D.G. , Coutre, S.E. , 2004. The FIP1L1-PDGFRalpha fusion tyrosine kinase in hypereosinophilic syndrome and chronic eosinophilic leukemia: implications for diagnosis, classification, and management. Blood. 103, 2879–2891. [DOI] [PubMed] [Google Scholar]
  25. Harley, C.B. , 2008. Telomerase and cancer therapeutics. Nat. Rev. Cancer. 8, 167–179. [DOI] [PubMed] [Google Scholar]
  26. Hou, J. , Lin, L. , Zhou, W. , Wang, Z. , Ding, G. , Dong, Q. , Qin, L. , Wu, X. , Zheng, Y. , Yang, Y. , Tian, W. , Zhang, Q. , Wang, C. , Zhuang, S.M. , Zheng, L. , Liang, A. , Tao, W. , Cao, X. , 2011. Identification of miRNomes in human liver and hepatocellular carcinoma reveals miR-199a/b-3p as therapeutic target for hepatocellular carcinoma. Cancer Cell. 19, 232–243. [DOI] [PubMed] [Google Scholar]
  27. Kaufmann, I. , Martin, G. , Friedlein, A. , Langen, H. , Keller, W. , 2004. Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase. EMBO J.. 23, 616–626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kiefer, H. , Mizutani, A. , Iemura, S. , Natsume, T. , Ando, H. , Kuroda, Y. , Mikoshiba, K. , 2009. Inositol 1,4,5-triphosphate receptor-binding protein released with inositol 1,4,5-triphosphate (IRBIT) associates with components of the mRNA 3' processing machinery in a phosphorylation-dependent manner and inhibits polyadenylation. J. Biol. Chem.. 284, 10694–10705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kim, M.P. , Chen, Y. , Bekele, B.N. , Lopez, A. , Khanna, A. , Chen, J.Q. , Spitz, M.R. , Behrens, C. , Solis, L. , Wismach, M. , Ji, L. , Wistuba, I.I. , Roth, J.A. , Katz, R.L. , 2011. Activating enhancer-binding protein-2beta nucleolar localization predicts poor survival after stage I non-small cell lung cancer resection. Ann. Thorac Surg.. 92, 1044–1050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kleiman, F.E. , Manley, J.L. , 2001. The BARD1-CstF-50 interaction links mRNA 3' end formation to DNA damage and tumor suppression. Cell. 104, 743–753. [DOI] [PubMed] [Google Scholar]
  31. Kyo, S. , Takakura, M. , Fujiwara, T. , Inoue, M. , 2008. Understanding and exploiting hTERT promoter regulation for diagnosis and treatment of human cancers. Cancer Sci.. 99, 1528–1538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lantuejoul, S. , Soria, J.C. , Moro-Sibilot, D. , Morat, L. , Veyrenc, S. , Lorimier, P. , Brichon, P.Y. , Sabatier, L. , Brambilla, C. , Brambilla, E. , 2004. Differential expression of telomerase reverse transcriptase (hTERT) in lung tumours. Br. J. Cancer. 90, 1222–1229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Liu, J.P. , 1999. Studies of the molecular mechanisms in the regulation of telomerase activity. FASEB J. Official Pub. Fed. Am. Soc. Exp. Biol.. 13, 2091–2104. [DOI] [PubMed] [Google Scholar]
  34. Lu, M.H. , Liao, Z.L. , Zhao, X.Y. , Fan, Y.H. , Lin, X.L. , Fang, D.C. , Guo, H. , Yang, S.M. , 2012. hTERT-based therapy: a universal anticancer approach (Review). Oncol. Rep.. 28, 1945–1952. [DOI] [PubMed] [Google Scholar]
  35. McCracken, S. , Fong, N. , Yankulov, K. , Ballantyne, S. , Pan, G. , Greenblatt, J. , Patterson, S.D. , Wickens, M. , Bentley, D.L. , 1997. The C-terminal domain of RNA polymerase II couples mRNA processing to transcription. Nature. 385, 357–361. [DOI] [PubMed] [Google Scholar]
  36. Milyavsky, M. , Shats, I. , Erez, N. , Tang, X. , Senderovich, S. , Meerson, A. , Tabach, Y. , Goldfinger, N. , Ginsberg, D. , Harris, C.C. , Rotter, V. , 2003. Prolonged culture of telomerase-immortalized human fibroblasts leads to a premalignant phenotype. Cancer Res.. 63, 7147–7157. [PubMed] [Google Scholar]
  37. Nakamura, T.M. , Morin, G.B. , Chapman, K.B. , Weinrich, S.L. , Andrews, W.H. , Lingner, J. , Harley, C.B. , Cech, T.R. , 1997. Telomerase catalytic subunit homologs from fission yeast and human. Science. 277, 955–959. [DOI] [PubMed] [Google Scholar]
  38. Nemeroff, M.E. , Barabino, S.M. , Li, Y. , Keller, W. , Krug, R.M. , 1998. Influenza virus NS1 protein interacts with the cellular 30 kDa subunit of CPSF and inhibits 3'end formation of cellular pre-mRNAs. Mol. Cell. 1, 991–1000. [DOI] [PubMed] [Google Scholar]
  39. Rozenblatt-Rosen, O. , Nagaike, T. , Francis, J.M. , Kaneko, S. , Glatt, K.A. , Hughes, C.M. , LaFramboise, T. , Manley, J.L. , Meyerson, M. , 2009. The tumor suppressor Cdc73 functionally associates with CPSF and CstF 3' mRNA processing factors. Proc. Natl. Acad. Sci. U S A. 106, 755–760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ruden, M. , Puri, N. , 2013. Novel anticancer therapeutics targeting telomerase. Cancer Treat. Rev.. 39, 444–456. [DOI] [PubMed] [Google Scholar]
  41. Saretzki, G. , Sitte, N. , Merkel, U. , Wurm, R.E. , von Zglinicki, T. , 1999. Telomere shortening triggers a p53-dependent cell cycle arrest via accumulation of G-rich single stranded DNA fragments. Oncogene. 18, 5148–5158. [DOI] [PubMed] [Google Scholar]
  42. Shay, J.W. , Keith, W.N. , 2008. Targeting telomerase for cancer therapeutics. Br. J. Cancer. 98, 677–683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Takakura, M. , Kyo, S. , Kanaya, T. , Hirano, H. , Takeda, J. , Yutsudo, M. , Inoue, M. , 1999. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells. Cancer Res.. 59, 551–557. [PubMed] [Google Scholar]
  44. Tian, X. , Chen, B. , Liu, X. , 2010. Telomere and telomerase as targets for cancer therapy. Appl. Biochem. Biotechnol.. 160, 1460–1472. [DOI] [PubMed] [Google Scholar]
  45. Toomey, D. , Smyth, G. , Condron, C. , Kay, E. , Conroy, R. , Foley, D. , Hong, C. , Hogan, B. , Toner, S. , McCormick, P. , Broe, P. , Kelly, C. , Bouchier-Hayes, D. , 2001. Immune function, telomerase, and angiogenesis in patients with primary, operable nonsmall cell lung carcinoma: tumor size and lymph node status remain the most important prognostic features. Cancer. 92, 2648–2657. [DOI] [PubMed] [Google Scholar]
  46. Topalian, S.L. , Kaneko, S. , Gonzales, M.I. , Bond, G.L. , Ward, Y. , Manley, J.L. , 2001. Identification and functional characterization of neo-poly(A) polymerase, an RNA processing enzyme overexpressed in human tumors. Mol. Cell. Biol.. 21, 5614–5623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Weinrich, S.L. , Pruzan, R. , Ma, L. , Ouellette, M. , Tesmer, V.M. , Holt, S.E. , Bodnar, A.G. , Lichtsteiner, S. , Kim, N.W. , Trager, J.B. , Taylor, R.D. , Carlos, R. , Andrews, W.H. , Wright, W.E. , Shay, J.W. , Harley, C.B. , Morin, G.B. , 1997. Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT. Nat. Gen.. 17, 498–502. [DOI] [PubMed] [Google Scholar]
  48. Zhang, A. , Zheng, C. , Lindvall, C. , Hou, M. , Ekedahl, J. , Lewensohn, R. , Yan, Z. , Yang, X. , Henriksson, M. , Blennow, E. , Nordenskjold, M. , Zetterberg, A. , Bjorkholm, M. , Gruber, A. , Xu, D. , 2000. Frequent amplification of the telomerase reverse transcriptase gene in human tumors. Cancer Res.. 60, 6230–6235. [PubMed] [Google Scholar]
  49. Zhu, C.Q. , Cutz, J.C. , Liu, N. , Lau, D. , Shepherd, F.A. , Squire, J.A. , Tsao, M.S. , 2006. Amplification of telomerase (hTERT) gene is a poor prognostic marker in non-small-cell lung cancer. Br. J. Cancer. 94, 1452–1459. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecular Oncology are provided here courtesy of Wiley

RESOURCES