Skip to main content
NCBI home page
Molecular Oncology logoLink to Molecular Oncology
. 2015 Jan 5;9(4):818–833. doi: 10.1016/j.molonc.2014.12.008

Ascochlorin, an isoprenoid antibiotic inhibits growth and invasion of hepatocellular carcinoma by targeting STAT3 signaling cascade through the induction of PIAS3

Xiaoyun Dai 1,†, Kwang Seok Ahn 2,†, Chulwon Kim 2, Kodappully Sivaraman Siveen 1, Tina H Ong 3, Muthu K Shanmugam 1, Feng Li 1, Jizhong Shi 1,4, Alan Prem Kumar 1,4,5,6, Ling Zhi Wang 1,4, Boon Cher Goh 1,4,7, Junji Magae 8, Kam M Hui 3,9,10,11,✉, Gautam Sethi 1,5,✉
PMCID: PMC5528777  PMID: 25624051

Abstract

Deregulated activation of oncogenic transcription factors such as signal transducer and activator of transcription 3 (STAT3) plays a pivotal role in proliferation and survival of hepatocellular carcinoma (HCC). Thus, agents which can inhibit STAT3 activation may have an enormous potential for treatment of HCC patients. Hence, in the present report, we investigated the effect of ascochlorin (ASC), an isoprenoid antibiotic on STAT3 activation cascade in various HCC cell lines and orthotopic mouse model. We observed that ASC could substantially inhibit both constitutive and IL‐6/EGF inducible STAT3 activation as well as reduce its DNA binding ability. ASC increased the expression of protein inhibitor of activated STAT3 (PIAS3) which could bind to STAT3 DNA binding domain and thereby down‐regulate STAT3 activation. Deletion of PIAS3 gene by siRNA abolished the ability of ASC to inhibit STAT3 activation and induce apoptosis in HCC cells. ASC also modulated the expression of diverse STAT3‐regulated oncogenic gene products. Finally, when administered intraperitoneally, ASC also inhibited tumor growth in an orthotopic HCC mouse model and reduced STAT3 activation in tumor tissues. Overall our results indicate that ASC mediates its anti‐tumor effects predominantly through the suppression of STAT3 signaling cascade, and can form the basis of novel therapy for HCC patients.

Keywords: Ascochlorin, HCC, STAT3, PIAS3, Invasion, Orthotopic model

Highlights

  • ASC abrogates both constitutive and IL‐6/EGF inducible STAT3 activation in HCC cells.

  • ASC reduces cell viability, migration/invasion and induces apoptosis in HCC cells.

  • ASC inhibits tumor growth at very low doses in an orthotopic HCC mouse model.

Abbreviations

ASC

ascochlorin

STAT3

signal transducer and activator of transcription 3

HCC

hepatocellular carcinoma

FBS

fetal bovine serum

MTT

3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl-2H-tetrazolium bromide

PIAS3

the protein inhibitor of activated STAT3

MMP-9

matrix metalloproteinase-9

JAK

janus kinase

PARP

poly (ADP-ribose) polymerase

1. Introduction

Hepatocellular carcinoma (HCC) is the sixth most commonly diagnosed cancer and the third most common cause of cancer mortality in the world. The treatment outcome of HCC is far from satisfactory as this malignancy has a dismal 5‐year survival rate of approximately 10% (Altekruse et al., 2009). Chemotherapeutic drugs, such as cisplatin, doxorubicin and fluorouracil are most commonly used treatment options, especially for patients with unresectable HCC tumors. However, because of poor response rates to chemotherapy, severe toxicities and high recurrence rates, the mean survival time for advanced stage disease is only 6 months (Thomas and Zhu, 2005). Thus, more effective agents are urgently required to clinically combat this lethal malignancy.

Recent evidences suggest that STAT family proteins, especially STAT3, play a crucial role in inducing as well as maintaining a pro‐carcinogenic inflammatory microenvironment, promoting malignant transformation and cancer progression (Mantovani et al., 2008; Yu et al., 2009). Phosphorylation at tyrosine residue (Tyr705) is critical for STAT3 activation, which contributes to its dimerization that is a prerequisite for nucleus entry and DNA binding (Subramaniam et al., 2013b). Activation of STAT3 is the most frequently mediated by receptor tyrosine kinases such as JAK1 and JAK2, but it also can be activated by other mechanism(s), including reversible acetylation and non‐receptor tyrosine kinases such as Src which is upstream of STAT3 and commonly overexpressed in a variety of solid tumor cells (Heinrich et al., 2003; Levy and Darnell, 2002). Cytokine‐induced STAT3 activation is a transient event in normal cells, because this activity can be controlled by negative feedback loops, and which in turn is regulated by diverse proteins including those of protein inhibitor of activated STAT (PIAS) family, especially PIAS3, that bind specifically to STAT3 and abrogate its activity (Chung et al., 1997).

However, in tumor cells STAT3 is often found to be constitutively activated through other diverse mechanism(s) as well (He and Karin, 2011). Persistent activation of STAT3 has also been found in the majority of HCC patient tissues but not in surrounding normal liver tissues and has been closely associated with poor prognosis (Calvisi et al., 2006). Accumulating evidences have demonstrated that STAT3 is an attractive molecular target both for cancer treatment and prevention (Siveen et al., 2014). For example, phosphopeptides and their derivative peptidomimetics have been designed to block STAT3 dimerization and DNA‐binding activity (Turkson et al., 2004, 2001). Furthermore, AG490, a Janus kinase (JAK) specific inhibitor, significantly inhibited the expression of p‐STAT3, and subsequently reduced invasion and adhesion of human pancreatic cancer cells (Huang et al., 2006). Thus, blockage of STAT3 activation by using diverse pharmacological agents can be considered as an important therapeutic strategy for HCC management.

One potential source of STAT3 inhibitors is agents derived from natural sources, because approximately 74.8% (131/175) of all anti‐cancer drugs approved either were isolated from natural sources or mimicked them in one form or another (1981–2010) (Newman and Cragg, 2012). ASC an isoprenoid antibiotic, isolated from a culture broth of the phytopathogenic fungus, Ascochyta viciae, has been found to exhibit diverse antiviral and antifungal activities (Tamura et al., 1968). In addition to its reported antimicrobial effects, natural and synthetic derivatives of ASC can suppress hypertension (Hosokawa et al., 1981), induce immunomodulation (Magae et al., 1986), and ameliorate type I as well as type II diabetes (Hosokawa et al., 1985). Interestingly, few recent studies have indicated that ASC may also exhibit anti‐cancer activities in various tumor cells, primarily mediated through activation of p53 and inhibition of the mitochondrial cytochrome bc1 complex and activator protein‐1 (AP‐1), leading to the suppression of the extra‐cellular enzyme, matrix metalloproteinase‐9 (MMP9) (Hong et al., 2005; Jeong and Chang, 2010; Jeong et al., 2009). However, the detailed molecular mechanism(s) through which ASC exhibits its anti‐cancer effects still remains to be elucidated.

In this study, we specifically investigated whether ASC could suppress the growth of HCC in vitro and in vivo by down‐regulating STAT3 signaling pathway, which plays a pivotal role in HCC initiation and progression. Our results indeed indicate for the first time that ASC could effectively abrogate both constitutive and inducible STAT3 activation in HCC cells through modulating upstream kinases and PIAS3 expression. Interestingly, this isoprenoid antibiotic also down‐regulated expression of proliferative, anti‐apoptotic as well as invasive gene products, leading to the suppression of proliferation, migration/invasion and induction of apoptosis in HCC cells. Alongside the effects of ASC in vitro, we also found that ASC significantly suppressed the growth of human HCC cells in an orthotopic mouse model and abrogated STAT3 activation in tumor tissues.

2. Materials and methods

2.1. Reagents

ASC was kindly provided by Dr. Junji Magae at Magae Bioscience Institute (Japan). ASC was dissolved in dimethylsulfoxide as a 50 mmol/L stock solution and stored at 4 °C. Further dilution was done in cell culture medium. DAPI, MTT, Tris, glycine, Sodium orthovanadate (90% titration), NaCl, SDS, BSA, IL‐6 and EGF were purchased from Sigma (St. Louis, MO). DMEM, 10% FBS were obtained from Life Technologies (Carlsbad, CA). Rabbit or mouse monoclonal antibodies against phospho‐STAT3 (Ser 727), STAT3, PARP, XIAP, SHP‐1, SHP‐2, PTEN, PTP1B, PIAS3, Bak, Bcl‐2, cyclin D1, Bid, MMP‐9, survivin, Mcl‐1, caspase‐3, caspase‐8 and caspase‐9 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies to phospho‐STAT3 (Tyr 705), phospho‐specific Src (Tyr 416), Src, phospho‐specific JAK2 (Tyr 1007/1008), JAK2, phospho‐specific JAK1 (Tyr 1022/1023), JAK1, phospho‐specific STAT5 (Tyr 694), and STAT5 were purchased from Cell Signaling Technology (Beverly, MA). The siRNA for PIAS3 (sc‐37005) and scrambled control (sc‐37007) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Goat anti‐rabbit–horse radish per‐oxidase (HRP) conjugate and goat anti‐mouse HRP were purchased from Sigma–Aldrich (St. Louis, MO). Bacteria‐derived recombinant human IL‐6 was purchased from ProSpec‐Tany Techno Gene Ltd.

2.2. Cell lines

HepG2, Hep3B and Huh7 were obtained from American Type Culture Collection. All the HCC cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 1X antibiotic‐antimycotic solution with 10% FBS. HCCLM3 was a kind gift of Professor Zhao‐You Tang at the Liver Cancer Institute (Zhongshan Hospital, Fudan University, Shanghai). HCCLM3 were cultured in high glucose DMEM containing 1X antibiotic‐antimycotic solution with 10% FBS.

2.3. Western blotting

Whole‐cell extracts were lysed in lysis buffer (250 mM NaCl, 20 mM HEPES, 2 mM EDTA (pH 8.0), 0.5 mM EGTA, 0.1% Triton X‐100, 1.5 μg/mL aprotinin, 1.5 μg/mL leupeptin, 1 mM PMSF, and 1.5 mM Na3VO4). Lysates were then spun at 13,300 rpm for 10 min to remove insoluble material and resolved on a 10% SDS gel. After electrophoresis, the proteins were electro‐transferred to a nitrocellulose membrane (Biorad), blocked with Blocking One (Nacalai Tesque, Inc.), and probed with primary antibodies of interest overnight at 4 °C. The blot was washed, exposed to HRP‐conjugated secondary antibodies for 1 h, and finally examined by chemiluminescence (ECL; Amersham Pharmacia Biotech).

2.4. Wound healing assay

HCC cells were seeded in the culture‐insert (Ibidi) until fully confluent. A cell‐free gap of 500 μm was created after removing the Culture‐Insert. After incubation with 50 μM ASC for 8 h, the medium was changed to medium with or without CXCL12. After migration for 24 h, the wounds were stained and observed using bright field microscopy.

2.5. Invasion assay

An in vitro cell invasion assay was performed using Bio‐Coat Matrigel invasion assay system (BD Biosciences, San Jose, CA), as described previously (Manu et al., 2013).

2.6. DNA binding assay

To determine the effect of ASC on STAT3 DNA binding activity, we performed DNA binding assay using TransAM STAT3 transcription factor assay kit (Active Motif, Carlsbad, CA) according to the manufacturer's instructions and as described previously (Subramaniam et al., 2013a).

2.7. Immunocytochemistry

HepG2 cells were plated in 8 chamber slides in DMEM containing 10% FBS and allowed to adhere for overnight. After treatment with 50 μM ASC for 8 h, the cells were fixed with cold acetone for 15 min, washed with PBS and blocked with 5% normal goat serum for 1 h. The cells were incubated with rabbit polyclonal anti‐human STAT3 (dilution, 1:100). After overnight incubation, the slides were washed and then incubated with goat anti‐rabbit IgG‐Alexa 488 (dilution, 1:100) for 1 h and counterstained for nuclei with DAPI (50 ng/ml) for 5 min. Stained slides will be mounted with mounting medium (Sigma–Aldrich) and analyzed under a fluorescence microscope (Olympus DP 70, Japan).

2.8. Colony forming assay

HepG2 cells (600–800 cells/well) were seeded in 6‐well plate for 24 h, and then treated with various concentrations of ASC. After incubation for 72 h, the cells were washed by PBS and cultured in normal medium for two weeks. At the end of time point, colonies were washed with PBS, fixed with methanol and thereafter stained with 1% crystal violet solution. Colonies with >50 cells were counted under microscope.

2.9. MTT assay

The anti‐proliferative effects of ASC against various HCC cells were determined by the MTT dye uptake method as described previously (Ramachandran et al., 2012). Briefly, the cells (7 × 103) were seeded in a 96‐well plate overnight, and then treated with or without different concentrations of ASC for indicated time intervals at 37 °C. Thereafter, 20 μL MTT solution (5 mg/mL in PBS) was added to each well. After 2 h incubation at 37 °C, 0.1 mL lysis buffer (20% SDS, 50% dimethylformamide) was added after removal of the medium and incubation at 37 °C for 1 h; and then the optical density (OD) at 570 nm was measured by Tecan plate reader.

2.10. Apoptosis detection – DNA fragmentation by ELISA

Cellular DNA fragmentation was detected using cell death detection ELISAPLUS kit according to the manufacturer's protocol (Roche Molecular Biochemicals, Mannheim, Germany) and as described previously (Shanmugam et al., 2014).

2.11. TUNEL assay

Apoptosis of cells was also determined by TUNEL enzyme kit (Roche Molecular Biochemicals, Mannheim, Germany) according to manufacturer's instruction.

2.12. STAT3 luciferase reporter assay

To determine the effect of ASC on STAT3 transcriptional activity, the STAT3 luciferase reporter assay was performed as described previously (Rajendran et al., 2011).

2.13. Transfection with PIAS3 siRNA

HepG2 cells were plated in each well of six‐well plates and allowed to adhere for 24 h. On the day of transfection, 4 μL of lipofectamine Life Technologies (Carlsbad, CA) was added to 50 nM PIAS3 siRNA in a final volume of 100 μL of culture medium. After 48 h of transfection, cells were treated with ASC, and whole‐cell extracts were prepared to analyze the expression of PIAS3, phospho‐STAT3, STAT3, and PARP by Western blot analysis.

2.14. RNA isolation and reverse transcription

Total cellular RNA was extracted from untreated and ASC‐treated cells by using Trizol reagent Life Technologies (Carlsbad, CA) as described previously (Shanmugam et al., 2014). The expression of PIAS3 was analyzed using QIAGEN One Step RT‐PCR kit with GAPDH as an internal control. The RT‐PCR reaction mixture contained 10 μL of 5X QIAGEN OneStep RT‐PCR buffer, 1 μg of total RNA, 0.6 μM each of forward and reverse primers, 2 μL of dNTP mix and 2 μL of QIAGEN OneStep RT‐PCR enzyme mix in a final volume of 50 μL. The reaction was performed at 50 °C for 30 min, 95 °C for 5 min, 95 °C for 1 min, 61 °C for 1 min, and 72 °C for 1 min for 33 cycles with a final extension at 72 °C for 10 min. PCR products were run on 1% agarose gel containing 1X Gel red nucleic acid gel stain from Biotium (Hayward, CA). Stained bands were visualized under UV light and photographed. The primer sequences for PIAS3 mRNA were as follows: 5′‐ATTGACTGCTGACCCTGACA‐3′ (forward) and, 5′‐GGGACAGCGAAGTTTCCATA‐3′ (reverse). The primer sequences for GAPDH were 5′‐CCACAGTCCATGCCATCAD‐3′ (forward) and 5′‐TCCACCACCCTGTTGCTGTA‐3′ (reverse).

2.15. Real‐time polymerase chain reaction

Real‐time polymerase chain reaction for cyclin D1, survivin and XIAP genes was performed as described previously (Shanmugam et al., 2014).

2.16. Orthotopic HCC tumor model and pharmacokinetic evaluation

All procedures involving animals were reviewed and approved by SingHealth Institutional Animal Care and Use Committee. In order to define suitable treatment doses, a pharmacokinetics study of ASC at 2.5 mg/kg (i.p.) was conducted. The blood samples were collected at 10 min, 30 min, 1, 2, 4, 6, and 8 h post dose. A sensitive liquid chromatography‐tandem mass spectrometry method was developed and validated for determination of serum concentrations of ASC. Eight week‐old athymic balb/c nude female mice (Biolasco, Taiwan) were implanted orthotopically with approximately 1 mm3 of human HCCLM3_Luc2 tumor stably expressing firefly luciferase. Tumor growth was monitored by IVIS 200 Bioluminescence Imaging System (Xenogen Corp., Alameda, CA). Once increasing bioluminescence tumor signals were detected in the mice liver, mice were randomly assigned to the treatment groups. Mice received intraperitoneal injections of 2.5 mg/kg or 5 mg/kg of ASC on day 0, 1, 2, 3, 13, 15, 17, 20, 22, 24, 27, 29 and 31. Animals were euthanized at day 34 after first therapeutic dose injection, and tumors were harvested for subsequent analysis. For imaging, mice were given i.p. injections of 150 mg/kg D‐luciferin (Xenogen) 10 min before imaging. To quantitate tumor burden, bioluminescence signals were calculated from the imaging data using the Living Image software 3.2 (Xenogen) according to manufacturer's protocol.

2.17. Immunohistochemical analysis of tumor samples

Solid tumors from control and ASC‐treated mice were fixed with 10% phosphate buffered formalin. Tumors were cut and embedded in paraffin. And then tissues were deparaffinized in xylene, dehydrated in graded alcohol, and finally hydrated in water. Antigen retrieval was carried out by boiling the slide in 10 mmol/L sodium citrate (pH 6.0) for 30 min. Immunohistochemistry was done following manufacturer's instructions (Dako LSAB kit). Briefly, endogenous peroxidases were quenched with 3% hydrogen peroxide. Non‐specific binding was blocked by incubation in the blocking reagent in the LSAB kit (Dako), according to the manufacturer's instructions. Sections were incubated overnight with primary antibodies as follows: anti‐p‐STAT3, anti‐CD31, anti‐Ki67, and anti‐cleaved‐caspase‐3 (each at 1:100 dilution). Slides were subsequently washed several times in Tris‐buffered saline with 0.1% Tween 20 and were incubated with biotinylated linker for 30 min, followed by incubation with streptavidin conjugate provided in LSAB kit (Dako), according to the manufacturer's instructions. Immunoreactive species were detected using 3, 30‐diamino‐benzidine tetrahydrochloride as a substrate. Sections were counterstained with Gill's hematoxylin and mounted under glass cover slips. Images were taken using an Olympus BX51 microscope (magnification: 20×). Positive cells (brown) were quantitated using the Image‐Pro plus 6.0 software package (Media Cybernetics, Inc.).

2.18. Statistical analysis

Data are expressed as the mean ± S.E.M. In all figures, vertical error bars denote the S.E.M. The significance of differences between groups was evaluated by Student's t‐test or one way analysis of variance, (ANOVA) test. A p‐value of less than 0.05 was considered statistically significant.

3. Results

In this study, we analyzed the potential effect of ASC (chemical structure shown in Figure 1A) on STAT3 activation and on various markers of cellular proliferation, survival, and apoptosis in HCC cell lines and an orthotopic mouse model.

Figure 1.

Figure 1

Open in a new tab

ASC inhibits constitutively active STAT3 in HCC cells. (A) The chemical structure of ASC. (B) ASC suppresses phosphorylation of STAT3 at tyrosine 705 in HepG2 cells at does and time dependent. HepG2 cells (2 × 106 mL−1) were treated with 50 μM ASC at indicated concentration for 8 h, after which western blotting was performed as described under “Materials and methods”. (C) Phospho‐STAT3 levels in HepG2, HCCLM3, Huh7 and Hep3B could be suppressed by ASC 50 μM for 8 h (D) ASC at (50 μM) concentration had minimal effect on the phosphorylation of STAT3 at serine 727 and STAT5 protein expression in HepG2 cells.

3.1. ASC inhibits constitutive STAT3 phosphorylation in HCC cells

The ability of ASC to modulate constitutive STAT3 activation in HCC cells was first determined by Western blot analysis using specific antibodies against p‐STAT3 (Tyr 705) residue. As shown in Figure 1B, ASC substantially suppressed the phosphorylation of STAT3 in a dose‐ and time‐dependent manner, and the maximum inhibition was observed with 50 μM at 10 h. We further found that various HCC cell lines including (HepG2, HCCLM3 and Huh7) displayed constitutively active STAT3 and this expression was abrogated upon treatment with 50 μM ASC for 8 h (Figure 1C). Because STAT3 also undergoes phosphorylation at Ser 727 for its transcriptional activation, we next investigated whether ASC has an effect on this phosphorylation and found that this isoprenoid antibiotic had little effect on STAT3 activation at Ser 727 residue (Figure 1D, upper panel). We also analyzed whether ASC also affects STAT5 phosphorylation in HCC cells. Under the conditions in which ASC inhibited STAT3 (Tyr705) phosphorylation, it had minimal effect on STAT5 phosphorylation (Figure 1D, lower panel), thereby indicating its specificity towards p‐STAT3 (Tyr 705) residue.

3.2. ASC decreases nuclear translocation of STAT3 in HCC cells

As nuclear translocation is critical for the function of transcription factors (Subramaniam et al., 2013b), we next studied the effect of ASC on nuclear translocation of STAT3 by immunocytochemistry analysis. The data reveals relatively strong expression of STAT3 in nuclei of untreated cells, however only reduced expression of STAT3 was observed in the nuclei of ASC‐treated cells. Similar inhibitory effects were noted when HepG2 cells were treated with 100 μM pharmacological JAK2 inhibitor AG490 for 8 h (Figure 2A, left panel). Moreover, the expression of STAT3 in nuclear and cytoplasmic was also analyzed by western blot analysis and results obtained were consistence with immunocytochemistry data (Figure 2A, right panel). Overall, our data indicates that ASC can also abrogate nuclear translocation of STAT3 in HepG2 cells.

Figure 2.

Figure 2

Open in a new tab

(A) ASC reduces translocation of STAT3 to the nucleus. Immunocytochemistry was performed as described as described under “Materials and methods”. After treatment with 100 μM AG490 for 8 h, it was used as a positive control for inhibition of STAT3 translocation. Similar results were observed in western blotting experiments with STAT3 protein on nuclear and cytoplasmic extracts. (B) ASC suppresses DNA‐binding ability of STAT3 in HCC cells. HepG2 and HCCLM3 cells were treated with 50 μM ASC for the indicated time, after which nuclear extracts were prepared, and 20 μg of the nuclear extract protein was used for ELISA‐based DNA‐binding assay. (C) ASC suppresses constitutive STAT3‐dependent reporter gene expression. HepG2 cells were transfected with STAT3‐luciferase (STAT3‐Luc) plasmid, incubated for 48 h, and thereafter treated with 10, 25 and 50 μM ASC for 8 h. Whole cell extracts were then prepared and analyzed for luciferase activity. The results shown are representative of three independent experiments. *p < 0.05, **p < 0.01 indicates significant effect of ASC‐treated groups by Student's t‐test.

3.3. ASC inhibits DNA binding ability of STAT3 in HCC cells

To further investigate whether ASC could inhibit the STAT3‐DNA binding activity in HCC cells, ELISA‐based TransAM STAT3 assay kit was used. Analysis of nuclear extracts prepared from both HepG2 and HCCLM3 cells using ELISA based TransAM STAT3 assay kit showed that ASC abrogated STAT3‐DNA binding activity in a time‐dependent manner (Figure 2B). Inhibition of STAT3‐DNA binding activity was found in HCCLM3 cells as early as 2 h after treatment with 50 μM ASC, whereas in HepG2 cells it was observed only after 6 h. These results suggest that ASC could abrogate the DNA binding ability of STAT3 in HCC cells.

3.4. ASC suppresses constitutive STAT3‐dependent reporter gene expression in HCC cells

Whether ASC could also inhibit the transcriptional activity of STAT3 was examined by luciferase reporter gene assay in HepG2 cells. As shown in Figure 2C, the transcriptional activity of STAT3 was suppressed by ASC in a dose‐dependent manner with the maximal inhibition observed with 50 μM concentration. These data suggest that ASC can indeed abrogate STAT3 activation at multiple steps in HCC cells.

3.5. ASC prevents IL‐6‐induced phosphorylation of STAT3 in HCC cells

As cytokines like IL‐6 can also induce transient STAT3 activation (Subramaniam et al., 2013b), we next examined whether ASC could also negatively regulate IL‐6 induced STAT3 phosphorylation. First, we noticed that the STAT3 phosphorylation level could be substantially increased upon IL‐6 treatment in a dose‐ and time‐dependent manner in Hep3B cells that display relatively low basal STAT3 activation (Figure 3A). Thereafter, following pre‐treatment with ASC for different time intervals, IL‐6 at a concentration of (25 ng/mL) was added to Hep3B cells for 20 min. Interestingly, we found that IL‐6 induced STAT3 phosphorylation was substantially prevented after ASC treatment in a time‐dependent manner (Figure 3B). These results suggest that ASC could also reduce inducible STAT3 activation in HCC cells.

Figure 3.

Figure 3

Open in a new tab

ASC prevents IL‐6/EGF inducible STAT3 activation in HCC cells. (A) IL‐6 increases phosphorylation of STAT3 in time‐ and does‐dependent in Hep3B cells. Hep3B cells were treated with IL‐6 at indicated concentrations and times. Cells were lysed for Western blot analysis by using antibodies specific to p‐STAT3 and STAT3. (B) ASC prevents IL‐6 inducible STAT3 activation in Hep3B cells. Hep3B cells were treated with 50 μM ASC for the indicated times and then stimulated with IL‐6 (25 ng/mL) for 20 min. Whole cell extracts were then prepared and analyzed for p‐STAT3 and STAT3. (C) ASC suppresses EGF induced STAT3‐dependent reporter gene expression. Hep3B cells were transfected with STAT3‐luciferase (STAT3‐Luc) plasmid, incubated for 48 h, and treated with 10, 25 and 50 μM ASC for 8 h. After treatment, Hep3B were stimulated with EGF (100 ng/mL) for 2 h. Whole cell extracts were then prepared and analyzed for luciferase activity. The results are representative of three independent experiments. **p < 0.01, significantly different from EGF alone; Student's t‐test.

3.6. ASC suppresses EGF‐induced STAT3‐dependent reporter gene expression in HCC cells

Our above results clearly indicated that ASC could indeed inhibit IL‐6‐induced phosphorylation of STAT3. We next determined whether ASC can also affect EGF‐induced STAT3‐dependent gene transcription in HCC cells. We found that when Hep3B cells were transiently transfected with the pSTAT3‐Luc construct and thereafter stimulated with EGF (100 ng/ml) for 2 h, STAT3‐mediated luciferase gene expression was significantly increased. Conversely, when cell were pre‐treated with ASC, the EGF‐induced STAT3 activity was inhibited in a dose‐dependent manner. The maximum inhibition was again found at 50 μM concentration (Figure 3C).

3.7. ASC abrogates phosphorylation of upstream kinases in HCC cells

Activation of STAT3 is frequently mediated by receptor tyrosine kinase JAK1 and JAK2 and non‐receptor tyrosine kinases such as Src (Levy and Darnell, 2002). We next investigated whether ASC could modulate constitutive activation of JAK1 and JAK2 in HepG2 cells. The results indicated that substantial reduction of JAK1 and JAK2 activation could be noted in a time‐dependent manner after treatment with ASC (Figure 4A). Furthermore, we determined whether ASC can also suppress constitutive activation of Src kinase in HCC cells. Figure 4A clearly shows that ASC can also abrogate the constitutive activation of Src kinase in a time‐dependent manner and the levels of non‐phosphorylated Src remained unchanged under the similar treatment conditions.

Figure 4.

Figure 4

Open in a new tab

ASC modulates the expression of upstream regulators of STAT3 signaling pathway. (A) ASC inhibits phosphorylation of JAK1, JAK2 and Src in HepG2 cells. HepG2 cells were treated with 50 μM ASC for 4, 6, 8 and 10 h. Cells were lysed for Western blot analysis by using antibodies specific to p‐JAK1, JAK1, p‐JAK2, JAK2, p‐Src, Src, and β‐actin. (B) ASC inhibits IL‐6 inducible JAK1, JAK2 and Src activation in Hep3B cells. Hep3B cells were treated with 50 μM ASC for the indicated times and then stimulated with IL‐6 (25 ng/mL) for 20 min (C) ASC induces the expression of PIAS3 in HepG2 cells. Western blotting was performed as previous described. The same blots were stripped and reprobed with β‐actin antibody to verify equal protein loading. (D) Relative quantitative RT‐PCR analysis revealed an increased PIAS3 expression after ASC treatment. (E) Knocking down PIAS3 partially abrogated the effect of ASC. HepG2 cells (2 × 106 mL−1) were transfected with either scrambled or PIAS3–specific siRNA (100 nM). After 48 h, cells were treated with 50 μM ASC for 8 h. Whole‐cell extracts were prepared and immunoblotted with antibodies for PIAS3 or p‐STAT3.

3.8. ASC inhibits IL‐6‐induced phosphorylation of upstream kinases in HCC cells

Whether ASC could also abrogate IL‐6‐induced JAK1, JAK2 and Src phosphorylation in Hep3B cells was examined by western blot analysis. When cells were stimulated with IL‐6, the phosphorylation of JAK1, JAK2 and Src was found to be substantially increased. However, when the cells were pre‐treated with ASC, this increase could be abrogated in a time‐dependent manner (Figure 4B). Exposure of cells to ASC for 4 h was sufficient to substantially suppress IL‐6‐induced JAK1, JAK2 and Src activation in Hep3B cells (Figure 4B).

3.9. ASC increases PIAS3 protein and mRNA expression in HCC cells

Next, we attempted to elucidate the potential effect of ASC on the negative regulators of STAT3 signaling cascade namely protein inhibitors of activated‐STAT 3 (PIAS3) (Chung et al., 1997) and protein phosphatases such as SHP‐1, SHP‐2 (He and Karin, 2011), PTEN (Sun and Steinberg, 2002) and PTP1B (Johnston and Grandis, 2011) in HCC cells which have been reported to be closely associated with dephosphorylation of STAT3. First, treatment of HepG2 cells with the broad‐acting tyrosine phosphatase inhibitor sodium pervanadate prevented the ASC‐induced inhibition of STAT3 activation in a dose dependent manner (Figure S1). This data indicated that tyrosine phosphatases may be involved in ASC‐induced inhibition of STAT3 activation. However, the expression of SHP‐1, SHP‐2, PTEN and PTP1B proteins was not substantially modulated upon ASC treatment (Figure 4C). Interestingly, we observed that treatment with 50 μM ASC substantially increased the expression of PIAS3 protein in HepG2 cells in a time‐dependent manner with maximum expression observed at 8–10 h (Figure 4C). Whether modulation of PIAS3 by ASC is also regulated at the transcriptional level was studied as well. We observed that treatment of ASC also induced the expression of PIAS3 mRNA in a time‐dependent manner (Figure 4D). Overall, these finding suggest that the induction of PIAS3 expression may mediate the negative regulation of STAT3 activation caused by ASC in HCC cells.

3.10. Depletion of PIAS3 reverses the STAT3 inhibitory effect of ASC in HCC cells

Our results clearly demonstrate ASC could significantly increase expression of PIAS3 protein, which is possibly associated with observed decrease in STAT3 phosphorylation following ASC treatment. To explore this hypothesis, HepG2 cells were transfected with siRNA against PIAS3 to inhibit PIAS3 expression and then treated with or without 50 μM ASC for 8 h. As observed by Western blot analysis, ASC‐induced PIAS3 expression was effectively inhibited in the cells transfected with PIAS3 siRNA but not in those treated with the scrambled siRNA (Figure 4E). We next analyzed whether the suppression of PIAS3 expression by siRNA blocks the inhibitory effect of ASC on STAT3 activation in HCC cells. Interestingly, we noted that ASC did not substantially suppress STAT3 activation in the cells transfected with PIAS3 siRNA (Figure 4E). However, in cells transfected with scrambled siRNA, ASC caused substantial downregulation of STAT3 activation. Thus these results indicate the important role of PIAS3 in suppression of STAT3 phosphorylation by ASC.

3.11. ASC inhibits the viability and colony forming ability of HCC cells

The effect of ASC on the viability of HCC cell lines was first investigated by MTT assay. The results showed that ASC could inhibit the viability of three different HCC cell lines tested (HepG2, HCCLM3 and Huh7) in a time and dose dependent manner (Figure 5A). We next investigated, by in vitro clonogenic assay, whether ASC could also decrease long term survival ability of HCC cells. Only a very small number of highly stained and tightly packed clones were observed in 50 μM ASC treated cells which was only one sixth of the total number observed in untreated group (Figure 5B).

Figure 5.

Figure 5

Open in a new tab

ASC inhibits the cell viability, invasion and migration in HCC cells. (A) ASC inhibits the viability of HCC cells. MTT assays were performed in HepG2, HCCLM3 and Huh7 cells. Cell viability was determined as percentage of the vehicle control. (B) ASC inhibits colony formation ability of HepG2 cells. Statistic results of colony‐forming assays presented as surviving colonies (percentage of untreated control). Data are expressed as mean ± SD. (C) Wound‐healing assay for evaluating the inhibitory effect of ASC on HCC cell. Width of wound was measured at time zero and 24 h of incubation with and without ASC (50 μM) in the absence or presence of 100 ng/mL CXCL12. (D) Inhibitory effect of ASC on invasion of HepG2 and HCCLM3. HCC cells were seeded in the top‐chamber of the Matrigel. After pre‐incubation with or without ASC (50 μM) for 8 h, transwell chambers were then placed into the wells of a 24‐well plate, in which we had added either the basal medium only or basal medium containing 100 ng/mL CXCL12 for 24 h. Columns represent percentage of invaded cells; bars, SD. *p < 0.05, **p < 0.01. Representative results of two independent experiments are shown.

These findings indicate that the viability of HCC cells is significantly inhibited upon ASC treatment.

3.12. ASC blocks migratory and invasive potential of HCC cells

In addition to proliferation, activated STAT3 signaling may also positively correlate with increased HCC metastasis and invasiveness (Manu et al., 2013; Zhang et al., 2002). Whether down regulation of STAT3 by ASC also correlated with its ability to inhibit cellular migration was examined using an in vitro wound healing assay. We found that treatment with ASC significantly suppressed CXCL12 induced migration of both HepG2 and HCCLM3 cells at 50 μM concentration (Figure 5C). To further elucidate the effect of ASC on CXCL12‐induced cellular invasion, we employed an in vitro matrigel invasion assay. As shown in Figure 5D, HepG2 and HCCLM3 cells moved to another side faster under the influence of CXCL12 and this effect was significantly abolished upon treatment with ASC.

3.13. ASC induces substantial apoptosis in HCC cells

It has been shown that abrogation of persistent STAT3 activation also could induce apoptosis (Mora et al., 2002; Rahaman et al., 2002). To investigate the potential effects of ASC on cellular apoptosis, PI staining was first conducted to examine the changes in sub G1 percentage. As shown in Figure 6A, the fraction of cells with sub G1 DNA content was substantially increased in a time‐dependent manner in both HepG2 and Huh7 cells after exposure to 50 μM ASC for 24, 48 and 72 h. Additionally ASC induced apoptosis was further confirmed by TUNEL and ELISA based DNA fragmentation assays. Increased TUNEL positive cells were observed after ASC treatment for 24 and 48 h (Figure 6B). Also, in HepG2 cells treated with ASC there was a time‐dependent increase in the percentage of DNA fragmentation as determined by Cell Death Detection ELISAPLUS kit (Figure 6C).

Figure 6.

Figure 6

Open in a new tab

ASC induces substantial apoptosis in HCC cells. (A) The sub G1 ratio in HCC cells treated with ASC was examined using flow cytometry. Cells were exposed to 50 μM ASC at indicated times, after which cell were harvested and stained with PI. FACS was used to measure the subG1 percentage. (B) Detection of apoptosis in HepG2 cells by TUNEL assay. After treatment, cells were stained with a TUNEL assay reagent and then analyzed under a fluorescence microscope as described in Methods. (C) Apoptosis was analyzed using ELISA‐based DNA fragmentation Kit. Data are expressed as mean ± SD. *p < 0.05, **p < 0.01 indicates significant effect of ASC‐treated groups by Student's t‐test. (D) HepG2 cells were treated with the 50 μM ASC at indicated times; Western blotting was performed using antibodies against pro‐apoptotic proteins (caspase‐3, ‐8 and ‐9). (E) Representative Western blots showing level of PARP and cleaved PARP after transfection with PIAS3 siRNA/scrambled siRNA and treatment with or without ASC. β‐actin antibody was used as a loading control.

3.14. Involvement of diverse caspases in ASC‐induced apoptosis of HCC cells

We next analyzed whether ASC‐induced apoptosis might also involve caspases using western blot analysis and representative blots are shown in Figure 6D. Treatment of HepG2 cells with 50 μM ASC resulted in cleavage of procaspase‐3 as evident by the appearance of 19 and 17 kDa intermediate bands in a time dependent manner. Caspase‐3 is an executioner caspase that can be activated by mitochondrial pathway involving activation of caspase‐9 or a death receptor mediated cascade involving caspase‐8 (Fan et al., 2005). As shown in Figure 6D, both caspase‐8 and 9 were activated after ASC treatment in HepG2 cells in a time‐dependent manner. These observations suggest the possible involvement of both caspase‐8 and caspase‐9 in ASC‐mediated cleavage of caspase‐3.

3.15. Silencing of PIAS3 reverses the pro‐apoptotic effect of ASC in HCC cells

Activation of downstream caspase‐3 can lead to the cleavage of a 116 kDa PARP protein into 85 kDa fragments (Tewari et al., 1995). As shown in Figure 6E, ASC could cause a dramatic increase in the expression of PARP cleavage products. We next determined whether the suppression of PIAS3 expression by siRNA could abrogate the observed pro‐apoptotic effect of ASC on HCC cells. Results shown in Figure 6E clearly indicate that the observed effect of ASC on PARP cleavage was substantially abolished in the cells transfected with PIAS3 siRNA, whereas treatment with scrambled siRNA had minimal effect.

3.16. ASC inhibits the expression of STAT3–regulated gene products in HCC cells

STAT3 activation has been shown to regulate the expression of various gene products involved in proliferation, anti‐apoptosis, invasion, angiogenesis and chemoresistance (Subramaniam et al., 2013b). As shown in Figure 7A, expression of the cell cycle regulator protein cyclin D1, the anti‐apoptotic proteins Bcl‐2, Mcl‐1, survivin and XIAP, and the invasive gene product MMP‐9 were inhibited upon ASC treatment. The expression of pro‐apoptotic proteins (Bak and cleaved‐Bid) was up‐regulated in a time‐dependent manner, with maximum increase observed at around 48 h. We also found that mRNA expression of cyclin D1, survivin and XIAP was also reduced upon ASC treatment in a time‐dependent manner with maximum suppression observed at around 24 h (Figure 7B).

Figure 7.

Figure 7

Open in a new tab

ASC modulates the expression of STAT3‐regulated gene products involved in proliferation, and survival. (A) HepG2 cells were treated with 50 μM ASC for 48 h. Cells were lysed for Western blot analysis by using antibodies specific to cyclin D1, Bcl‐2, Mcl‐1, survivin, XIAP, Bak, Bid and MMP‐9 antibodies. The same blots were stripped and reprobed with β‐actin antibody to verify equal protein loading. (B) Real‐time PCR was conducted to measure the mRNA level of cyclin D1, survivin and XIAP. 18sRNA was set as endogenous control for measurement of equal loading of RNA samples. Results were analyzed using Sequence Detection Software (version 1.3) provided by Applied Biosystems. Relative gene expression was obtained after normalization with endogenous 18sRNA and determination of the difference in Ct between treated and untreated cells using ΔΔCt, *p < 0.05, **p < 0.01.

3.17. In vivo antitumor activity of ASC in an orthotopic mouse HCC model

The results of pharmacokinetics study indicated that ASC showed a good exposure in mouse serum at 2.5 mg/kg with maximum concentration (Cmax) of 1272.3 nM (Figure 8A). It suggested that 2.5 and 5 mg/kg could be suitable dose range for evaluation of in vivo anticancer effect of ASC in an orthotopic mouse HCC model. We next analyzed the antitumor potential of ASC in vivo via intraperitoneal administration in an orthotopic model of human HCC using HCCLM3_Luc2 tumor stably‐expressing firefly luciferase. Orthotopic tumor growth was monitored non‐invasively using bioluminescence imaging. Prior to first therapeutic injection (10 days after tumor implantation), the growth of orthotopic tumors was monitored using bioluminescence imaging and it was found to be localized mainly at the liver (Figure 8B). Mice were treated with either vehicles (0.1% DMSO) alone (n = 9), 2.5 mg/kg (n = 7) or 5 mg/kg (n = 5) of ASC for five weeks. Bioluminescence images revealed that there was significant inhibition of tumor growth in the ASC‐treated group compared with the vehicle control group (Figure 8B). Differences in tumor burden at set time points were quantitated by measuring photon counts and expressed as tumor burden relative to photon counts before first therapeutic injection (Figure 8C). One‐way ANOVA indicated that ASC at 2.5 mg/kg and 5 mg/kg induced significant inhibition of tumor growth compared with the vehicle‐treated controls (Figure 8C). No significant changes in body weight were observed in ASC‐treated mice compared to control group (Figure 8D).

Figure 8.

Figure 8

Open in a new tab

In vivo antitumor activities of ASC in an orthotopic human HCC tumor. (A) Pharmacokinetics analysis of ASC at 2.5 mg/kg following i.p. injection was performed. The blood samples were collected at 10 min, 30 min, 1, 2, 4, 6, and 8 h post dose. A sensitive liquid chromatography‐tandem mass spectrometry method was developed and validated for determination of serum concentrations of ASC. (B) Representative images of mice from bioluminescent imaging. D = day. (C) Relative tumor burden in athymic mice bearing orthotopically implanted HCCLM3‐Luc2 tumors treated with vehicles alone (n = 9), 2.5 mg/kg (n = 7) or 5 mg/kg (n = 5) of ASC. (D) Body weight changes observed. (E) Immunohistochemical analysis of p‐STAT3, Ki67, CD31 and cleaved‐caspase‐3 showed the inhibition in expression of p‐STAT3, Ki67, CD31 and increased levels of cleaved‐caspase‐3 expression in ASC‐treated samples as compared with control group. Percentage indicates positive staining for the biomarker shown. The photographs were taken at magnification of 20×.

3.18. ASC reduces STAT3, Ki‐67 and CD31 expression in tumor tissues

We further evaluated the effect of ASC on constitutive p‐STAT3 levels in HCC tumor tissues by immunohistochemical analysis and found that ASC can significantly inhibit the constitutive STAT3 activation in drug treated group as compared with the control group (Figure 8E). The effect of ASC was also analyzed on the expression of Ki‐67 (marker of proliferation), CD31 (marker of angiogenesis), and cleaved caspase‐3 (marker of apoptosis). As shown in Figure 8E, expression of various biomarkers including Ki‐67 as well as that of CD31 was downregulated, and that of caspase‐3 was significantly increased in ASC treated group as compared to the control group.

4. Discussion

Persistent activation of STAT3 has been commonly observed in wide majority of HCC tissues (Calvisi et al., 2006), and is closely linked to the development of chemoresistance in patients (Sun and Karin, 2012). Given the pivotal role of STAT3 in HCC initiation and progression, the aim of this present study was to investigate whether ASC could exert its anticancer effects at least in part through the attenuation of the STAT3 signaling pathway in HCC cells and an orthotopic mouse model. We found that ASC treatment caused substantial inhibition of constitutive and inducible STAT3 activation concomitant with the blockade of c‐Src, JAK1 and JAK2 kinase activation and the induction of PIAS3 in human HCC cells. ASC could further modulate the expression of STAT3‐regulated gene products, significantly inhibit cell viability, migration as well as invasion and induce substantial apoptosis in HCC cells. The potential therapeutic efficacy of ASC was also analyzed in an orthotopic model of human HCC. Intraperitoneal injection of ASC resulted in a significant suppression of tumor progression and reduction in the expression of p‐STAT3 in ASC‐treated tumor tissues. Overall, our results clearly establish that ASC as a novel blocker of STAT3 activation in HCC.

We report for the first time that ASC could substantially suppress STAT3 activation in HCC cells in a dose and time‐dependent manner. Prior studies have indicated that STAT3 can be phosphorylated at both Ser 727 and Tyr 705 residues (Subramaniam et al., 2013b). However, STAT3 dimerization, translocation to the nucleus, and binding to DNA are primarily mediated through the phosphorylation at critical tyrosine site (Tyr705) (Bromberg and Darnell, 2000; Svinka et al., 2014). In this study, we observed that ASC could specifically inhibit STAT3 phosphorylation at Tyr 705 residue without affecting its activation at Ser 727 site, and this abrogation further decreased STAT3 nuclear translocation, DNA binding and transcriptional activities. IL‐6 is a major cytokine that has been reported to promote HCC development through activating STAT3 signaling cascade (He and Karin, 2011). Furthermore, we found that STAT3 activation induced by IL‐6 treatment was also prevented by ASC as early as 1 h following drug exposure in Hep3B cells. A prior study indicated that ASC could downregulate the expression of c‐Myc, which could be rapidly activated by STAT3 upon stimulation of the interleukin IL‐6 receptor or gp130 (Jeong and Chang, 2010; Kiuchi et al., 1999). Thus the reported inhibition of c‐Myc protein could be possibly explained by the suppressive effects of ASC on STAT3 phosphorylation as observed by us in the present report.

The underlying molecular mechanism(s) through which ASC inhibits STAT3 activation was also investigated in detail. STAT3 phosphorylation can be tightly controlled by growth factor receptor and non‐receptor tyrosine kinase‐induced signaling cascade (Levy and Darnell, 2002). In addition, STAT3 can directly interact with JAK1 and JAK2 kinases as scaffold, and this interaction leads to STAT3 phosphorylation at Tyr 705 (Hodge et al., 2005). We noted that ASC treatment caused substantial downregulation of both constitutive and inducible JAK1 and JAK2 phosphorylation levels in a time‐dependent manner that directly correlated with its observed STAT3 inhibitory effects in HCC cells. This is in agreement at least in part with a prior report that AZD1480, a JAK2 inhibitor, can signaling suppress STAT3 signaling and oncogenesis in different solid tumors (Hedvat et al., 2009). Besides causing abrogation of JAK1 and JAK2 activation, ASC also inhibited c‐Src phosphorylation which has also been implicated in STAT3 activation in tumor cells. Thus it is possible that ASC may directly abrogate the cooperation of Src and JAK1/2 proteins involved in tyrosine phosphorylation of STAT3. We also observed that ASC significantly inhibited EGF induced STAT3 reporter activity in HCC cells. This is also in agreement with a previous study in which ASC was reported to inhibit growth factor‐induced HIF‐1α activation and tumor‐angiogenesis through the suppression of EGFR/ERK/p70S6K signaling pathway in human cervical carcinoma cells (Jeong et al., 2012).

We also report for the first time that the ASC‐induced inhibition of STAT3 activation directly correlated with the induction of PIAS3 expression in HCC cells. Prior studies have reported that negative regulators of STAT3 signaling cascade such as PIAS3, which was originally identified as a specific inhibitor of STAT3 activation could significantly block the DNA binding activity of this transcription factor and also decrease dimer‐dependent gene transcription (Shuai, 2000). Moreover, loss of PIAS3 may contribute to the activation of STAT3 protein in various cancers and PIAS3 indeed has been shown to be inactive in diverse human tumors, including lymphoma (Zhang et al., 2002) and gastric carcinoma (Liu et al., 2011). In this report, we found that the ASC‐induced the expression of PIAS3 protein and mRNA in HCC cells, which correlated, with its ability to negatively regulate STAT3 phosphorylation. Transfection with PIAS3 siRNA reversed the STAT3 inhibitory effects of this antibiotic, thereby clearly implicating an important role of this protein in ASC‐induced downregulation of STAT3 activation. Interestingly, it has been previously reported that other important anticancer agents such as curcumin (Saydmohammed et al., 2010) and 8‐hydrocalamenene (Nam et al., 2014) can also exhibit tumor inhibition through enhancing PIAS3 expression in tumor cells. Thus, targeted induction of PIAS3 protein can also form a basis of important strategy to downmodulate deregulated STAT3 activation in tumor cells.

Our results also indicate that the expression of several STAT3‐regulated gene products including proliferative (cyclin D1), anti‐apoptotic (Bcl‐2, XIAP, Mcl‐1 and survivin), pro‐apoptotic (Bak and Bid) and invasive (MMP‐9) was modulated upon ASC treatment in HCC cells. The inhibition of cyclin D1 expression may account for its ability to induce G1 arrest in U2OS cells as reported recently (Jeong and Chang, 2010). Previous studies have already shown that constitutively active STAT3 can act as a marker of oncogenic transformation by preventing cancer cells from undergoing apoptosis (Bowman et al., 2000; Catlett‐Falcone et al., 1999; Siveen et al., 2014). Thus, the down‐regulation of the expression of Bcl‐2, XIAP, Mcl‐1 and survivin as well as activation of Bid is likely linked with the ability of ASC to induce apoptosis in HCC cells, as evident by activation of caspase‐8, ‐9, and ‐3 and cleavage of PARP. This is in contrast to a recent study in which a synthetic derivative of ASC, 4‐O‐carboxymethyl ascochlorin (AS‐6) was found to cause ER stress and induce autophagy in HCC cells (Kang et al., 2012). The downmodulation of MMP‐9 expression as shown here may also explain the anti‐invasive potential of ASC that needs further investigation.

The relevance of these interesting in vitro observations with ASC was also investigated under in vivo settings. Our data clearly shows that ASC significantly suppressed HCC growth in orthotopic mouse model, downregulated the expression of phospho‐STAT3, Ki‐67, as well as CD31 and increased the levels of cleaved caspase‐3 in treated group as compared to control group. To the best of our knowledge, no prior studies with ASC has been reported in tumor bearing mouse models so far, and our overall findings suggest that ASC has an enormous potential for the treatment of HCC through the modulation of STAT3 signaling cascade. Thus, overall, our in vitro and in vivo experimental findings clearly provide novel mechanistic insights into the molecular actions of ASC and provide a strong rationale to pursue the use of this isoprenoid antibiotic to improve the treatment outcome of HCC patients.

Conflict of interest

None.

Supporting information

The following is the supplementary data related to this article:

Supplementary data

Click here for additional data file. (26.7KB, jpg)

Acknowledgments

This research work was supported by grants from Singapore Ministry of Health's National Medical Research Council to GS under its Individual research grants funding scheme. KMH was supported by grant from the National Medical Research Council of Singapore, Biomedical Research Council of Singapore, and the Singapore Millennium Foundation. KSA was supported by the Korea Science and Engineering Foundation (KOSEF) grant funded by the Korean Ministry of Education, Science and Technology (MoEST) (No. 2011‐0006220). This work was also supported by grants from the Singapore Ministry of Education Tier 2 [MOE2012‐T2‐2‐139], NUHS Bench‐to‐Bedside‐To‐Product [R‐184‐000‐243‐515] and Cancer Science Institute of Singapore, Experimental Therapeutics I Program [R‐713‐001‐011‐271] to APK.

Supplementary data 1.

1.1.

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.molonc.2014.12.008.

Dai Xiaoyun, Ahn Kwang Seok, Kim Chulwon, Siveen Kodappully Sivaraman, Ong Tina H., Shanmugam Muthu K., Li Feng, Shi Jizhong, Kumar Alan Prem, Wang Ling Zhi, Goh Boon Cher, Magae Junji, Hui Kam M., Sethi Gautam, (2015), Ascochlorin, an isoprenoid antibiotic inhibits growth and invasion of hepatocellular carcinoma by targeting STAT3 signaling cascade through the induction of PIAS3, Molecular Oncology 9, doi: 10.1016/j.molonc.2014.12.008.

Contributor Information

Kam M. Hui, Email: cmrhkm@nccs.com.sg

Gautam Sethi, Email: phcgs@nus.edu.sg.

References

  1. Altekruse, S.F. , McGlynn, K.A. , Reichman, M.E. , 2009. Hepatocellular carcinoma incidence, mortality, and survival trends in the United States from 1975 to 2005. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 27, 1485–1491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bowman, T. , Garcia, R. , Turkson, J. , Jove, R. , 2000. STATs in oncogenesis. Oncogene 19, 2474–2488. [DOI] [PubMed] [Google Scholar]
  3. Bromberg, J. , Darnell, J.E. , 2000. The role of STATs in transcriptional control and their impact on cellular function. Oncogene 19, 2468–2473. [DOI] [PubMed] [Google Scholar]
  4. Calvisi, D.F. , Ladu, S. , Gorden, A. , Farina, M. , Conner, E.A. , Lee, J.S. , Factor, V.M. , Thorgeirsson, S.S. , 2006. Ubiquitous activation of Ras and Jak/Stat pathways in human HCC. Gastroenterology 130, 1117–1128. [DOI] [PubMed] [Google Scholar]
  5. Catlett-Falcone, R. , Landowski, T.H. , Oshiro, M.M. , Turkson, J. , Levitzki, A. , Savino, R. , Ciliberto, G. , Moscinski, L. , Fernandez-Luna, J.L. , Nunez, G. , Dalton, W.S. , Jove, R. , 1999. Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity 10, 105–115. [DOI] [PubMed] [Google Scholar]
  6. Chung, C.D. , Liao, J. , Liu, B. , Rao, X. , Jay, P. , Berta, P. , Shuai, K. , 1997. Specific inhibition of Stat3 signal transduction by PIAS3. Science 278, 1803–1805. [DOI] [PubMed] [Google Scholar]
  7. Fan, T.J. , Han, L.H. , Cong, R.S. , Liang, J. , 2005. Caspase family proteases and apoptosis. Acta. Biochim. Biophys. Sin. 37, 719–727. [DOI] [PubMed] [Google Scholar]
  8. He, G. , Karin, M. , 2011. NF-kappaB and STAT3-key players in liver inflammation and cancer. Cell Res. 21, 159–168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hedvat, M. , Huszar, D. , Herrmann, A. , Gozgit, J.M. , Schroeder, A. , Sheehy, A. , Buettner, R. , Proia, D. , Kowolik, C.M. , Xin, H. , Armstrong, B. , Bebernitz, G. , Weng, S. , Wang, L. , Ye, M. , McEachern, K. , Chen, H. , Morosini, D. , Bell, K. , Alimzhanov, M. , Ioannidis, S. , McCoon, P. , Cao, Z.A. , Yu, H. , Jove, R. , Zinda, M. , 2009. The JAK2 inhibitor AZD1480 potently blocks Stat3 signaling and oncogenesis in solid tumors. Cancer Cell 16, 487–497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Heinrich, P.C. , Behrmann, I. , Haan, S. , Hermanns, H.M. , Muller-Newen, G. , Schaper, F. , 2003. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem. J. 374, 1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hodge, D.R. , Hurt, E.M. , Farrar, W.L. , 2005. The role of IL-6 and STAT3 in inflammation and cancer. Eur. J. Cancer 41, 2502–2512. [DOI] [PubMed] [Google Scholar]
  12. Hong, S. , Park, K.K. , Magae, J. , Ando, K. , Lee, T.S. , Kwon, T.K. , Kwak, J.Y. , Kim, C.H. , Chang, Y.C. , 2005. Ascochlorin inhibits matrix metalloproteinase-9 expression by suppressing activator protein-1-mediated gene expression through the ERK1/2 signaling pathway: inhibitory effects of ascochlorin on the invasion of renal carcinoma cells. J. Biol. Chem. 280, 25202–25209. [DOI] [PubMed] [Google Scholar]
  13. Hosokawa, T. , Ando, K. , Tamura, G. , 1985. An ascochlorin derivative, AS-6, reduces insulin resistance in the genetically obese diabetic mouse, db/db. Diabetes 34, 267–274. [DOI] [PubMed] [Google Scholar]
  14. Hosokawa, T. , Sawada, M. , Ando, K. , Tamura, G. , 1981. Alteration of cholesterol metabolism by 4-O-methylascochlorin in rats. Lipids 16, 433–438. [DOI] [PubMed] [Google Scholar]
  15. Huang, C. , Cao, J. , Huang, K.J. , Zhang, F. , Jiang, T. , Zhu, L. , Qiu, Z.J. , 2006. Inhibition of STAT3 activity with AG490 decreases the invasion of human pancreatic cancer cells in vitro. Cancer Sci. 97, 1417–1423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jeong, J.H. , Chang, Y.C. , 2010. Ascochlorin, an isoprenoid antibiotic, induces G1 arrest via downregulation of c-Myc in a p53-independent manner. Biochem. Biophys. Res. Commun. 398, 68–73. [DOI] [PubMed] [Google Scholar]
  17. Jeong, J.H. , Jeong, Y.J. , Cho, H.J. , Shin, J.M. , Kang, J.H. , Park, K.K. , Park, Y.Y. , Chung, I.K. , Chang, H.W. , Magae, J. , 2012. Ascochlorin inhibits growth factor-induced HIF-1alpha activation and tumor-angiogenesis through the suppression of EGFR/ERK/p70S6K signaling pathway in human cervical carcinoma cells. J. Cell. Biochem. 113, 1302–1313. [DOI] [PubMed] [Google Scholar]
  18. Jeong, J.H. , Nakajima, H. , Magae, J. , Furukawa, C. , Taki, K. , Otsuka, K. , Tomita, M. , Lee, I.S. , Kim, C.H. , Chang, H.W. , Min, K.S. , Park, K.K. , Park, K.K. , Chang, Y.C. , 2009. Ascochlorin activates p53 in a manner distinct from DNA damaging agents. Int. J. Cancer 124, 2797–2803. [DOI] [PubMed] [Google Scholar]
  19. Johnston, P.A. , Grandis, J.R. , 2011. STAT3 signaling: anticancer strategies and challenges. Mol. Interv. 11, 18–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kang, J.H. , Chang, Y.C. , Maurizi, M.R. , 2012. 4-O-carboxymethyl ascochlorin causes ER stress and induced autophagy in human hepatocellular carcinoma cells. J. Biol. Chem. 287, 15661–15671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kiuchi, N. , Nakajima, K. , Ichiba, M. , Fukada, T. , Narimatsu, M. , Mizuno, K. , Hibi, M. , Hirano, T. , 1999. STAT3 is required for the gp130-mediated full activation of the c-myc gene. J. Exp. Med. 189, 63–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Levy, D.E. , Darnell, J.E. , 2002. Stats: transcriptional control and biological impact. Nat. Rev. Mol. Cell Biol. 3, 651–662. [DOI] [PubMed] [Google Scholar]
  23. Liu, L.M. , Yan, M.G. , Yang, D.H. , Sun, W.W. , Zhang, J.X. , 2011. PIAS3 expression in human gastric carcinoma and its adjacent non-tumor tissues. Clin. Res. Hepatol. Gastroenterol. 35, 393–398. [DOI] [PubMed] [Google Scholar]
  24. Magae, J. , Suzuki, S. , Nagai, K. , Yamasaki, M. , Ando, K. , Tamura, G. , 1986. In vitro effects of an antitumor antibiotic, ascofuranone, on the murine immune system. Cancer Res. 46, 1073–1078. [PubMed] [Google Scholar]
  25. Mantovani, A. , Allavena, P. , Sica, A. , Balkwill, F. , 2008. Cancer-related inflammation. Nature 454, 436–444. [DOI] [PubMed] [Google Scholar]
  26. Manu, K.A. , Shanmugam, M.K. , Ong, T.H. , Subramaniam, A. , Siveen, K.S. , Perumal, E. , Samy, R.P. , Bist, P. , Lim, L.H. , Kumar, A.P. , Hui, K.M. , Sethi, G. , 2013. Emodin suppresses migration and invasion through the modulation of CXCR4 expression in an orthotopic model of human hepatocellular carcinoma. PloS One 8, e57015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mora, L.B. , Buettner, R. , Seigne, J. , Diaz, J. , Ahmad, N. , Garcia, R. , Bowman, T. , Falcone, R. , Fairclough, R. , Cantor, A. , Muro-Cacho, C. , Livingston, S. , Karras, J. , Pow-Sang, J. , Jove, R. , 2002. Constitutive activation of Stat3 in human prostate tumors and cell lines: direct inhibition of Stat3 signaling induces apoptosis of prostate cancer cells. Cancer Res. 62, 6659–6666. [PubMed] [Google Scholar]
  28. Nam, D. , Song, J. , Kim, S.M. , Chiang, S.Y. , Kim, J.S. , Chung, W.S. , Jang, H.J. , Jung, S.H. , Na, Y.S. , Kim, S.H. , Shim, B.S. , Ahn, K.S. , 2014. 8-hydrocalamenene, derived from Reynoutria elliptica, suppresses constitutive STAT3 activation, inhibiting proliferation and enhancing chemosensitization of human multiple myeloma cells. J. Med. Food 17, 365–373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Newman, D.J. , Cragg, G.M. , 2012. Natural products as sources of new drugs over the 30 years from 1981 to 2010. J. Nat. Prod. 75, 311–335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Rahaman, S.O. , Harbor, P.C. , Chernova, O. , Barnett, G.H. , Vogelbaum, M.A. , Haque, S.J. , 2002. Inhibition of constitutively active Stat3 suppresses proliferation and induces apoptosis in glioblastoma multiforme cells. Oncogene 21, 8404–8413. [DOI] [PubMed] [Google Scholar]
  31. Rajendran, P. , Ong, T.H. , Chen, L. , Li, F. , Shanmugam, M.K. , Vali, S. , Abbasi, T. , Kapoor, S. , Sharma, A. , Kumar, A.P. , Hui, K.M. , Sethi, G. , 2011. Suppression of signal transducer and activator of transcription 3 activation by butein inhibits growth of human hepatocellular carcinoma in vivo. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 17, 1425–1439. [DOI] [PubMed] [Google Scholar]
  32. Ramachandran, L. , Manu, K.A. , Shanmugam, M.K. , Li, F. , Siveen, K.S. , Vali, S. , Kapoor, S. , Abbasi, T. , Surana, R. , Smoot, D.T. , Ashktorab, H. , Tan, P. , Ahn, K.S. , Yap, C.W. , Kumar, A.P. , Sethi, G. , 2012. Isorhamnetin inhibits proliferation and invasion and induces apoptosis through the modulation of peroxisome proliferator-activated receptor gamma activation pathway in gastric cancer. J. Biol. Chem. 287, 38028–38040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Saydmohammed, M. , Joseph, D. , Syed, V. , 2010. Curcumin suppresses constitutive activation of STAT-3 by up-regulating protein inhibitor of activated STAT-3 (PIAS-3) in ovarian and endometrial cancer cells. J. Cell. Biochem. 110, 447–456. [DOI] [PubMed] [Google Scholar]
  34. Shanmugam, M.K. , Rajendran, P. , Li, F. , Kim, C. , Sikka, S. , Siveen, K.S. , Kumar, A.P. , Ahn, K.S. , Sethi, G. , 2014. Abrogation of STAT3 signaling cascade by zerumbone inhibits proliferation and induces apoptosis in renal cell carcinoma xenograft mouse model. Mol. Carcinog. [DOI] [PubMed] [Google Scholar]
  35. Shuai, K. , 2000. Modulation of STAT signaling by STAT-interacting proteins. Oncogene 19, 2638–2644. [DOI] [PubMed] [Google Scholar]
  36. Siveen, K.S. , Sikka, S. , Surana, R. , Dai, X. , Zhang, J. , Kumar, A.P. , Tan, B.K. , Sethi, G. , Bishayee, A. , 2014. Targeting the STAT3 signaling pathway in cancer: role of synthetic and natural inhibitors. Biochim. Biophys. Acta. 1845, 136–154. [DOI] [PubMed] [Google Scholar]
  37. Subramaniam, A. , Shanmugam, M.K. , Ong, T.H. , Li, F. , Perumal, E. , Chen, L. , Vali, S. , Abbasi, T. , Kapoor, S. , Ahn, K.S. , Kumar, A.P. , Hui, K.M. , Sethi, G. , 2013. Emodin inhibits growth and induces apoptosis in an orthotopic hepatocellular carcinoma model by blocking activation of STAT3. Br. J. Pharmacol. 170, 807–821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Subramaniam, A. , Shanmugam, M.K. , Perumal, E. , Li, F. , Nachiyappan, A. , Dai, X. , Swamy, S.N. , Ahn, K.S. , Kumar, A.P. , Tan, B.K. , Hui, K.M. , Sethi, G. , 2013. Potential role of signal transducer and activator of transcription (STAT)3 signaling pathway in inflammation, survival, proliferation and invasion of hepatocellular carcinoma. Biochim. Biophys. Acta. 1835, 46–60. [DOI] [PubMed] [Google Scholar]
  39. Sun, B. , Karin, M. , 2012. Obesity, inflammation, and liver cancer. J. Hepatol. 56, 704–713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sun, S. , Steinberg, B.M. , 2002. PTEN is a negative regulator of STAT3 activation in human papillomavirus-infected cells. J. Gen. Virol. 83, 1651–1658. [DOI] [PubMed] [Google Scholar]
  41. Svinka, J. , Mikulits, W. , Eferl, R. , 2014. STAT3 in hepatocellular carcinoma: new perspectives. Hepatic Oncol. 1, 107–120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tamura, G. , Suzuki, S. , Takatsuki, A. , Ando, K. , Arima, K. , 1968. Ascochlorin, a new antibiotic, found by the paper-disc agar-diffusion method. I. Isolation, biological and chemical properties of ascochlorin. (Studies on antiviral and antitumor antibiotics. I). J. Antibiot. (Tokyo) 21, 539–544. [DOI] [PubMed] [Google Scholar]
  43. Tewari, M. , Quan, L.T. , O'Rourke, K. , Desnoyers, S. , Zeng, Z. , Beidler, D.R. , Poirier, G.G. , Salvesen, G.S. , Dixit, V.M. , 1995. Yama/CPP32 beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose) polymerase. Cell 81, 801–809. [DOI] [PubMed] [Google Scholar]
  44. Thomas, M.B. , Zhu, A.X. , 2005. Hepatocellular carcinoma: the need for progress. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 23, 2892–2899. [DOI] [PubMed] [Google Scholar]
  45. Turkson, J. , Kim, J.S. , Zhang, S. , Yuan, J. , Huang, M. , Glenn, M. , Haura, E. , Sebti, S. , Hamilton, A.D. , Jove, R. , 2004. Novel peptidomimetic inhibitors of signal transducer and activator of transcription 3 dimerization and biological activity. Mol. Cancer Ther. 3, 261–269. [PubMed] [Google Scholar]
  46. Turkson, J. , Ryan, D. , Kim, J.S. , Zhang, Y. , Chen, Z. , Haura, E. , Laudano, A. , Sebti, S. , Hamilton, A.D. , Jove, R. , 2001. Phosphotyrosyl peptides block Stat3-mediated DNA binding activity, gene regulation, and cell transformation. J. Biol. Chem. 276, 45443–45455. [DOI] [PubMed] [Google Scholar]
  47. Yu, H. , Pardoll, D. , Jove, R. , 2009. STATs in cancer inflammation and immunity: a leading role for STAT3. Nat. Rev. Cancer 9, 798–809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhang, Q. , Raghunath, P.N. , Xue, L. , Majewski, M. , Carpentieri, D.F. , Odum, N. , Morris, S. , Skorski, T. , Wasik, M.A. , 2002. Multilevel dysregulation of STAT3 activation in anaplastic lymphoma kinase-positive T/null-cell lymphoma. J. Immunol. 168, 466–474. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

The following is the supplementary data related to this article:

Supplementary data

Click here for additional data file. (26.7KB, jpg)

Articles from Molecular Oncology are provided here courtesy of Wiley

RESOURCES