Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2017 Jul 6;18(7):1455. doi: 10.3390/ijms18071455

Reply to the Letter to the Editor by A. Schwelm and S. Neuhauser: “Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates”

Rawnak Laila 1, Jong-In Park 1, Arif Hasan Khan Robin 1,2, Kiwoung Yang 1, Gyung Ja Choi 3, Ill-Sup Nou 1,*
PMCID: PMC5535946  PMID: 28684669

The authors of Laila et al. [1] would like thank to the readers (A. Schwelm and S. Neuhauser) for submitting a letter requesting the authors to correct ribosomal DNA (rDNA) sequences of 11 Korean Plasmodiophora bassicae isolates at the 3′-end. After re-sequencing 2069 bp large subunit (LSU) sequences at the 3′-end, the authors confirm that in the main text of our original paper [1]: Figures 4–6 are redundant. In the supplementary materials of our original paper [1]: Table S1, Figures S4–S6 and S8 and Probes 5516, 6754 and 6479 in Figure S7 are redundant.

Here, we have corrected rDNA sequences of 11 Korean P. bassicae isolates and submitted the revised sequences to NCBI. The up-to-date accession numbers of rDNA sequences are given in Table 1.

Table 1.

The up-to-date GenBank accession numbers of ribosomal DNA sequences of 11 Korean Plasmodiophora bassicae isolates.

Different Geographic Isolates Accession No. Sequence Length (bp) Sequence Encoding
Gangneung1 KX430457.3 7421 Partial ribosomal RNA, both small and large subunits
Yeoncheon KX430458.3 7421
Daejon KX430459.3 7425
Haenam2 KX430460.3 7426
Seosan KX430461.3 7423
Pyeongchang KX430462.3 7424
Gangneung2 KX430463.3 7421
Haenam1 KX430464.3 7425
Hoengseong KX430465.3 7425
Geumsan KX430466.3 7424
Goesan KX430467.3 7424

The updated rDNA sequences of P. brassicae of Korean isolates now have over 98% sequence identity with reference sequence KX011115. Korean isolates Yeoncheon, Daejon, Haenam2, Gangneung2, Haenam1 and Geumsan have identical rDNA sequences. These six isolates have less than 1% sequence dissimilarities with another five isolates.

The phylogenetic tree grouped rDNA sequences of both Korean and reference isolates, reported by Schwelm et al. [2], of P. brassicae in the same cluster as shown in Figure 1. Thus, the phylogenetic tree separated rDNA sequences of Korean and reference isolates from other cercozoans. Strikingly, the Japanese NGY isolate AB526853 [3] clustered with non-parasitic Glissomonadida, Heteromita globosa.

Figure 1.

Figure 1

Phylogenetic tree constructed following the Neighbor-joining method and Maximum Composite Likelihood model in Mega6.06 software between the 11 Korean field isolates and the reference isolates of P. brassicae based on variations in the nucleotide sequences of rDNA. Complete rDNA, if available, or LSU sequences were used.

We previously used the rDNA sequences of the Japanese NGY isolate, accession number AB526843 [3], as a reference for designing primers to obtain rDNA sequences of 11 Korean P. bassicae isolates. There were no complete published rDNA sequences except AB526843 when we started sequencing and obtained rDNA sequences of selected Korean P. bassicae isolates. In a recent article, it was reported that rDNA sequences of NGY isolate were chimeric in nature between P. brassicae and non-parasitic Glissomonadida [2]. We became aware of this issue after our article was published [1].

We have now, therefore, designed primers based on the following two sequences, KX011115 and KX011135, published by Schwelm et al. [2] to correct sequences of LSU of 11 Korean P. bassicae isolates that mismatched with recently reported sequences (Table 2). The procedure of constructing the phylogenetic tree has been described in Laila et al. [1].

Table 2.

List of primer sequences used for cloning and sequencing the large subunit of rDNA of target region of P. brassicae.

Primer Name Target Region Forward Primer Reverse Primer Product Size (bp)
LSU1 5391–5671 GAACCAGGACGTGGATATTGTATGG CCGACTTCCCTTACCTACATTGTT 281
LSU2 5648–6639 CATTGATTCTCCCGCTGGGCCC GCTGTGGTTTCGCTAGATAGTAGA 1185
LSU3 6549–7459 GGAGTTCGAACAGCTCTTAAGGTA GTATAGTATGATGCCCGACCCATT 911

In conclusion, Among 11 Korean P. brassicae isolates Yeoncheon, Daejon, Haenam2, Gangneung2, Haenam1 and Geumsan had identical rDNA sequences. The other five isolates had less than 1% sequence dissimilarities with those six isolates. The rDNA sequences of 11 Korean P. brassicae including LSU had 98% identity with the reference rDNA sequences of European isolates KX011115 and KX011135.

Conflicts of Interest

The authors declare no conflict of interest.

References

  • 1.Laila R., Robin A.H.K., Yang K., Choi G.J., Park J.I., Nou I.S. Detection of ribosomal DNA sequence polymorphisms in the protist Plasmodiophora brassicae for the identification of geographical isolates. Int. J. Mol. Sci. 2017;18:84. doi: 10.3390/ijms18010084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Schwelm A., Berney C., Dixelius C., Bassc D., Neuhauser S. The large subunit rDNA sequence of plasmodiophora brassicae does not contain intra-species polymorphism. Protist. 2016;167:544–554. doi: 10.1016/j.protis.2016.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Niwa R., Kawahara A., Murakami H., Tanaka S., Ezawa T. Complete structure of nuclear rDNA of the obligate plant parasite Plasmodiophora brassicae: Intraspecific polymorphisms in the exon and group I intron of the large subunit rDNA. Protist. 2011;162:423–434. doi: 10.1016/j.protis.2011.02.005. [DOI] [PubMed] [Google Scholar]

Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES