Skip to main content
Oncology Letters logoLink to Oncology Letters
. 2017 Jun 6;14(2):1775–1779. doi: 10.3892/ol.2017.6316

Anti-cancer effect of low dose of celecoxib may be associated with lnc-SCD-1:13 and lnc-PTMS-1:3 but not COX-2 in NCI-N87 cells

Bin Song 1, Zhen-Bo Shu 1, Juan Du 2, Ji-Chen Ren 2, Ye Feng 1,
PMCID: PMC5529947  PMID: 28789408

Abstract

In order to investigate the mechanism of celecoxib and whether long non-coding RNAs (lncRNAs) were involved in the effects of celecoxib treatment in NCI-N87 cells, NCI-N87 cells were treated with 15, 30 and 60 µM celecoxib and an MTT assay was performed to assess cell viability. Following treatment with 15 µM celecoxib, the cell cycle and apoptosis were analyzed by flow cytometry, and the mRNA levels of lnc-SCD-1:13, lnc-PTMS-1:3, cyclooxygenase-2 (COX-2), integrin α3 (ITGA3) and DSH homolog 1 (DVL1) were detected by reverse transcription quantitative PCR (RT-qPCR) in NCI-N87 cells. MTT analysis demonstrated that celecoxib significantly inhibited cell viability in treated cells compared with untreated cells. Flow cytometry analysis revealed that, compared with untreated cells, the percentage of cells in the G0/G1 phase was significantly increased, and the percentage of cells in the S and G2 phase was decreased. In addition, the percentage of early and late apoptotic cells was increased in cells treated with 15 µM celecoxib compared with the control. RT-qPCR analysis also demonstrated that the mRNA levels of lnc-SCD-1:13, lnc-PTMS-1:3, ITGA3 and DVL1 were increased following treatment with celecoxib (15 µM; P<0.05). However, there were no significant differences in the expression of COX-2 mRNA between cells treated with celecoxib (15 µM) and untreated cells. The present study demonstrated that a low dose of celecoxib may be involved in regulating cell growth independent of COX-2 in NCI-N87 cells. Furthermore, ITGA3 and/or DVL1 co-expressed with lnc-SCD-1:13 and lnc-PTMS-1:3 may be associated with the effects of treatment with a low dose of celecoxib in NCI-N87 cells.

Keywords: celecoxib, anti-cancer effect, cyclooxygenase-2, long non-coding RNA

Introduction

Gastric cancer (GC) is a common malignancy worldwide, characterized by high invasiveness and aggressiveness (1). It is estimated that there are ~990,000 new cases of GC and that ~738,000 succumb from this type of cancer per year (2). Although a number of conventional therapeutic methods, including surgical excision and chemotherapy achieve satisfactory therapeutic effects for patients with early GC, a greater number of patients with GC at an advanced stage have poor prognosis (3). Therefore, despite increasing knowledge of the genetic and biochemical basis of GC, it is also essential to search for novel therapeutic targets and to develop more effective diagnostic and treatment methods.

A series of studies have reported that nonsteroidal anti-inflammatory drugs (NSAIDs) have an anti-cancer effect in various types of cancer, including breast cancer (4), esophageal cancer (5), colorectal cancer (6), prostate cancer (7) and GC (8). In addition to aspirin, celecoxib, a cyclooxygenase-2 (COX-2) inhibitor, has been demonstrated to be involved in uncontrolled cell proliferation, apoptosis, angiogenesis and metastasis (9,10). Previous studies have suggested that celecoxib is able to induce cell apoptosis through the phosphoinositide 3 kinase/Akt signaling pathway (11) and to inhibit invasion through the adenine nucleotide translocator-dependent signaling pathway in GC cells (12). In addition, celecoxib has been reported to be able to prevent the development of GC in rats (13). Increasing evidence suggests that long non-coding RNAs (lncRNAs) are able to regulate tumor-suppressing or oncogenic effects, and lncRNAs may be considered as novel biomarkers and therapeutic targets for cancer (14,15). However, an understanding of the function of lncRNAs in the treatment of GC with celecoxib remains limited.

A previous bioinformatics study has demonstrated that DVL1 and/or ITGA3, as well as their co-expressed lncRNAs, including lnc-SCD-1:13 and lnc-PTMS-1:3, were abnormally expressed in patients with GC following treatment with celecoxib. In the present study, the effects of a low dose of celecoxib on the viability, cell cycle and apoptosis of human GC NCI-N87 cells was investigated. In addition, the mRNA levels of lnc-SCD-1:13, lnc-PTMS-1:3, COX-2, ITGA3 and DVL1 were analyzed in order to investigate further whether lncRNAs are involved in the treatment of NCI-N87 cells with celecoxib.

Materials and methods

Cell culture

NCI-N87 cells were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The cells were maintained in Dulbecco's modified Eagle medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) in a 37°C incubator with a humidified atmosphere of 5% CO2 (Thermo Fisher Scientific, Inc.).

MTT assay

The cells (5×103) were seeded into each well of a 96-well plate and cultured in DMEM supplemented with 10% FBS. Following 24 h of culture at 37°C and 5% CO2 with saturated humidity, the cells were treated with 0 (control group), 15, 30 and 60 µM celecoxib (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), and subsequently incubated for 72 h (37°C, 5% CO2 with saturated humidity) (11). MTT (10 µl, 5 mg/ml; Shanghai Sangon Biotech Co., Ltd, Shanghai, China) was added to each well at the same time, and the cells were subsequently incubated for 4 h at 37°C. Following the removal of the medium, dimethyl sulfoxide (DMSO; 100 µl; Shanghai Sangon Biotech Co., Ltd) was added into each well for 10 min to solubilize the formazan crystals at room temperature. The zero control (medium, MTT, DMSO) and blank control (no reagent) were set up. The absorbance was read at 570 nm using a microplate reader (BioTek Instruments, Inc., Winooski, VT, USA). All experiments were performed in triplicate.

Flow cytometry

The NCI-N87 cells were treated with a low dose of celecoxib (15 µM) for 72 h at 37°C. For cell cycle detection, the treated cells were collected by centrifugation (250 × g for 6 min) at 25°C and subsequently fixed with ice-cold 70% ethanol overnight. Next, the cells were centrifuged (111 × g for 5 min) at 25°C and re-suspended in 500 µl phosphate buffered saline (PBS). The cells were subsequently treated with 50 µg/ml RNase A (Shanghai Sangon Biotech Co., Ltd.) for 30 min at 37°C. Finally, the cells were stained with propidium iodide (PI; BD Pharmingen, San Diego, CA, USA) in the dark for 15 min at 4°C and detected using a FACSCalibur flow cytometer (BD Pharmingen). An annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit (BD Pharmingen) was used for the detection of apoptotic cells. The treated cells were digested with 0.25% trypsin-EDTA and collected by centrifugation at 250 × g for 6 min at 25°C. The cells were then washed once with PBS. Subsequently, the cells were resuspended with 1X binding buffer (from the annexin V-FITC apaoptosis detection kit) and stained with FITC-annexin V and PI in the dark for 15 min at 25°C. Following this, 1X binding buffer (400 µl) was added to the cells, and apoptosis was detected using a FACSCalibur flow cytometer (BD Pharmingen).

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

The cells were treated with a low dose of celecoxib (15 µM) for 72 h at 37°C. Total RNA was extracted using 1 ml TRIzol reagent (Takara Biotechnology Co., Ltd., Dalian, China), and cDNA was obtained once using a reverse transcription kit (Takara Biotechnology Co., Ltd), according to the manufacturer's protocol. Primer sequences for ITGA3, DVL1, COX-2, lnc-SCD-1:13, lnc-PTMS-1:3 and glyceraldehyde-3-phosphate dehydrogenase are listed in Table I. SYBR Premix Ex Taq (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used to perform qPCR. The thermocycler conditions used were as follows: 50°C for 3 min, 95°C for 3 min, 40 cycles of 95°C for 10 sec and 60°C for 30 sec. Relative quantification and calculations were performed using the comparative threshold (Cq) cycle method (2−ΔΔCq) (16).

Table I.

Primer sequences for real-time quantitative polymerase chain reaction.

Gene Primer sequences (5′-3′)
GAPDH-hf GAAGGTGAAGGTCGGAGTC
GAPDH-hr GAAGATGGTGATGGGATTTC
ITGA3-hf GGACCTTACAACGCCGAGTG
ITGA3-hr GGAGGCTCTTTGGCTTGTTTT
DVL1-hf AGCACCTCATCCAGACTCATCC
DVL1-hr GATGCTGATGCCCAGAAAGTGAT
COX-2-hf CCCTGAGCATCTACGGTTTG
COX-2-hr CAGTATTAGCCTGCTTGTCT
lnc-SCD-1:13-hf AAGTCTTGAAGTTGGGTGTT
lnc-SCD-1:13-hr GAAGATGGCAGAGCAGAAAG
lnc-LRR1-1:2-hf GTGTCCGCACTAAGTTCGGCATCA
lnc-LRR1-1:2-hr GTGTCCGCACTAAGTTCGGCATCA
lnc-PTMS-1:3-hf ATCCCAAACGGCAGAAGACA
lnc-PTMS-1:3-hr CAGAGCAGGGAGCCAGGTGA

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ITGA3, integrin subunit α3; DVL1, dishevelled segment polarity protein 1; COX-2, cyclooxygenase-2; lnc, long non-coding RNA; hf, forward; hr, reverse.

Statistical analysis

SPSS statistical analysis software (version 12.0; SPSS Inc., Chicago, IL, USA) was used to perform statistical analysis. Data are expressed as the mean ± standard error and were analyzed by one-way analysis of variance followed by least significance difference test. P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of celecoxib on the viability of NCI-N87 cells

MTT analysis was performed to observe the effect of celecoxib treatment on NCI-N87 cell viability. The results demonstrated that cell viability was significantly inhibited in the celecoxib treatment group compared with the untreated cells (P<0.05; Fig. 1A). To further understand the nature of the decrease in cell viability associated with the addition of celecoxib, cell cycle analysis was performed. The results suggested that compared with the control, there was an increased percentage of cells in the G0/G1 phase (P<0.05) and a decreased percentage of cells in the S and G2 phase in the celecoxib (15 µM) treatment group (P<0.05; Fig. 1B, Table II).

Figure 1.

Figure 1.

Celecoxib inhibits NCI-N87 cell viability. (A) MTT analysis demonstrated that cell viability was significantly inhibited in the celecoxib treatment group compared with untreated cells. (B) Flow cytometry analysis indicated an increase in the percentage of cells in the G0/G1 phase and a decrease in the percentage of cells in the S and G2 phases in the celecoxib treatment group compared with the control. *P<0.05 vs. untreated cells. Dip, diploid.

Table II.

Cell cycle analysis of celecoxib treatment and control groups.

Group G0/G1 phase (%) S phase (%) G2 phase (%)
Control 47.07±0.70 39.05±4.34 13.88±3.65
Celecoxib 65.56±0.16a 29.19±0.98a 5.25±1.16a
a

P<0.05 vs. control. Data are expressed as the mean ± standard error.

Effect of celecoxib on apoptosis in NCI-N87 cells

The apoptotic rate was analyzed by flow cytometry, and the results indicated that the percentage of early and late apoptotic cells was significantly increased in cells treated with celecoxib (15 µM) compared with untreated cells (P<0.05; Fig. 2).

Figure 2.

Figure 2.

Celecoxib (15 µM) promotes early and late apoptosis in NCI-N87 cells. *P<0.05 vs. control. Con, control. PI, propidium iodide.

Effect of a low dose of celecoxib on the mRNA levels of lnc-SCD-1:13, lnc-PTMS-1:3, COX2, ITGA3 and DVL1 in NCI-N87 cells

There was no significant difference in the expression of COX2 in cells treated with celecoxib (15 µM) and untreated cells (Fig. 3). The mRNA levels of lnc-SCD-1:13, lnc-PTMS-1:3, ITGA3 and DVL1 were also detected. The expression of these genes was indicated to be aberrant in GC by our previous bioinformatics analysis (17). RT-qPCR analysis demonstrated that there was an increase in mRNA expression of lnc-SCD-1:13, lnc-PTMS-1:3 ITGA3 and DVL1 in cells treated with celecoxib (15 µM) compared with untreated cells (P<0.05, Fig. 3). Expression of COX2 was not significantly altered in cells treated with celecoxib (15 µM) compared with untreated cells (Fig. 3).

Figure 3.

Figure 3.

Celecoxib (15 µM) increases mRNA expression of lnc-SCD-1:13, lnc-PTMS-1:3, ITGA3 and DVL1, but not COX-2 in NCI-N87 cells. *P<0.05 vs. control. lnc, long non-coding RNA; ITGA3, integrin subunit α3; DVL1, dishevelled segment polarity protein 1; COX-2, cyclooxygenase-2.

Discussion

Celecoxib, a novel NSAID that is able to inhibit COX-2 activity, is considered to be an agent for the chemoprevention of GC (18). A previous study demonstrated that increased COX-2 expression is an independent prognostic factor for poor prognosis and is associated with reduced survival in patients with GC (19). Therefore, increasing attention had been directed to the mechanisms of celecoxib action on GC. In the present study, it was demonstrated that a low dose of celecoxib (15 µM) was able to significantly inhibit viability of NCI-N87 cells by arresting the cell cycle at the the G0/G1 phase and promoting apoptosis. Similarly, Cho et al (20) demonstrated the anti-cancer effect of celecoxib on GC cells (AGS and MKN-45) by regulating cell-cycle arrest and apoptosis. In addition, Liu et al (11) suggested that celecoxib induced apoptosis through the mitochondrial and death receptor pathways in GC cells. These results indicated that a low dose of celecoxib may have a chemopreventive function in the development of GC by regulating cell cycle and apoptosis.

The association of COX2 with tumor development by promoting cell proliferation and invasion or metastasis has been well established (21,22). Previous studies have demonstrated that COX-2 is overexpressed in human GC (23,24), and in vitro downregulation of COX-2 is able to induce growth inhibition (25). However, the present study indicated that 15 µM celecoxib was not able inhibit COX2 mRNA expression, but was able to suppress cell viability. Consistent with the findings of the present study, Kim et al (26) also demonstrated that COX2 expression is not inhibited by 10 µM celecoxib, but expression is suppressed by 25 µM celecoxib. Taken together, these results indicated that the anti-cancer effect of celecoxib may not be fully dependent on COX-2 suppression. Previous studies have also demonstrated that chemopreventive effect of celecoxib on cancer may be associated with a COX-2-independent mechanism (13,2729). Combined with the results of the present study, it is possible to hypothesize that a low dose of celecoxib may inhibit cell growth independent of COX-2. However, the exact mechanism requires further elucidation.

To further investigate the molecular mechanisms underlying the inhibition of cell viability induced by a low dose of celecoxib, the mRNA levels of differentially expressed genes (ITGA3 and DVL1) and lncRNAs (lnc-SCD-1:13 and lnc-PTMS-1:3) were detected in NCI-N87 cells. ITGA3 has been previously been demonstrated to be involved in the development of GC (30). Integrins, a family of adhesion receptors, are associated with cell adhesion and migration as well as signal transduction (31,32). Several previous studies have also demonstrated that decreased expression of ITGA3 is associated with cancer growth and development (33,34). In addition, overexpression of DVL1 was observed in the metastasis of colorectal cancer (35). Dishevelled homologs (DVL1, DVL2, DVL2) are core signaling molecules of the WNT/planar cell polarity (PCP) signaling pathways (36). Accumulating evidence has demonstrated that PCP signaling is associated with tumorigenesis (31). Tang et al (37) reported that microRNA (miR)-200b and miR-22 were able to synergistically inhibit the growth of GC through the Wnt-1 signaling pathway. Notably, a previous study by our group demonstrated that ITGA3 and/or DVL1 were co-expressed with lnc-SCD-1:13 and lnc-PTMS-1:3 in GC cells. Further studies have reported that lncRNAs are involved in the pathogenesis of GC (3840). These results suggested that genes co-expressed with lnc-SCD-1:13 and lnc-PTMS-1:3 may be involved in the effects of a low dose of celecoxib on GC. However, the associations of ITGA3 and DVL1 with lnc-SCD-1:13 and lnc-PTMS-1:3 remain unclear, and should be investigated in further studies.

In summary, the present study demonstrated that a low dose of celecoxib may exert an anti-cancer effect by regulating the cell cycle and apoptosis independent of COX-2 in GC cells. Furthermore, ITGA3 and/or DVL1 co-expressed with lnc-SCD-1:13 and lnc-PTMS-1:3 may be involved in the effects of a low dose of celecoxib on GC.

Acknowledgements

The present study was supported by the Special Fund for Medical Service of Jilin Finance Department project (grant no. SCZSY201507).

References

  • 1.Bray F, Ren JS, Masuyer E, Ferlay J. Global estimates of cancer prevalence for 27 sites in the adult population in 2008. Int J Cancer. 2013;132:1133–1145. doi: 10.1002/ijc.27711. [DOI] [PubMed] [Google Scholar]
  • 2.Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010;127:2893–2917. doi: 10.1002/ijc.25516. [DOI] [PubMed] [Google Scholar]
  • 3.Akagi H, Higuchi H, Sumimoto H, Igarashi T, Kabashima A, Mizuguchi H, Izumiya M, Sakai G, Adachi M, Funakoshi S, et al. Suppression of myeloid cell leukemia-1 (Mcl-1) enhances chemotherapy-associated apoptosis in gastric cancer cells. Gastric Cancer. 2013;16:100–110. doi: 10.1007/s10120-012-0153-6. [DOI] [PubMed] [Google Scholar]
  • 4.Harris RE, Namboodiri KK, Farrar WB. Nonsteroidal antiinflammatory drugs and breast cancer. Epidemiology. 1996;7:203–205. doi: 10.1097/00001648-199603000-00017. [DOI] [PubMed] [Google Scholar]
  • 5.Funkhouser EM, Sharp GB. Aspirin and reduced risk of esophageal carcinoma. Cancer. 1995;76:1116–1119. doi: 10.1002/1097-0142(19951001)76:7<1116::AID-CNCR2820760703>3.0.CO;2-I. [DOI] [PubMed] [Google Scholar]
  • 6.Levy GN. Prostaglandin H synthases, nonsteroidal anti-inflammatory drugs and colon cancer. FASEB J. 1997;11:234–247. [PubMed] [Google Scholar]
  • 7.Hsu AL, Ching TT, Wang DS, Song X, Rangnekar VM, Chen CS. The cyclooxygenase-2 inhibitor celecoxib induces apoptosis by blocking Akt activation in human prostate cancer cells independently of Bcl-2. J Biol Chem. 2000;275:11397–11403. doi: 10.1074/jbc.275.15.11397. [DOI] [PubMed] [Google Scholar]
  • 8.Wang WH, Huang JQ, Zheng GF, Lam SK, Karlberg J, Wong BC. Non-steroidal anti-inflammatory drug use and the risk of gastric cancer: A systematic review and meta-analysis. J Natl Cancer Inst. 2003;95:1784–1791. doi: 10.1093/jnci/djg106. [DOI] [PubMed] [Google Scholar]
  • 9.Pairet M, Engelhardt G. Distinct isoforms (COX-1 and COX-2) of cyclooxygenase: Possible physiological and therapeutic implications. Fundam Clin Pharmacol. 1996;10:1–17. doi: 10.1111/j.1472-8206.1996.tb00144.x. [DOI] [PubMed] [Google Scholar]
  • 10.Williams CS, Mann M, Dubois RN. The role of cyclooxygenases in inflammation, cancer, and development. Oncogene. 1999;18:7908–7916. doi: 10.1038/sj.onc.1203286. [DOI] [PubMed] [Google Scholar]
  • 11.Liu M, Li CM, Chen ZF, Ji R, Guo QH, Li Q, Zhang HL, Zhou YN. Celecoxib regulates apoptosis and autophagy via the PI3K/Akt signaling pathways in SGC-7901 gastric cancer cells. Int J Mol Med. 2014;33:1451–1458. doi: 10.3892/ijmm.2014.1713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lan C, Yang L, Fan L, Zhang Y, Wang J, Guo GJ, Wan S, Yang S, Wang R, Fang D. Celecoxib inhibits helicobacter pylori-induced invasion of gastric cancer cells through an adenine nucleotide translocator-dependent mechanism. Anticancer Agents Med Chem. 2013;13:1267–1272. doi: 10.2174/18715206113139990324. [DOI] [PubMed] [Google Scholar]
  • 13.Hu P, Yu J, Zeng Z, Leung WK, Lin HL, Tang BD, Bai AH, Sung JJ. Chemoprevention of gastric cancer by celecoxib in rats. Gut. 2004;53:195–200. doi: 10.1136/gut.2003.021477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Du Z, Fei T, Verhaak RG, Su Z, Zhang Y, Brown M, Chen Y, Liu XS. Integrative genomic analyses reveal clinically relevant long noncoding RNAs in human cancer. Nat Struct Mol Biol. 2013;20:908–913. doi: 10.1038/nsmb.2591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Passon DM, Lee M, Rackham O, Stanley WA, Sadowska A, Filipovska A, Fox AH, Bond CS. Structure of the heterodimer of human NONO and paraspeckle protein component 1 and analysis of its role in subnuclear body formation; Proc Natl Acad Sci USA; 2012; pp. 4846–4850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 17.Song B, Du J, Feng Y, Gao YJ, Zhao JS. Co-expressed differentially expressed genes and long non-coding RNAs involved in the celecoxib treatment of gastric cancer: An RNA sequencing analysis. Exp Ther Med. 2016;12:2455–2468. doi: 10.3892/etm.2016.3648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yeh TS, Wu CW, Hsu KW, Liao WJ, Yang MC, Li AF, Wang AM, Kuo ML, Chi CW. The activated Notch1 signal pathways is associated with gastric cancer progression through cyclooxygenase-2. Cancer Res. 2009;69:5039–5048. doi: 10.1158/0008-5472.CAN-08-4021. [DOI] [PubMed] [Google Scholar]
  • 19.Thiel A, Mrena J, Ristimäki A. Cyclooxygenase-2 and gastric cancer. Cancer Metastasis Rev. 2011;30:387–395. doi: 10.1007/s10555-011-9312-1. [DOI] [PubMed] [Google Scholar]
  • 20.Cho SJ, Kim N, Kim JS, Jung HC, Song IS. The anti-cancer effect of COX-2 inhibitors on gastric cancer cells. Dig Dis Sci. 2007;52:1713–1721. doi: 10.1007/s10620-007-9787-3. [DOI] [PubMed] [Google Scholar]
  • 21.Fu SL, Wu YL, Zhang YP, Qiao MM, Chen Y. Anti-cancer effects of COX-2 inhibitors and they correlation with angiogenesis and invasion in gastric cancer. World J Gastroenterol. 2004;10:1971–1974. doi: 10.3748/wjg.v10.i13.1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Greenhough A, Smartt HJ, Moore AE, Roberts HR, Williams AC, Paraskeva C, Kaidi A. The COX-2/PGE2 pathways: Key roles in the hallmarks of cancer and adaptation to the tumour microenvironment. Carcinogenesis. 2009;30:377–386. doi: 10.1093/carcin/bgp014. [DOI] [PubMed] [Google Scholar]
  • 23.Ristimäki A, Honkanen N, Jänkälä H, Sipponen P, Härkönen M. Expressions of cyclooxygenase-2 in human gastric carcinoma. Cancer Res. 1997;57:1276–1280. [PubMed] [Google Scholar]
  • 24.Uefuji K, Ichikura T, Mochizuki H. Cyclooxygenase-2 expressions is relate to prostaglandin biosynthesis and angiogenesis in human gastric cancer. Clin Cancer Res. 2000;6:135–138. [PubMed] [Google Scholar]
  • 25.Tsuji S, Kawano S, Sawaoka H, Takei Y, Kobayashi I, Nagano K, Fusamoto H, Kamada T. Evidences for involvement of cyclooxygenase-2 in proliferation of two gastrointestinal cancer cell lines. Prostaglandins Leukot Essent Fatty Acids. 1996;55:179–183. doi: 10.1016/S0952-3278(96)90095-2. [DOI] [PubMed] [Google Scholar]
  • 26.Kim N, Kim CH, Ahn DW, Lee KS, Cho SJ, Park JH, Lee MK, Kim JS, Jung HC, Song IS. Anti-gastric cancer effects of celecoxib, a selective COX-2 inhibitor, through inhibition of Akt signaling. J Gastroenterol Hepatol. 2009;24:480–487. doi: 10.1111/j.1440-1746.2008.05599.x. [DOI] [PubMed] [Google Scholar]
  • 27.Charalambous D, O'brien PE. Inhibition of colon cancer precursors in the rat by sulindac sulphone is not dependent on inhibition of prostaglandin synthesis. J Gastroenterol Hepatol. 1996;11:307–310. doi: 10.1111/j.1440-1746.1996.tb01376.x. [DOI] [PubMed] [Google Scholar]
  • 28.Elder D, Halton DE, Hague A, Paraskeva C. Induction of apoptotic cell death in human colorectal carcinoma cell lines by a cyclooxygenase-2 (COX-2)-selective nonsteroidal anti-inflammatory drug: Independence from COX-2 protein expressions. Clin Cancer Res. 1997;3:1679–1683. [PubMed] [Google Scholar]
  • 29.Hanif R, Pittas A, Feng Y, Koutsos MI, Qiao L, Staiano-Coico L, Shiff SI, Rigas B. Effects of nonsteroidal anti-inflammatory drugs on proliferation and on induction of apoptosis in colon cancer cells by a prostaglandin-independent pathways. Biochem Pharmacol. 1996;52:237–245. doi: 10.1016/0006-2952(96)00181-5. [DOI] [PubMed] [Google Scholar]
  • 30.Song X, Zhong H, Zhou J, Hu X, Zhou Y, Ye Y, Lu X, Wang J, Ying B, Wang L. Association between polymorphisms of microRNA-binding sites in integrin genes and gastric cancer in Chinese Han population. Tumor Biol. 2015;36:2785–2792. doi: 10.1007/s13277-014-2903-z. [DOI] [PubMed] [Google Scholar]
  • 31.Wang Y. Wnt/Planar cell polarity signaling: A new paradigm for cancer therapy. Mol Cancer Ther. 2009;8:2103–2109. doi: 10.1158/1535-7163.MCT-09-0282. [DOI] [PubMed] [Google Scholar]
  • 32.Hemler ME. Integrin associated proteins. Curr Opin Cell Biol. 1998;10:578–585. doi: 10.1016/S0955-0674(98)80032-X. [DOI] [PubMed] [Google Scholar]
  • 33.Dedhar S, Saulnier R, Nagle R, Overall CM. Specific alterations in the expressions of α3β1 and α6β4 integrins in highly invasive and metastatic variants of human prostate carcinoma cells selected by in vitro invasion through reconstituted basement membrane. Clin Exper Met. 1993;11:391–400. doi: 10.1007/BF00132982. [DOI] [PubMed] [Google Scholar]
  • 34.Sampson-Johannes A, Wang W, Shtivelman E. Colonization of human lung grafts in SCID-hu mice by human colon carcinoma cells. Int J Cancer. 1996;65:864–869. doi: 10.1002/(SICI)1097-0215(19960315)65:6<864::AID-IJC26>3.0.CO;2-2. [DOI] [PubMed] [Google Scholar]
  • 35.Huang MY, Yen LC, Liu HC, Liu PP, Chung FY, Wang TN, Wang JY, Lin SR. Significant overexpression of DVL1 in taiwanese colorectal cancer patients with liver metastasis. Int J Mol Sci. 2013;14:20492–20507. doi: 10.3390/ijms141020492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Katoh M. WNT/PCP signaling pathways and human cancer (review) Oncol Rep. 2005;14:1583–1588. [PubMed] [Google Scholar]
  • 37.Tang H, Kong Y, Guo J, Tang Y, Xie X, Yang L, Su Q, Xie X. Diallyl disulfide suppresses proliferation and induces apoptosis in human gastric cancer through Wnt-1 signaling pathways by up-regulation of miR-200b and miR-22. Cancer Lett. 2013;340:72–81. doi: 10.1016/j.canlet.2013.06.027. [DOI] [PubMed] [Google Scholar]
  • 38.Lin XC, Zhu Y, Chen WB, Lin LW, Chen DH, Huang JR, Pan K, Lin Y, Wu BT, Dai Y, Tu ZG. Integrated analysis of long non-coding RNAs and mRNA expressions profiles reveals the potential role of lncRNAs in gastric cancer pathogenesis. Int J Oncol. 2014;45:619–628. doi: 10.3892/ijo.2014.2431. [DOI] [PubMed] [Google Scholar]
  • 39.Chen S, Li P, Xiao B, Guo J. Long noncoding RNA HMlincRNA717 and AC130710 have been officially name as gastric cancer associated transcript 2 (GACAT2) and GACAT3, respectively. Tumor Biol. 2014;35:8351–8352. doi: 10.1007/s13277-014-2378-y. [DOI] [PubMed] [Google Scholar]
  • 40.Okugawa Y, Toiyama Y, Hur K, Toden S, Saigusa S, Tanaka K, Inoue Y, Mohri Y, Kusunoki M, Boland CR, Goel A. The expressions of metastasis-associated long non-coding RNA, HOTAIR, is involved in cancer development and peritoneal metastasis in gastric cancer. Cancer Res. 2014;74:3553–3553. doi: 10.1158/1538-7445.AM2014-3553. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Oncology Letters are provided here courtesy of Spandidos Publications

RESOURCES