Skip to main content
NCBI home page
Molecular Oncology logoLink to Molecular Oncology
. 2015 Jul 3;9(9):1825–1833. doi: 10.1016/j.molonc.2015.06.007

ERBB3 is required for tumor promotion in a mouse model of skin carcinogenesis

Maik Dahlhoff 1, Matthias Schäfer 2, Sukalp Muzumdar 2, Christian Rose 3, Marlon R Schneider 1,✉
PMCID: PMC5528713  PMID: 26194695

Abstract

The epidermal growth factor receptor (EGFR) plays a key role in skin inflammation, wound healing, and carcinogenesis. Less is known about the functions of the structurally related receptor ERBB3 (HER3) in the skin. We assessed the requirement of ERBB3 for skin homeostasis, wound healing, and tumorigenesis by crossing mice carrying a conditional Erbb3 allele with animals expressing cre under the control of the keratin 5 promoter. Erbb3del mice, lacking ERBB3 specifically in keratinocytes, showed no obvious abnormalities. The EGFR was upregulated in Erbb3del skin, possibly compensating the loss of ERBB3. Nonetheless, healing of full‐thickness excisional wounds was negatively affected by ERBB3 deficiency. To analyze the function of ERBB3 during tumorigenesis, we employed the established DMBA/TPA multi‐stage chemical carcinogenesis protocol. Erbb3del mice remained free of papillomas for a longer time and had significantly reduced tumor burden compared to control littermates. Tumor cell proliferation was considerably reduced in Erbb3del mice, and loss of ERBB3 also impaired keratinocyte proliferation after a single application of TPA. In human skin tumor samples, upregulated ERBB3 expression was observed in squamous cell carcinoma, condyloma, and malignant melanoma. Thus, we conclude that ERBB3, while dispensable for the development and the homeostasis of the epidermis and its appendages, is required for proper wound healing and for the progression of skin tumors during multi‐stage chemical carcinogenesis in mice. ERBB3 may also be important for human skin cancer progression. The latter effects most probably reflect a key role for ERBB3 in increasing cell proliferation after stimuli as wounding or carcinogenesis.

Keywords: EGFR, ERBB3, Mouse, Skin, Carcinogenesis, Wound healing

Highlights

  • The EGFR‐related ERBB3 receptor is dispensable for skin development and homeostasis.

  • ERBB3 is required for wound healing and for the progression of skin tumors in mice.

  • ERBB3 may also be important for human skin cancer progression.

  • ERBB3 is an attractive drug target for skin cancer therapy.

1. Introduction

Nonmelanoma skin cancer (NMSC), whose major subtypes are basal cell carcinoma (BCC) and squamous cell carcinoma (SCC), shows a worldwide increasing incidence (Lomas et al., 2012). BCC is actually the most common human cancer and represents 2/3 of all skin cancers in patients of mixed European descent (Kasper et al., 2012). The epidermal growth factor receptor family of tyrosine kinases (EGFR, also known as ERBB1/HER1, ERBB2/HER2/neu, ERBB3/HER3, and ERBB4/HER4) plays a major role in the regulation of keratinocyte proliferation and differentiation, with implications for wound healing, skin inflammation and carcinogenesis (Schneider et al., 2008). These receptors, in particular EGFR and ERBB2, are also the target of several therapeutic agents used clinically to treat a number of cancer types (Yarden and Pines, 2012). In this study, we provide evidence that ERBB3 may be a promising target against NMSC.

Unlike other ERBB receptors, ERBB3 lacks intrinsic catalytic activity due to changes in the kinase domain, and can therefore not auto‐phosphorylate (Guy et al., 1994). Phosphorylation of ERBB3, which is indispensable for development, occurs by other family members, most commonly by ERBB2 (Yarden and Sliwkowski, 2001). The potential of ERBB3 as a target for cancer therapy, long clouded by its defective kinase activity, recently turned the object of intense investigation. Overexpression of ERBB3 has been detected in a variety of cancers, including those of the breast, lung, colon, ovary, and pancreas (Amin et al., 2010). More recent studies suggested that targeting ERBB3 may be of therapeutic value in colorectal (Lee et al., 2009) and luminal breast cancers (Morrison et al., 2013). Accordingly, considerable efforts have been put in the development of compounds that target this receptor either singly or in combination with other targets (Aurisicchio et al., 2012; Ma et al., 2014; Gaborit et al., 2015).

In the skin, ERBB3 was shown to be expressed in all epidermal layers, with highest levels in the suprabasal and spinous layers (Kiguchi et al., 2000; Piepkorn et al., 2003). However, apart from its potential involvement in wound repair (Okwueze et al., 2006; Forsberg and Rollman, 2010), little is known about its function in the skin. Here, we employed tissue‐specific gene deletion to assess the role of ERBB3 in skin homeostasis, wound healing, and tumorigenesis.

2. Materials and methods

2.1. Mice

Mice carrying floxed Erbb3 alleles (Lee et al., 2009) were obtained from the Mutant Mouse Regional Resource Center (MMRC, University of North Carolina). Mice expressing cre under the keratin 5 promoter (Ramirez et al., 2004) were a courtesy of A. Ramirez and J. Jorcano (CIEMAT, Madrid, Spain). Both mouse strains were maintained in the C57BL/6 background. Animals were maintained under specific pathogen‐free conditions and had access to water and standard rodent diet (V1534, Ssniff, Soest, Germany) ad libitum. All experiments were approved by the Committee on Animal Health and Care of the state of Upper Bavaria (Regierung von Oberbayern, Germany) or by the local veterinary authorities of Zurich (Switzerland). Genotyping of mouse lines and detection of the floxed and deleted Erbb3 alleles were performed according to the original publications.

2.2. Chemical skin carcinogenesis

Chemical carcinogenesis was carried out according to internationally accepted standards (Abel et al., 2009). Seven‐week‐old Erbb3 del females and control littermates were shaved on their backs and received a single application (400 nmol) of the initiating agent 7,12‐dimethylbenz(a)anthracene (DMBA, Sigma–Aldrich, Germany). This was followed by two weekly applications (10 nmol each) of the promoting agent 12‐O‐tetradecanoylphorbol‐13‐acetate (TPA, Sigma–Aldrich) for 22 weeks, after which mice were euthanized. Tumor development was assessed weekly. After euthanasia, tumors and skin samples were fixed in 4% paraformaldehyde (Sigma–Aldrich), dehydrated, and embedded in paraffin or snap‐frozen and stored at −80 °C. The following PCR primers were used for detecting Hras mutation: 5′‐CAGGAGCTCCTGGATTGGC‐3′; 5′‐GGTGGATATGAGCCAGCTAGC‐3′; procedures have been described previously (Dahlhoff et al., 2012).

For TPA‐induced hyperproliferation, shaved back skin was treated once with 10 nmol TPA or ethanol only (vehicle) and mice were sacrificed 24 h later. Epidermis thickness was measured on H&E‐stained skin sections over a length of 4.33 mm on 125 single points for each animal. For proliferation, both Ki67‐positive and negative nuclei were counted on pictures taken with a 200 magnification lens and a Leica DFC425C digital camera (Leica Microsystems GmbH, Wetzlar, Germany) covering a length of 4.33 mm.

2.3. Wound healing

Experimental wounding was performed as following: 8–10 week‐old female mice were anaesthetized by intraperitoneal injection of ketamine/xylazine and the back was shaved. Subsequently, two anterior and two posterior excision wounds (left and right from the midline), 5 mm in diameter were generated on the back skin using a circular blade. 5 days after wounding, mice were euthanized by carbon dioxide inhalation, wounds were excised, fixed in 4% paraformaldehyde in PBS, and embedded in paraffin. Subsequently, 7 μm sections were cut from the middle of the wounds, stained with H&E, photographed and wound morphometry was analyzed. The boundary between the dermis and granulation tissue was assigned as the wound edge. Length and area of the thickened epithelium outside the wound (defined as outer thickened epidermis; OTE) and of the wound epithelium (WE) was measured. Wound diameter was defined as the distance between the left and right wound edges. Wound closure was defined as the ratio of the sum of the lengths of the left and right wound epithelium to the wound diameter. Proliferation was analyzed in 1 anterior and 1 posterior wound each of 4 control and 4 Erbb3 del mice by performing immunofluorescence on paraffin sections using an anti‐PCNA primary antibody. Quantification was performed by counting the number of PCNA‐positive nuclei per length of outer thickened epithelium, and wound epithelium separately.

2.4. Immunohistochemistry

After euthanasia, skin samples were fixed in 4% paraformaldehyde, dehydrated, and embedded in paraffin. For target retrieval the section were boiled in a microwave oven for 20 min in 10 mM citrate buffer (pH 6.0). Tissue sections were incubated with an anti‐ERBB3 antibody (sheep anti ERBB3, AF4518, R&D Systems, 1:100) or with an anti‐Ki67 antibody (rat anti mouse Ki67, TEC‐3, DakoCytomation, 1:200) over night at 4 °C followed by incubation with a horseradish peroxidase conjugated secondary antibody (rabbit anti sheep, Vector Laboratories, 1:200) or rabbit anti rat antibody (DakoCytomation, E0468, 1:200) for 1 h at room temperature. 3,3′‐diaminobenzidine (KemEnTec, Copenhagen, Denmark) was used as a chromogen.

2.5. Immunofluorescence

Skin samples were fixed in ethanol with 1% acetic acid, dehydrated, and embedded in paraffin. Tissue sections were blocked with 3% BSA in PBS, 1% Tween (PBST) and incubated over night at 4 °C with rabbit anti‐keratin 10 (1:500), anti‐keratin 14 (1:50,000) or anti‐loricrin antibody (1:250) (Covance, Berkeley, CA) in blocking solution. Afterwards, slides were washed with PBST and incubated with goat anti‐rabbit cy3 antibody (1:250) (Jackson ImmunoResearch, West Grove, PA) and Hoechst (1:1000) (Sigma–Aldrich, Steinheim, Germany) in blocking solution for 2 h at RT. After washing with PBS the sections were mounted with Mowiol, 10% DABCO (Sigma–Aldrich).

PFA‐fixed, paraffin‐embedded sections from wounds were blocked using 12% BSA in PBS, incubated with an anti‐PCNA primary antibody (Santa Cruz Biotechnology, Heidelberg, Germany) at 4 °C over night, washed in PBS and incubated with an anti‐rabbit‐Cy3‐coupled secondary antibody (Jackson ImmunoResearch, West Grove, PA) for 1 h at room temperature. The slides were then washed with PBS, mounted with Mowiol/10% DABCO, photographed and analyzed.

2.6. Western blots

Protein was extracted using Laemmli‐extraction‐buffer, and the concentration was estimated via bicinchoninic acid assay. 30 μg of total protein were separated by 8% or 12% SDS‐PAGE and transferred to PVDF membranes (Millipore, Schwalbach, Germany) by semidry blotting. Membranes were blocked in 5% w/v fat‐free milk powder (Roth, Karlsruhe, Germany) for 1 h at room temperature. After washing in Tris‐buffered saline solution with 0.1% Tween 20 (Sigma, Taufkirchen, Germany), membranes were incubated over night at 4 °C in 5% w/v BSA (Sigma) with the appropriate primary antibody. All primary antibodies and their dilution are in Supplementary Table S1. Membranes were washed and incubated in 5% w/v fat‐free milk powder with a horseradish peroxidase‐labeled secondary antibody donkey anti‐rabbit (1:2000; NA934V, GE Healthcare, Munich, Germany). Signals were detected using an enhanced chemiluminescence detection reagent (GE Healthcare) and appropriate X‐ray films (GE Healthcare). After detection, membranes were stripped by incubation with an appropriate buffer (2% SDS, 62.5 mM Tris/HCl, pH 6.7 and 100 mM β‐mercaptoethanol) for 40 min at 70 °C and incubated with a second primary antibody recognizing the total protein of a phosphorylated protein or a housekeeping protein. Band density measurement was performed using ImageQuant software package (Molecular Dynamics, Krefeld, Germany), values were normalized to alpha tubulin.

2.7. Human skin samples

A paraffin tissue microarray panel (SK805, Skin disease spectrum) was purchased from US Biomax Inc. (Rockville, MD, USA) and immunohistochemically stained for ERBB3. The slide was unmasked by boiling for 20 min in 10 mM citrate buffer pH 6.0 and blocked by serum blocking reagent G (R&D Systems) for 15 min and 30 min with avidin biotin blocking reagents (R&D Systems). The slide was incubated over night at 4 °C with mouse anti human ERBB3 (R&D Systems, Wiesbaden‐Nordenstadt, Germany, 1:100; MAB3483) followed by incubation with a biotinylated rabbit anti mouse secondary antibody (1:200, R&D Systems). 3,3′‐diaminobenzidine was used as a chromogen. The tissue samples were scored by a pathologist using following score: 0 = staining is absent, 1 = staining intensity is comparable to normal epidermis, 2 = staining intensity is higher than in normal epidermis, 3 = staining is higher than in grade 2.

2.8. Statistical analysis

Data was analyzed with Student's t‐test and error bars represent SEM (GraphPad Prism, GraphPad Software, USA). A Two‐way ANOVA (GraphPad Prism) was performed for tumor incidence, tumor number per mouse, mean tumor size, and tumor burden. P < 0.05 was considered significant.

3. Results

3.1. ERBB3 is dispensable for skin development and homeostasis

To investigate the functions of ERBB3 in skin, we crossed mice carrying a conditional Erbb3 allele (Lee et al., 2009) with transgenic animals expressing cre recombinase under the keratin 5 promoter from embryonic day ∼15.5 (Ramirez et al., 2004). Recombination of the floxed Erbb3 allele (Figure 1A) specifically in the skin of K5Cre; Erbb3 f/f mice (hereafter called Erbb3 del mice) was confirmed by PCR analysis (Figure 1B). Immunohistochemistry revealed abundant presence of ERBB3 in the basal and suprabasal layers of control epidermis, while no ERBB3 could be detected in the epidermis of Erbb3 del mice (Figure 1C). Skin‐specific loss of ERBB3 did not affect animal behavior, body weight, or coat appearance, and evaluation of H&E‐stained skin sections revealed no changes in tissue architecture compared to control mice (data not shown). Also, immunofluorescence did not reveal changes in the expression pattern of the epidermal differentiation markers K14, K10, and loricrin (Figure 1D). Western blot analysis (Figure 1E) and its densitometric quantification (Figure 1F) confirmed loss of ERBB3 in the skin of Erbb3 del mice and, additionally, revealed a significant upregulation of EGFR compared to control mice. The remaining ERBB3 signals observed in the skin of Erbb3 del mice (Figure 1E) most probably reflect expression of the receptor in non‐epithelial cells such as fibroblasts, vascular, or neuronal cells.

Figure 1.

Figure 1

Open in a new tab

Erbb3 is dispensable for skin development and adult skin homeostasis. (A) Schematic representation of the floxed Erbb3 allele and the deleted allele after cre recombinase‐mediated deletion of exon 2. The large arrowheads represent loxP sites, the arrows indicate the position of PCR primers. (B) PCR showing the presence of a deleted Erbb3 allele exclusively in the skin (Sk) of Erbb3del mice; Amplification of Gapdh is shown as a control. Li, liver; Ki, kidney; He, heart; Sp, spleen; Mu, muscle. (C) Immunohistochemistry showing the normal level of ERBB3 in control mouse tail skin epidermis and the absence of the receptor in the epidermis of Erbb3del mice. (D) Immunofluorescence showing the distribution of the epidermal differentiation markers loricrin (Lor), keratin 10 (K10), and keratin 14 (K14) (green) in the back skin of Erbb3del and control mice. (E) Western blot of lysates back skin from Erbb3del and control mice. (F) Relative levels of the EGFR/ERBB receptors in back skin from Erbb3del and control mice. Values were normalized to tubulin. N = 4, **P < 0.01, ***P < 0.001. Scale bars represent 50 μm.

EGFR upregulation is likely to be a compensatory response to ERBB3 loss, and may explain the lack of an obvious skin phenotype in Erbb3 del mice. To evaluate whether ERBB3 loss and EGFR upregulation changed major ERBB signaling pathways in Erbb3 del skin, we next assessed the activation of MAPK, AKT, P38 and SAPK, as well as of S6RP and P70SEK, which are downstream of AKT, using phospho‐specific antibodies. No changes in the activation of these pathways could be detected (Supplementary Figure S1A). We did also not detect changes in the cleavage of caspase 3 or PARP (Supplementary Figure S1B), suggesting that apoptosis rate is not changed by ERBB3 loss in keratinocytes.

3.2. ERBB3 is required for proper skin wound healing

We next subjected Erbb3 del mice and control littermates to full‐thickness excisional wounding (two anterior and two posterior wounds per animal) and evaluated the healing process after 5 days. Representative anterior wounds from both genotypes are shown in Figure 2A. Histological examination and morphometric analysis revealed no changes in the length (Figure 2B) or area (Figure 2C) of the outer thickened epithelium (OTE) outside the wound. In contrast, length and area of the wound epithelium (WE) were significantly reduced in Erbb3 del mice wounds (Figure 2B,C). While no changes were detected in the wound diameter (Figure 2D), the reduced WE length and area were associated with an impaired overall wound closure in Erbb3 del mice (Figure 2E). Additionally, cell proliferation, measured by PCNA staining, was unchanged in the TE peripheral to the wound but was reduced in the WE in Erbb3 del mice (Figure 2F), although the difference did not reach statistical significance. This could explain the delay in wound closure in Erbb3 del mice. Our data indicate that ERBB3, while dispensable for skin development and homeostasis, is required for adequate wound healing.

Figure 2.

Figure 2

Open in a new tab

Loss of ERBB3 impairs full‐thickness wound healing. (A) Representative images of H&E‐stained wounds from Erbb3del and control mice. The outer thickened epithelium (OTE, highlighted in red), wound epithelium (WE, highlighted in blue), the wound edge (highlighted by dotted line), the eschar (ES), granulation tissue (G), epidermis (E), dermis (D), fat (F), and muscle (M) are indicated. Scale bar represents 50 μm. The OTE and WE length (B) and area (C), the wound diameter (D), wound closure (E), and the number of PCNA‐positive nuclei per length epithelium (F) were quantified on H&E‐stained sections using ImageJ. Wounds two from 4 control and 4 Erbb3del mice were analyzed using Student's t‐test, error bars represent SEM (n = 4/group). *P < 0.05, **P < 0.01.

3.3. Impaired tumor development after loss of ERBB3 in the skin

We next asked whether ERBB3 loss would affect tumor progression and subjected Erbb3 del mice and control littermates to a two‐step skin chemical carcinogenesis protocol (Abel et al., 2009) that includes a single DMBA application (tumor initiation) followed by repeated, twice weekly administration of TPA (tumor promotion). As expected, tumors became visible on the back skin of control mice from the 5th week after DMBA treatment, and all control mice showed at least one tumor by the 10th week (Figure 3A). In contrast, in Erbb3 del mice, the first tumors appeared only by the 10th week after DMBA, and by the end of the experiment (20 weeks after DMBA application) about 30% of the mice remained without any visible tumor (Figure 3A). The mean number of tumors per mouse increased with time in both groups, but remained significantly lower in Erbb3 del (∼1.5 tumors/mouse 20 weeks after DMBA) compared to control (7.5 tumors/mouse 20 weeks after DMBA) mice (Figure 3B). A similar effect was observed in the mean tumor size, which increased with time in both groups but was considerably smaller in Erbb3 del animals (∼1 mm at 20 weeks after DMBA) compared to control (∼4 mm at 20 weeks after DMBA) mice (Figure 3C).

Figure 3.

Figure 3

Open in a new tab

ERBB3 is required for skin tumor growth. Evaluation of the tumor incidence (A), tumor number/mouse (B), mean tumor size/mouse (C), and tumor burden (D) in Erbb3del (n = 12) and control (n = 10) mice. (E) Representative pictures of Erbb3del and control mice backs at the end of the experiment. (F) Histological analysis of H&E‐stained sections showing diffuse epithelial hyperproliferation in Erbb3del and full‐grown papillomas in control mice. (G) Immunohistochemical detection of Ki67 revealing strongly reduced cell proliferation in Erbb3del tumors (right panel) compared to control tumors (left panel). (H) XbaI restriction enzyme digest of a PCR‐amplified segment of the Hras gene showing the presence of a XbaI‐sensitive mutation in tumors from Erbb3del and control mice. Western blot of lysates from Erbb3del and control tumors for detecting EGFR/ERBB receptors (I) and phosphorylated or total MAPK and AKT (J). Data in B–D are means ± SEM. Two‐way ANOVA of data in A–D revealed a significant difference between genotypes, P < 0.0001. Scale bars represent 1 mm in F and G.

These findings are reflected in a significantly lower tumor burden in Erbb3 del mice compared to control animals (Figure 3D), which is illustrated by representative images in Figure 3E. Histologic evaluation of H&E‐stained sections revealed that tumors from control mice were typical papillomas with well‐delimited basement membranes enclosed by hyperplastic epidermis with orthologous keratinization, while tumors from Erbb3 del mice were characterized by a visible, but comparatively weak diffuse hyperplasia of the epidermis (Figure 3F). Ki67 staining revealed robust cell proliferation in control papillomas, with several layers of Ki67‐positive cells present at the bottom of the tumors (Figure 3G). In contrast, proliferation was considerably lower and was restricted to a single, regularly interrupted Ki67‐positive layer at the base of the hyperplastic lesions in Erbb3 del tumors (Figure 3G). Immunofluorescence did not reveal changes in the expression pattern of the epidermal differentiation markers K10, loricrin, but a focal upregulation of K6 was observed in Erbb3 del tumors (Supplementary Figure S2). DMBA treatment is known to induce an A → T transversion at the second position of codon 61 of the Hras gene, which can be easily detected by PCR and restriction fragment length polymorphism (Dahlhoff et al., 2012). We detected a Hras mutation in all examined tumors from control and Erbb3 del mice (n = 4/group), while the mutation was absent as expected in non DMBA‐treated tail skin (representative images are shown in Figure 3H).

These data suggest that, in Erbb3 del mice, DMBA‐mediated skin tumor initiation is retarded and the promotion to full papillomas is completely blocked, most likely due to the severely impaired tumor cell proliferation in the absence of ERBB3. In contrast to normal skin (Figure 1E), EGFR levels were not upregulated in Erbb3 del tumors, which also showed unchanged ERBB2 and ERBB4 levels, while ERBB3 was completely absent (Figure 3I). Surprisingly, Western blot analysis revealed increased phosphorylation of MAPK and AKT in Erbb3 del tumors (Figure 3J), while the levels of P38, SAPK, S6RP and P70SEK (Supplementary Figure S3A) and those of cleaved caspase 3 and PARP (Supplementary Figure S3B) remained unchanged compared to control tumors.

3.4. Loss of ERBB3 impairs TPA‐induced epidermal hyperproliferation

Our data suggest that loss of ERRB3 impairs cell proliferation induced by stimuli as wounding and Hras‐induced carcinogenesis. To confirm this observation, we treated Erbb3 del and control mice once with TPA or vehicle and assessed epidermal thickness and proliferation 24 h later. As shown in Figure 4A, loss of ERBB3 did not affect epidermal thickness or proliferation in vehicle‐treated mice. In contrast, the TPA‐induced increase in epidermal thickness and proliferation was significantly weaker in Erbb3 del compared to control mice (Figure 4B).

Figure 4.

Figure 4

Open in a new tab

Loss of ERBB3 decreases epidermal thickness and hyperproliferation induced by TPA. (A) Immunohistochemistry showing Ki67 positive nuclei in the epidermis of vehicle‐treated back skin of control and Erbb3del mice and quantitative assessment of epidermal thickness and proliferation. (B) The same analysis is shown for TPA‐treated control mice and Erbb3del mice. Data were analyzed with Student's t‐test and error bars represent SEM. P < 0.05 was considered significant. *P < 0.05, ***P < 0.001. n = 5 animals per group. Scale bars represent 50 μm.

3.5. ERBB3 expression is upregulated in human skin tumor samples

To study the role of ERBB3 in human skin cancer, we assessed the expression of ERBB3 in normal human skin and in different skin cancer types by immunohistochemistry. As shown in Figure 5A, ERBB3 expression in BCC and basal cell papilloma samples did not differ from that in normal skin (which was graded as “1”). In contrast, a significantly increased ERBB3 expression compared to normal skin was found in condyloma, malignant melanoma, and SCC samples, indicating that enhanced ERBB3 activity is associated with skin cancer development. Representative images of ERBB3‐stained normal skin and of the examined cancer types are shown in Figure 5B.

Figure 5.

Figure 5

Open in a new tab

ERBB3 is increased in human squamous cell carcinoma (SCC), malignant melanoma (MM) and condyloma. (A) Expression levels of ERBB3 in normal human skin and different skin diseases. (B) Representative pictures of ERBB3 immunohistochemical staining in human skin epidermis, in basal cell carcinoma (BCC), basal cell papilloma (BCP), condyloma, MM, and SCC. Score: 0 = staining is absent, 1 = staining intensity is comparable to normal epidermis, 2 = staining intensity is higher than in normal epidermis, 3 = staining is higher than in grade 2. Data was analyzed with Student's t‐test and error bars represent SEM.

4. Discussion

In this study, we evaluated the requirement of the ERBB3 receptor for skin physiology, wound healing, and carcinogenesis. Our data indicate that while ERBB3 is dispensable for the development and the homeostasis of the epidermis and its appendages, skin‐specific ERBB3 ablation negatively affects wound healing. The latter finding, probably a consequence of reduced proliferation of the wound epithelium, substantiates previous reports implicating the EGFR/ERBB system in general (Schneider et al., 2008), and ERBB3 in particular (Okwueze et al., 2006; Forsberg and Rollman, 2010) in wound healing.

More importantly, loss of ERBB3 completely prevented the growth of papillomas in the DMBA/TPA carcinogenesis model, indicating that this receptor is essential for skin tumor promotion. Collectively, data derived from wounding experiments, Hras‐induced carcinogenesis, and TPA‐induced hyperproliferation suggest that loss of ERBB3 severely compromises the proliferation normally associated with such stimuli. Our results differ in part from those reported on the influence of ERBB3 on the growth of intestinal tumors in mice. While intestine‐specific loss of ERBB3 almost completely abrogated the appearance of intestinal tumors in the Apc Min mouse model of colon cancer, which is in agreement with our data on skin tumors, ERBB3‐deficient intestinal tumors showed reduced AKT signaling and increased caspase 3‐mediated tumor cell apoptosis (Lee et al., 2009), which were not detected in our model. Thus, ERBB3 seems to have different effects depending on the specific tumor type.

The finding of increased MAPK and AKT signaling in Erbb3 del tumors represents a puzzling observation, in particular considering the reduced cell proliferation and unchanged EGFR levels. Possible explanations include compensatory upregulation of other so far unidentified signaling pathways or an experimental artefact: While full‐grown papillomas from control mice contain large amounts of terminally differentiated and metabolically inactive keratinocytes along with cellular debris, tumor samples from Erbb3 del mice frequently included hyperproliferative epithelium (compare Figure 3F), in which vigorous MAPK and AKT signaling would be expected.

Previous studies, limited to a small number of cases and based mainly on RT‐PCR analysis, suggested that high ERBB3 expression is associated with increased malignancy of human NMSC (Krahn et al., 2001; Wimmer et al., 2008). It has also been shown that ERBB3 is important for melanoma cell proliferation, migration, and invasion in vitro, and that this receptor is frequently expressed in human melanoma and metastases at elevated levels and correlates with reduced patient survival (Reschke et al., 2008; Buac et al., 2009). We confirmed and expanded these findings by showing that ERBB3 expression is upregulated in squamous cell carcinoma, condyloma, and malignant melanoma in human skin tumors samples. Our study therefore supports the concept that ERBB3 represents an important therapeutic target, which has already been demonstrated in melanoma cell lines (Belleudi et al., 2012; Fattore et al., 2013). This concept has been recently boosted by the report that ERBB3 may be able to catalyze auto‐phosphorylation, even if with a considerably weaker activity compared to the EGFR (Shi et al., 2010). Thus, targeting ERBB3 alone or in combination with other ERBBs by using monospecific or bispecific antibodies (Aurisicchio et al., 2012) may be an effective strategy for treating a wide range of skin tumors.

In conclusion, while ERBB3 is dispensable for the development and the homeostasis of the epidermis and its appendages, this receptor is required for proper wound healing and for the progression of skin tumors during multi‐stage chemical carcinogenesis in mice. As ERBB3 expression is increased in different skin tumor types, our report highlights the potential of targeting ERBB3 for treating human skin cancer.

Funding

This work was supported by a research grant of the Deutsche Forschungsgemeinschaft (DFG, SCHN 1081/3‐3) to MRS.

Conflict of interest statement

The authors state no conflict of interest.

Supporting information

Supplementary Figures 1–3 and Supplementary Table 1 can be found at http://www.moloncol.org/

The following are the supplementary data related to this article:

Supplementary data

Click here for additional data file. (239.7KB, pdf)

Supplementary data

Click here for additional data file. (920.5KB, pdf)

Supplementary data

Click here for additional data file. (147KB, pdf)

Supplementary data

Click here for additional data file. (15.6KB, docx)

Acknowledgments

We thank Dr. Ingrid Renner‐Müller and Petra Renner (Gene Center, LMU Munich) for excellent animal care, Angel Ramirez and Jose Jorcano (CIEMAT, Madrid, Spain) for providing K5‐Cre mice and Sabine Werner (ETH Zurich, Zurich, Switzerland) for constant support.

Supplementary data 1.

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.molonc.2015.06.007.

Dahlhoff Maik, Schäfer Matthias, Muzumdar Sukalp, Rose Christian, Schneider Marlon R., (2015), ERBB3 is required for tumor promotion in a mouse model of skin carcinogenesis, Molecular Oncology, 9, doi: 10.1016/j.molonc.2015.06.007.

References

  1. Abel, E.L. , Angel, J.M. , Kiguchi, K. , Digiovanni, J. , 2009. Multi-stage chemical carcinogenesis in mouse skin: fundamentals and applications. Nat. Protoc. 4, 1350–1362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amin, D.N. , Campbell, M.R. , Moasser, M.M. , 2010. The role of HER3, the unpretentious member of the HER family, in cancer biology and cancer therapeutics. Semin. Cell Dev. Biol. 21, 944–950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aurisicchio, L. , Marra, E. , Roscilli, G. , Mancini, R. , Ciliberto, G. , 2012. The promise of anti-ErbB3 monoclonals as new cancer therapeutics. Oncotarget. 3, 744–758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Belleudi, F. , Marra, E. , Mazzetta, F. , Fattore, L. , Giovagnoli, M.R. , Mancini, R. , Aurisicchio, L. , Torrisi, M.R. , Ciliberto, G. , 2012. Monoclonal antibody-induced ErbB3 receptor internalization and degradation inhibits growth and migration of human melanoma cells. Cell Cycle. 11, 1455–1467. [DOI] [PubMed] [Google Scholar]
  5. Buac, K. , Xu, M. , Cronin, J. , Weeraratna, A.T. , Hewitt, S.M. , Pavan, W.J. , 2009. NRG1/ERBB3 signaling in melanocyte development and melanoma: inhibition of differentiation and promotion of proliferation. Pigment Cell Melanoma Res. 22, 773–784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dahlhoff, M. , Rose, C. , de Angelis, M.H. , Wolf, E. , Schneider, M.R. , 2012. Negative feedback mechanisms surpass the effect of intrinsic EGFR activation during skin chemical carcinogenesis. Am. J. Pathol. 180, 1378–1385. [DOI] [PubMed] [Google Scholar]
  7. Fattore, L. , Marra, E. , Pisanu, M.E. , Noto, A. , De Vitis, C. , Belleudi, F. , Aurisicchio, L. , Mancini, R. , Torrisi, M.R. , Ascierto, P.A. , Ciliberto, G. , 2013. Activation of an early feedback survival loop involving phospho-ErbB3 is a general response of melanoma cells to RAF/MEK inhibition and is abrogated by anti-ErbB3 antibodies. J. Transl. Med. 11, 180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Forsberg, S. , Rollman, O. , 2010. Re-epithelialization from human skin explant cultures is promoted by ligand-activated HER3 receptor. J. Dermatol. Sci. 59, 7–15. [DOI] [PubMed] [Google Scholar]
  9. Gaborit, N. , Abdul-Hai, A. , Mancini, M. , Lindzen, M. , Lavi, S. , Leitner, O. , Mounier, L. , Chentouf, M. , Dunoyer, S. , Ghosh, M. , Larbouret, C. , Chardes, T. , Bazin, H. , Pelegrin, A. , Sela, M. , Yarden, Y. , 2015. Examination of HER3 targeting in cancer using monoclonal antibodies. Proc. Natl. Acad. Sci. U. S. A. 112, 839–844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Guy, P.M. , Platko, J.V. , Cantley, L.C. , Cerione, R.A. , Carraway, K.L. , 1994. Insect cell-expressed p180erbB3 possesses an impaired tyrosine kinase activity. Proc. Natl. Acad. Sci. U. S. A. 91, 8132–8136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kasper, M. , Jaks, V. , Hohl, D. , Toftgard, R. , 2012. Basal cell carcinoma – molecular biology and potential new therapies. J. Clin. Invest. 122, 455–463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kiguchi, K. , Bol, D. , Carbajal, S. , Beltran, L. , Moats, S. , Chan, K. , Jorcano, J. , Digiovanni, J. , 2000. Constitutive expression of erbB2 in epidermis of transgenic mice results in epidermal hyperproliferation and spontaneous skin tumor development. Oncogene. 19, 4243–4254. [DOI] [PubMed] [Google Scholar]
  13. Krahn, G. , Leiter, U. , Kaskel, P. , Udart, M. , Utikal, J. , Bezold, G. , Peter, R.U. , 2001. Coexpression patterns of EGFR, HER2, HER3 and HER4 in non-melanoma skin cancer. Eur. J. Cancer. 37, 251–259. [DOI] [PubMed] [Google Scholar]
  14. Lee, D. , Yu, M. , Lee, E. , Kim, H. , Yang, Y. , Kim, K. , Pannicia, C. , Kurie, J.M. , Threadgill, D.W. , 2009. Tumor-specific apoptosis caused by deletion of the ERBB3 pseudo-kinase in mouse intestinal epithelium. J. Clin. Invest. 119, 2702–2713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lomas, A. , Leonardi-Bee, J. , Bath-Hextall, F. , 2012. A systematic review of worldwide incidence of nonmelanoma skin cancer. Br. J. Dermatol. 166, 1069–1080. [DOI] [PubMed] [Google Scholar]
  16. Ma, J. , Lyu, H. , Huang, J. , Liu, B. , 2014. Targeting of erbB3 receptor to overcome resistance in cancer treatment. Mol. Cancer. 13, 105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Morrison, M.M. , Hutchinson, K. , Williams, M.M. , Stanford, J.C. , Balko, J.M. , Young, C. , Kuba, M.G. , Sanchez, V. , Williams, A.J. , Hicks, D.J. , Arteaga, C.L. , Prat, A. , Perou, C.M. , Earp, H.S. , Massarweh, S. , Cook, R.S. , 2013. ErbB3 downregulation enhances luminal breast tumor response to antiestrogens. J. Clin. Invest. 123, 4329–4343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Okwueze, M.I. , Cardwell, N.L. , Pollins, A.C. , Nanney, L.B. , 2006. Modulation of porcine wound repair with a transfected ErbB3 gene and relevant EGF-like ligands. J. Invest. Dermatol. 127, 1030–1041. [DOI] [PubMed] [Google Scholar]
  19. Piepkorn, M. , Predd, H. , Underwood, R. , Cook, P. , 2003. Proliferation-differentiation relationships in the expression of heparin-binding epidermal growth factor-related factors and erbB receptors by normal and psoriatic human keratinocytes. Arch. Dermatol. Res. 295, 93–101. [DOI] [PubMed] [Google Scholar]
  20. Ramirez, A. , Page, A. , Gandarillas, A. , Zanet, J. , Pibre, S. , Vidal, M. , Tusell, L. , Genesca, A. , Whitaker, D.A. , Melton, D.W. , Jorcano, J.L. , 2004. A keratin K5Cre transgenic line appropriate for tissue-specific or generalized Cre-mediated recombination. Genesis. 39, 52–57. [DOI] [PubMed] [Google Scholar]
  21. Reschke, M. , Mihic-Probst, D. , van der Horst, E.H. , Knyazev, P. , Wild, P.J. , Hutterer, M. , Meyer, S. , Dummer, R. , Moch, H. , Ullrich, A. , 2008. HER3 is a determinant for poor prognosis in melanoma. Clin. Cancer Res. 14, 5188–5197. [DOI] [PubMed] [Google Scholar]
  22. Schneider, M.R. , Werner, S. , Paus, R. , Wolf, E. , 2008. Beyond wavy hairs: the epidermal growth factor receptor and its ligands in skin biology and pathology. Am. J. Pathol. 173, 14–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Shi, F. , Telesco, S.E. , Liu, Y. , Radhakrishnan, R. , Lemmon, M.A. , 2010. ErbB3/HER3 intracellular domain is competent to bind ATP and catalyze autophosphorylation. Proc. Natl. Acad. Sci. U. S. A. 107, 7692–7697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Wimmer, E. , Kraehn-Senftleben, G. , Issing, W.J. , 2008. HER3 expression in cutaneous tumors. Anticancer Res. 28, 973–979. [PubMed] [Google Scholar]
  25. Yarden, Y. , Pines, G. , 2012. The ERBB network: at last, cancer therapy meets systems biology. Nat. Rev. Cancer. 12, 553–563. [DOI] [PubMed] [Google Scholar]
  26. Yarden, Y. , Sliwkowski, M.X. , 2001. Untangling the ErbB signalling network. Nat. Rev. Mol. Cell Biol. 2, 127–137. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures 1–3 and Supplementary Table 1 can be found at http://www.moloncol.org/

The following are the supplementary data related to this article:

Supplementary data

Click here for additional data file. (239.7KB, pdf)

Supplementary data

Click here for additional data file. (920.5KB, pdf)

Supplementary data

Click here for additional data file. (147KB, pdf)

Supplementary data

Click here for additional data file. (15.6KB, docx)

Articles from Molecular Oncology are provided here courtesy of Wiley

RESOURCES