Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2017 Aug 17;7:8502. doi: 10.1038/s41598-017-09156-7

Identification of Endogenous Reference Genes for RT-qPCR Expression Analysis in Urochloa brizantha Under Abiotic Stresses

Luciana Midori Takamori 1, Alyne Valéria Carrion Pereira 1, Gustavo Maia Souza 2, Luiz Gonzaga Esteves Vieira 1, Alessandra Ferreira Ribas 1,✉
PMCID: PMC5561021  PMID: 28819216

Abstract

Urochloa brizantha is one of the most important warm season forage grasses in tropical countries. Despite its importance, there are few studies on gene expression in this species under stressful conditions. Real-time (RT-qPCR) is an accurate technique for gene quantification analysis, but reference genes must be validated under the same conditions used to assess the expression of the target genes. Here, we evaluated the stability of nine reference genes: Actin 12, Eukaryotic initiation factor 4 A, Elongation factor-1 alpha, FTSH protease 4, U2 auxiliary fator, Succinol Co-enzyme A, Tubulin alfa-5, Tubulin beta-6, Ubiquitin conjugating enzyme. Total RNA was extract from leaf tissues of U. brizantha subjected to 6, 12 and 24 h of cold and heat stresses (10 and 45 °C, respectively), and drought, including moderate (−0.5 to −0.7 MPa), severe (−1.1 to −1.8 MPa) and recovery after re-watering. The RefFinder web-based tool was used to rank the most stable reference genes for each stress. Elongation factor-1 alpha, Elongation factor-1 alpha or Ubiquitin conjugating enzyme, and Eukaryotic initiation factor 4 A were the most stable genes for heat, cold and drought stress, respectively. The expression of Rubisco large subunit gene was normalized against the most stable gene selected by ReFfinder for each stress.

Introduction

Native from Africa, signal grass [(Urochloa brizantha (Hochst. Ex. A. Rich)] Stapf, formely Brachiaria brizantha 1 is a perennial grass belonging to the Poaceae family that is mainly used for livestock farming. Brazil is the second largest cattle and beef producer in the world. That production is based on planted pastures, as they provide feed and ensure low production costs2. Despite its great importance, this species is still considered a ‘genomic orphan’ due to limited availability of genetic and genomic information.

Quantitative real-time PCR (RT-qPCR) is considered the most accurate and reliable technique to measure gene expression and to validate data obtained by other methods like cDNA microarrays and RNA-seq. For some genes with very low levels of transcription, only RT-qPCR technique can detect such a small number of mRNA copies3. However, accurate normalization is a crucial step for the correct measurement of gene expression since the expression of constitutive genes might vary from cell to cell and according to the experimental conditions; therefore, the expression stability of candidate reference genes has to be verified before each research condition4.

Different algorithms have been developed to identify the best reference gene(s) among a group of potential candidate genes. NormFinder4, geNorm5, BestKeeper6 and ΔCt method7 are the most commonly methods used for this propose. These softwares calculate a measure of the stability of potential reference genes by comparing their individual stability in relation to the other tested genes under different experimental conditions. RefFinder8 is a web-based tool that integrates the four algorithms cited before. Based on the rankings from each program, it calculates the geometric mean to establish a comprehensive rank from a panel of candidate genes.

In U. brizantha, only one study investigated the expression profile of eight candidate reference genes in sexual and apomictic accessions of this species9. To our knowledge, there is no report regarding the identification of the stably expressed reference genes in U. brizantha for experimental conditions such as heat, cold and drought stresses.

In this work, we evaluate the suitability of nine reference genes [Actin 12 (ACT12), Eukaryotic initiation factor 4 A (eIF4a), Elongation factor 1-alpha (EF1-α), FTSH protease 4 (FTHS), U2 auxiliary fator (U2AF), Succinol Co-enzyme A (SucCoa), Tubulin alfa-5 (α-TUB5), Tubulin beta-6 (β-TUB6) and Ubiquitin conjugating enzyme (UbiCo)] as candidates for normalization in RT-qPCR assays to study the transcriptional changes involved in the responses of U. brizantha to three different abiotic stresses using the RefFinder web-based tool8.

In addition, considering that Rubisco activity is highly regulated in response to abiotic stresses10, the relative expression of the plastidial large subunit of ribulose 1, 5-bisphosphate carboxylase/oxygenase (rbCl) gene in leaves of U. brizantha plants under the abiotic stresses was calculated to assess the reliability of the chosen reference genes to normalize the RT-qPCR data.

Results

The description of the nine genes tested in this work and their genebank accession number are in Table 1. Primer sequences, amplicon sizes and amplification efficiency values are in Table 2. The primer efficiency was calculated with LinRegPCR software, where 2.0 means 100% efficiency (Table 1).

Table 1.

List and description of the genes used in this study. Primer sequences (5′–3′) employed in the RT–qPCR analysis, amplicon sizes and LinRegPCR-derived PCR efficiency values.

Gene Name NCBI genbank Accession number Gene symbol Forward primer Reverse primer Amplicon size (bp) Primer efficiency ± SD R
Actin 12 JG436709.1 ACT12 GGGTGGAGAGAGATTGCAGGTTA GGGAACTGAGGCAACCACAGA 85 1.99 ± 0,073 0,9861
Eukaryotic initiation factor 4 A EZ000622 eIF4a CAGGTGTCCCTGGTCATCAACTAT GAAACGACCTCTACGACCAATGC 81 2.01 ± 0,025 0,9998
Elongation factor-1 alpha EZ000623 EF1-α CAAGGCTGCTGCCAAGAAGA CTGCAAGAACCAGCCTTGAACA 111 1.97 ± 0,052 0,9887
FTSH protease 4 JG437233.1 FTSH GCAACTTATGGACCAGGAGGTT CGCACTGGGTTCATCAATCA 115 1.97 ± 0,007 0,9995
U2 auxiliary fator JG436537.1 U2AF CGCCCACCTGCAAAGATATT GGTGCTGGTAAGCAGTCCTCAT 104 1.90 ± 0,015 0,9984
Succinol Co-enzyme A GE617476 SucCoa ATGTACTTTGCCATCACCCTTGA TCAATACTGGTTCCTCCCTTGCT 80 1.94 ± 0,029 0,9992
Tubulin alfa-5 GE617477 α-TUB5 CGTGTGCATGATCAGCAACA GCGCTTGGCGTACATCAGAT 85 1.98 ± 0,019 0,9765
Tubulin beta-6 JG436975.1 β-TUB6 GTACCAGGACGCAACTGCTGAT GAAATCTGCCTGCCCTAGAAGCT 119 2.07 ± 0,018 0,9989
Ubiquitin conjugating enzyme GE617481.1 UbiCo CATCTGCTCCCTGCTGACTGA GCCGGTCCGTCTTGTACATATG 80 1.92 ± 0,049 0,9247
Rubisco large subunit from U. Panicoides HE573318.1 rbCl CGGAGTACGAAACCAAGGATACTG ACTGCAGCCCCTGCTTCTT 91 1.97 ± 0,007 0,9994

Table 2.

Ranking of candidate reference genes according to stability values in a pool of Urochloa brizantha leaves samples subjected to various abiotic stresses.

Gene Name geNorm NormFinder BestKeeper ΔCt RefFinder
Rank order Average expression stability (M) Rank order Stability Value (SV) Rank order Standard deviation [ + /−CP] Rank order Average of standard deviations Rank order Geometric mean of ranking values
Heat Stress
EF1-α 6 1,297 1 0,727 5 1,21 1 1,35 1 2,34
U2AF 2 0,813 4 0,988 2 0,78 4 1,44 2 2,38
β-TUB6 1 0,813 8 1,472 1 0,76 8 1,73 3 2,83
Act12 5 1,231 2 0,788 6 1,46 2 1,39 4 3,31
α-TUB5 3 0,976 5 1,009 3 1,12 5 1,47 5 3,87
eIF4a 7 1,374 3 0,943 8 2,02 3 1,41 6 4,74
SucCoa 4 1,109 6 1,018 4 1,19 6 1,49 7 4,90
FTSH 8 1,453 7 1,360 9 2,35 7 1,68 8 7,71
UbiCo 9 1,529 9 1,517 7 1,77 9 1,80 9 8,45
Cold Stress
EF1-α 1 0,667 4 0,592 1 0,84 3 1,18 1 1,86
UbiCo 3 0,824 1 0,501 4 0,91 1 1,15 2 1,86
α-TUB5 2 0,667 2 0,549 5 0,90 2 1,16 3 2,11
eIF4a 4 0,915 3 0,591 6 0,98 4 1,18 4 4,12
SucCoa 5 1,010 5 0,992 8 1,24 5 1,40 5 5,62
Act12 7 1,109 8 1,360 2 0,87 8 1,55 6 5,66
FTSH 8 1,206 7 1,247 3 0,90 7 1,55 7 5,66
β-TUB6 6 1,105 6 1,237 9 1,52 6 1,54 8 6,64
U2AF 9 1,392 9 1,496 7 1,00 9 1,73 9 8,45
Drought Stress
eIF4a 1 0,565 1 0,656 6 0,96 1 1,26 1 1,57
U2AF 2 0,565 2 0,761 3 0,92 2 1,31 2 1,86
α-TUB5 5 1,208 5 1,155 1 0,74 6 1,54 3 3,50
SucCoa 6 1,261 3 0,772 4 0,93 3 1,33 4 3,83
β-TUB6 4 1,110 6 1,210 2 0,78 5 1,53 5 3,94
EF1-α 3 1,023 8 1,301 5 0,95 7 1,61 6 5,38
Act12 7 1,324 4 0,867 7 1,03 4 1,36 7 5,29
FTSH 8 1,414 7 1,294 8 1,11 8 1,64 8 7,74
UbiCo 9 1,474 9 1,437 9 1,51 9 1,68 9 9,00

The mean efficiency values for the primer pairs (three replicates) ranged from 1.90 (U2AF) to 2.07 (β-TUB6) that means 95 to 103.5% efficiency, respectively. The melting curve analysis performed at the end of RT-qPCR reactions for all selected candidate genes to check the specificity and integrity of the PCR products showed the presence of a single peak (Fig. 1). In addition, regular PCR reaction using the primer pairs followed by agarose gel electrophoresis revealed a single DNA band in each gel lane (Fig. 2).

Figure 1.

Figure 1

Melting curves of PCR products from all reference genes used in this study showing a single peak (each includes two technical replicates of the cDNA pool from all samples).

Figure 2.

Figure 2

Ethidium bromide-stained agarose gel (1.2%) loaded with PCR products from cDNAs for each gene showing single amplificafion band.

In order to select the best stable genes for normalization, expressions of the selected candidate reference genes were compared using leaf tissue of U. brizantha cv. Marandú plants under three abiotic stresses: drought, cold and heat shocks. The means and ranges of the Cq values are an indication of the most stable reference genes across all samples for each stress. The Cq means for all genes ranged from 22.8 (Ubico) to 34.4 (U2AF) for drought, 24.9 (UbiCo) to 33.7 (U2AF) for cold and 24.3 (ACT12) to 33.0 (FTHS) for heat stress. The lowest Cq values were 19.6 (UbiCo) for drought, 23.7 (UbiCo) for cold and 22.5 (ACT12) for heat stress, while the highest values were 36.5 and 35.9 (U2AF) for drought and cold stress, respectively, and 35.9 (FTSH) for heat stress (Fig. 3). The coefficients of variation (CV%) of the Cq values ranged from 2.89 (U2AF) to 8.2% (UbiCo) for heat stress, 3.4 (EF1α) to 5.5% (β-TUB6) for cold stress and 2.9 (α-TUB5) to 7.8% (UbiCo) for drought stress. To calculate the gene stability values of reference genes for gene expression studies in U. brizantha we used RefFinder8, a freely available web-based tool that combines the results from geNorm, NormFinder, and BestKeeper and ΔCt methods. When all stresses were considered together the NormFinder and ΔCt methods showed exactly the same classification for all genes from the most to least stable gene: (eIF4a > α-TUB5 > β-TUB6 > SucCoa > ACT12 > EF1-α > UbiCo > U2AF > FTSH) (Fig. 4). On the other hand, for the BestKeeper and geNorm algorithms only the two least stable genes ranked at the same position (Fig. 4). Considering all stress together α-TUB5 was the most stable gene, while the reference gene FTSH was considered the least stable gene in all four algorithms and in the comprehensive ranking generated by RefFinder (Fig. 4).

Figure 3.

Figure 3

Average of Cq values of the candidate reference genes for each stresses: A –heat, B- cold and C – drought stress, with a total of 12 samples for each gene. Box-plot graph shows the median values as lines across the box. Lower and upper boxes indicate the 25th percentile and 75th percentile, respectively. Whiskers represent the maximum and minimum values.

Figure 4.

Figure 4

Rank of the candidate genes for all treatments combined (heat, cold and drought) generated by RefFinder web-tool showing the values for each of the four different algorithms. ΔCt method (Mean SD), NormFinder (Stability value), geNorm (Average expression stability M), BestKeeper (SD [±CP] crossing point values) and the final comprehensive ranking.

The rankings of the four algorithms (geNorm, NormFinder, and BestKeeper and ΔCt method) and the RefFinder comprehensive ranking for each stress separately is shown in Table 2. The most and the least stable genes do not rank at the same position for all four algorithms. For heat stress, the most stable gene ranked by the NormFinder and ΔCt methods was EF1-α, while β-TUB6 was selected by the geNorm and BestKeeper. UbiCo was ranked as the least stable reference gene, with exception of the BestKeeper software that selected FTSH instead.

For cold stress EF1-α was ranked as the most stable by geNorm and BestKeeper while UbiCo by NormFinder and ΔCt. For drought stress, eIF4a was ranked as most stable for all methods, except for BestKeeper; under this stress condition, the UbiCo was ranked as the least stable by the four algorithms (Table 2). Considering the comprehensive rank generated by RefFinder for each stress separately, the most stable genes were EF1-α, EF1-α or UbiCo and eIF4a for heat, cold and drought stresses, respectively, whereas the genes ranked as the least stable were UbiCo (heat and drought) and U2AF (cold) (Table 2).

The analysis of the transcriptional profile of the rbCl gene in leaves of U. brizantha cv. Marandú subjected to the various abiotic stresses was normalized against all genes from the most to the least stable gene selected by the ranking generated by RefFinder (Table 2). The results in Fig. 5 indicate that different reference genes can influence target gene relative expression levels. Our results showed that EF1-α was progressively upregulated under heat stress. However, when using the least stable gene (UbiCo) for that same stress treatment, the mRNA level showed a 5-fold difference in the severe heat stress condition (24 h at 45 °C) compared to the value detected using EF1-α (Fig. 5A).

Figure 5.

Figure 5

Relative expression of the rbCl gene in leaves of U. brizantha cv. Marandú under three abiotic stresses normalized to reference genes ranked according to the RefFinder approach: A – heat, B – cold and C - drought. The results are expressed as mean fold in change in relative expression compared to control samples. Bars indicate the standard error (±SE) calculated from three biological replicates.

For the cold stress treatment, the relative expression patterns of rbCl gene were very similar when normalized with the three most stable genes ranking by RefFinder (EF1-α, UbiCo and α-TUB5). In contrast, when normalized against the least stable gene (U2AF), the target gene rbCl showed a quite different expression pattern. When the EF1-α gene was used as reference, a 1.5 fold increase in transcript abundance of the rbCl gene after 6 h at 10 °C was detected, while a near 8-fold difference was observed when the transcripts were normalized against U2AF (Fig. 5B).

On the other hand, there was no noticeable difference between the rbCl expression in plants exposed to drought stress treatments when the data was normalized against the two most (eIF4a and U2AF), or the least stable gene (UbiCo), for the severe water decifit and recovery conditions. Although all algorithms, including RefFinder, ranked UbiCo as the least stable reference gene for normalization in leaves of U. brizantha submitted to drought stress (Table 2), the rbCl gene was shown to be slightly down-regulated across all water deficit treatments, similarly to the results obtained using the most stable reference genes (Fig. 5C).

Discussion

RefFinder8, an easy to use web-based tool that integrates the currently most used methods (geNorm, NormFinder, BestKeeper and the comparative ΔCt method) was used to compare and rank a set of nine reference genes for assessing gene expression in U. brizantha plants under three abiotic stresses: heat, cold and drought. The geNorm determines the average pairwise variation (V) for a candidate reference gene in comparison with all other tested reference genes by calculating the expression stability measure (M). The NormFinder software compares each gene to the mean derived from the dataset to identify the gene(s) with the greatest stability5. BestKeeper directly uses Cq values as the input to calculate the geometric and arithmetic mean, minimal and maximal value, standard deviation and coefficient of variance6. ΔCt method approach compares relative expression of pairs of genes within each sample7. Comparisons among these methods have been frequently reported and, in many cases, a set of candidate genes selected by those approaches does not rank at same position11–15.

Based on the rankings obtained from each method, RefFinder gives an appropriate weight to individual genes and calculates the geometric mean of their weights for the overall final ranking8. The composite scores from RefFinder allow for the validation of the most stable reference genes. In this work, only the NormFinder algorithm and the ΔCt method gave the same rank order when considering all stresses together.

From the set of reference genes tested, tubulin alfa-5 (α-TUB5) was found to be the most stable while FTSH ranked as the least stable gene across all stresses (drought, cold and heat) in U. brizantha as calculated by RefFinder. This gene (α-TUB5) is one of the most commonly used as reference gene for the analysis of relative transcript expression levels; neverthless it was considered one of the most unstable reference among 32 genes used for quantification of gene expression in wheat in various tested conditions, including different tissues, developmental stages and temperature stresses16. Tubulin was also found to be the second most stable for normalization of different tissues of swichtgrass plants (Panicum virgatum) considering different abiotic stresses (drought, high salinity, cold, heat, and waterlogging) altogether. However, when each stress was analyzed separately, this gene was not ranked in the same position, presenting the largest variation in transcript levels between the stresses17.

As the expression of most the reference genes varied under different abiotic stresses, no single gene could be considered suitable for normalization of all experiments. Thus, it is more appropriate to select the reference genes for each specific stress. In this work, the eukaryotic initiation factor (eIF4a), which mediates the binding of mRNA to the ribosome, functioning as a subunit of the initiation factor complex eIF4a 18, was considered the most stable gene under drought stress using RefFinder. The eIF4a has also been identified as the most suitable reference gene for normalization in gene expression studies of sugarcane under drought treatments13. For different abiotic stresses, including drought, salt and heat waterlogging and ABA treatments, the eIF4a gene ranked as one of the best reference genes for normalization of RT-qPCR data in perennial ryegrass (Lolium perenne), although not always ranked first for all stresses19.

Eukaryotic elongation factor 1 alpha (EF1-α), which catalyzes the binding of aminoacyl-trna to the A-site of the ribosome by a GTP-dependent mechanism20, was identified as the most stable reference gene for both heat and cold stresses by the RefFinder tool. In several species and at different experimental conditions, EF1-α has been selected as one of the most stable genes. For example, it was considered the most stable gene in Caragana intermedia, a drought-resistant desert shrub, subjected to cold and salt stress12. In addition, for gene expression normalization in coffee plants under abiotic stresses, EF1-α was one of the recommended reference genes21.

In several species of grasses, the EF1-α gene has been selected as one of the most stable genes under different conditions. In perennial ryegrass, EF-1α and UBQ5 genes were the most stably expressed reference genes in leaves during plant development22. This same combination of reference genes were found to be a reliable for RT-qPCR data normalization in aerial tissues of Lolium temulentum plants under abiotic stresses23. In male and female reproductive tissues, spikelets, roots and leaves of U. brizantha, the genes EF1-α and UbiCo were the more stable, while for ovary tissues, where apomictic and sexual reproduction occur, the best ranked reference genes were UbiCo, eIF4a and EF1-α 9.

The genes EF1-α and eIF4a are among the most stable reference genes for normalization in different monocot plant species, such as maize under heat and cold stress24 and switchgrass25, 26. In Brachypodium distachyon, the EF1-α was the most stable gene for cold and heat treatments27. Also, in leaves of creeping bentgrass (Agrotis stolonifera) under cold stress, EF1-α and Ubi3 (E3 ubiquitin protein ligase) were selected by RefFinder as the most stable genes for normalization28. Besides that, EF1-α and RNA POL II were identified as the most appropriate internal controls for dehydration stress-related expression analyses in foxtail millet (Setaria italica)29.

In our work, as observed in other grass species, the EF1-α gene was ranked by RefFinder at the first position in gene stability for cold and drought stresses in leaves of U. brizantha. Ubiquitin-conjugating enzyme, ranked in the second position for cold stress, was also one the most suitable reference genes across different cold treatments in switchgrass17. Elongation factor-1 alpha and Ubiquitin-conjugating enzyme E2 were also ranked as the most stable genes across individual and multiple abiotic stresses, and also various developmental tissues in pearl millet (Pennisetum glaucum)30. On the other hand, EF1-α was considered the least stable gene for four abiotic stresses (drought, salt, dark and heat) in Reaumuria soongorica, a plant that is tolerant to extremely drought conditions, while the histone H2A and eukaryotic initiation factor 4A-2 (eIF4a) were considered the most stable genes for those conditions31.

Aiming to validate the reference genes selected for studies with U. brizantha plants under the three major abiotic stresses (heat, cold and drought) we evaluated the relative expression of the plastidial rbCl gene normalized to reference genes according to RefFinder rank. The plastidic rbCl gene encodes the large subunit of the primary CO2 fixation enzyme Rubisco in the mature C4 leaves of U. brizantha and has been used to validate candidate reference genes in plants submitted to abiotic stress31.

When normalization of rbCL gene was performed with reference genes poorly ranked according to RefFinder, a clear over-estimation of transcript abundance the target gene was observed in some samples, particularly in leaves subjected to heat and cold stresses. For drought stress, a high variation on expression pattern was observed depending on the reference gene used for normalization, except for the two better-ranked genes that showed exactly the same profile.

The analysis of the transcriptional profile of the rbCl gene in plants of U. brizantha cv. Marandú normalized with EF1-α, ranked as the most stable gene, showed that it was progressively upregulated under heat stress. C4 plants, such as U. brizantha, are generally adapted to warm environments. This fact could be explained by the increased CO2 assimilation rates at high temperatures at the place of Rubisco in the photosynthetic bundle sheath32. The increased transcript levels of large subunit of Rubisco was also observed during heat stress in tobacco, a C3 species, where increased respiration did not cause a significant change in photosynthesis33.

The analysis of the transcriptional profile of the rbCl gene in plants of U. brizantha cv. Marandú normalized with EF1-α showed that this gene was progressively upregulated under heat stress. This observartion was expected since C4 plants, such as U. brizantha, are generally adapted to warm environments. This fact could be explained by the increased CO2 assimilation rates at high temperatures at the place of Rubisco in the photosynthetic bundle sheath32. The increased transcript levels of the large subunit of Rubisco was also detected during heat stress in tobacco, a C3 species33.

For the cold treatment, the relative expression of rbCl normalized against the EF1-α showed only a slight increase in the transcript abundance after 6 hour at 10 °C and then a small but progressive decline until 24 °C of cold stress. This small variation in rbCl transcrips was expected since only in long-term acclimation the large subunits of rubisco increased in abundance34. It occurs because plants grown at low temperatures have higher amounts of photosynthetic enzymes, including Rubisco to compensate for decreased activities of the enzymes at low temperatures34. In contrast, when the rcbl gene was normalized against the less stable reference gene (U2AF), a large variability was observed, illustrating the low expression stability when using this gene for normalization of data from cold stress treatment.

The relative expression of rbCl gene against the two most stable reference genes eIF4a and U2AF showed the same profile. The rbCl gene was down-regulated under drought stress treatment. There was no remarkable expression differences between the most and the least stable candidate references used for normalize rbCl gene in U. brizantha subjected to drought stress. The rbCl was down-regulated when U. brizantha plants were exposed to the drought stress treatments using either the most stable or the unstable reference gene. In agreement with our results, the quantity of rbCl mRNA transcript was reduced when Pinus halepensis plants were subjected to drought stress35. This was expected as Rubisco was proved to be down-regulated in several stressful conditions that impose alterations in photosynthesis rate and carbon assimilation32, 36, 37.

The use of the stable reference genes resulted in the consistency of rbCl gene expression according to the literature, as discussed above. In contrast, biases were produced when the less stable reference genes were used as internal control, which could lead to misinterpretation of the rbCl expression patterns in U. brizantha plants under different environmental stresses.

To our knowledge, this is the first detailed report on selection and validation of reference genes for RT-qPCR of Urochloa brizantha plants under different abiotic stresses. Our results showed the stability of nine selected genes by using RefFinder to rank the potential candidate reference genes. Based on this approach, α-TUB5 was ranked as the overall most suitable reference gene across the multiple abiotic stresses tested - drought, cold and heat. However, different reference genes are recommended for gene expression normalization for U. brizantha under those stress conditions: EF1-α for heat, EF1-α or UbiCo for cold and eIF4a for drought stress. In contrast, the frequently used reference genes UbiCo (for drought and heat) and U2AF (for cold) were the least suitable for the conditions used in this work. The appropriateness of these genes for further studies of abiotic stresses in U. brizantha was confirmed by the expression the rbCl gene after normalization.

Methods

Plant Material

Signal grass seeds from the 2012/13 season kept in cold storage at 15 °C were sown in trays containing Bioplant® substrate. Forty days after sowing, the seedlings were transferred to pots containing 5 kg of sandy soil (Ferric alisol). Soil acidity was corrected with dolomitic limestone and treated with 10-10-10 (NPK) fertilizer. The plants were cultivated in a greenhouse under natural light and long-day photoperiod of 16/8 h (light/dark) at 28 °C. The plants were irrigated daily with 500 ml of tap water.

Cold and heat stresses

The stress treatments started five weeks after transferring the plants to pots. Initially, the pots containing two plants each were transferred to a phytotron (Eletrolab model EL011, São Paulo, Brazil), where they were kept for one week at 25 °C/day and 22 °C/night with a photoperiod of 16-h light (intensity 400 µmol photons m−2 s−1) and 8-h dark. The pots were irrigated every day to the maximum soil retention capacity.

The temperatures treatments were carried out after the plants were held for one week under the conditions described above. Sixteen pots containing two plants each were used for each experiment. Four pots were used as control (normal phytotron temperatures prior to stress treatments). After collecting the samples from the control plants, the other twelve pots were subjected to constant temperature of 10 or 45 °C for 24 h for cold or heat shock, respectively. For all treatments, each sample were constituted by six pooled young flag leaves collected before the beginning of each stress and after 6, 12 and 24 h under stressful conditions.

Drought stress

This experiment was carried out under the same conditions depicted above for the initial growth of the plants in a greenhouse. Twenty pots, with two five weeks-old plants per pot, were used in this experiment. The plants were kept at 100% field capacity for a week and then exposed to four watering regimes: 1) No stress (soil water-holding capacity); 2) moderate stress (soil water content maintained at 50% of the maximum soil retention capacity until reaching −0.5 to −0.7 MPa); 3) severe stress (soil water content maintained at 20% of the maximum soil retention capacity −1.0 to −1.8 MPa); and 3) recovery (full-irrigation to soil saturation following the severe stress). The soil moisture was measured daily using sensors (model EC-TM Decagon devices, Pullman, USA). Leaf water status was monitored with a pressure chamber instrument (model PMS 1000, Oregon, USA). The light intensity at the green house was about 900 µmol photons m−2 s−1 during the day.

Biological replicates were represented by three pots with two plants each. Each sample was composed by a pool of six flag leaves collected from each pot subjected to the different stress levels. The samples were placed in plastic bags, frozen with liquid N2 and stored at −80 °C until RNA extraction.

RNA extraction and cDNA synthesis

Each leaf sample (30 mg) was ground in liquid N2 using a mortar and pestle to a fine powder and quickly transferred to pre-cooled eppendorf tubes for RNA extraction. The total RNA was isolated using RNA Mini Kit Purelink™ (Invitrogen, Carlsbad, CA) and the samples were treated with TURBO DNAse™ (Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions. After DNAse treatment, the samples were purified with phenol/chloroform, precipitated with isopropanol and resuspended in 20 µl of DEPC (diethylpyrocarbonate) water. The quality and quantity of total RNA were assessed with a Nanodrop ND-1000TM spectrophotometer (Thermo Fisher Scientific, USA). Only RNA with OD 260:280 ratios always greater than 1.8 was used. The integrity of the RNA was checked upon electrophoresis in a 1.2% agarose gel with Tris-Borate-EDTA buffer (pH 8,0) stained with ethidium bromide by evaluating the integrity of the 28 S and 18 S ribosomal RNA bands and absence of smears.

For each sample, two micrograms of total RNA were used to synthesize first-strand cDNAs using oligo-(dt)18 primers and the Superscript III™ RT kit (Invitrogen, Carlsbad, CA), according to manufacturer’s recommendations.

Selection of reference genes and primer design

Genbank accession numbers for U. brizantha ESTs (Expressed Sequence Tags) corresponding to the reference genes have been previously published by Silveira et al.9. These genes are Elongation factor-1 alpha (EF1-α), Eukaryotic initiation factor (eIF4a), Splicing factor (U2AF), FTSH protease 4 (FTSH), Succinyl-coa ligase (SucCoa), Tubulin alfa-5 (α-TUB5) and Ubiquitin conjugating enzyme (UbiCo). The accession numbers were used to search for nucleotide sequences against dbest database in the GenBank, which in turn, were used to design the primers. To search for ESTss of Actin 12 (ACT12) and Tubulin beta-6 (β-TUB6) genes of U. brizantha, sequences of switchgrass (Panicum virgatum L.) were used as query (accession numbers GR878265 and GR880018, respectively)11. The protein sequences of these genes were blasted against the dbest of U. brizantha using TBLASTN tool37. The selected ESTs were then used as query for the BLASTX (http://blast.ncbi.nlm.nih.gov/Blast.cgi) against the non-redundant protein database for identity verification. The gene description and the GenBank accession numbers of the ESTs used in this work are in Table 1.

For reference gene validation we design primers using the sequence from the plastidial large subunit of Rubisco (rbCl) homolog from U. panicoides (Accession number HE573318.1) (Table 1) because of the absence of rbCl nucleotide sequences from U. brizantha in the NCBI and the high conservation of this gene across plant species38.

All primers were designed using Primer Express software version 3.0.1 (PE Applied Biosystems, Foster City, USA) with the following parameters: amplicon length between 80 and 120 bp; melting temperature (Tm) between 58 and 60 °C, GC content ranging from 50% to 60% and length between 18 and 24 bases (Table 1). The specificity of the primers was checked using Primer-Blast tool (available at: (http://www.ncbi.nlm.nih.gov/tools/primer-blast/).

RT-qPCR

The RT-qPCR assays were performed in 96-well plates using the StepOnePlusTM Real Time PCR System (Applied Biosystems, Foster City USA). All cDNAs were diluted 1:25 to serve as a template for the reactions. Each RT-qPCR reaction contained 5 µl Power SYBR Mix (Applied Biosystems, Foster City, USA), 2 µl of the diluted cDNA, 4 pmol of each of forward and reverse gene-specific primers and ultrapure water up to 10 µl. RT-qPCR reactions were performed as follow: one step thermal cycle of 2 min at 95 °C, and then 40 cycles of 30 s at 95 °C and 30 s at 60 °C. A melting curve analysis was carried out to assess primer specificity and product quality by step-wise denaturation of the PCR product with the following conditions: a final step of 15 s at 95 °C, 1 min at 60 °C and then the fluorescence measured from 60 to 95 °C at each 0.7 °C increment of temperature.

The experiment was performed using biological triplicate samples for each condition tested. Two technical replicates were used for each biological replicate and the average Cq values (Cycle quantification) were used for quantification.

Data analysis

A pool of cDNA from 36 samples was used to carry out the RT-qPCR reactions to estimate the efficiency of each primer pair using the LinRegPCR software version 2015.039. This program uses non-baseline corrected data, performs a baseline correction on each sample separately, determines a window-of-linearity and then uses linear regression analysis to fit a straight line through the PCR data set from which the PCR efficiency of each individual sample is calculated. The primer efficiency is calculated based on slope of the line (E = 10−1/slope), considering an ideal value range (1.8 ≤ E ≤ 2) and correlation (R ≥ 0.995)40.

The expression stabilities of the nine candidate genes was analyzed by RefFinder8 a web-tool that use four different algorithms geNorm5, NormFinder4, BestKeeper6 and the comparative ΔCt method7 all together to establish a compreensive rank of gene stability. A score is then assigned to each gene considering the rankings of the various algorithms employed.

Reference Gene Validation

In order to determine whether the choice of the reference genes ranked by RefFinder affects the normalization of target genes, the same cDNA samples used for the stability analysis of the reference genes were also analysed for the expression of the ribulose-1,5-bisphosphate carboxylase/oxygenase (rbCl) under drought, cold and heat stresses. The ranking of all the references genes, from the most stable to the less stable according to the RefFinder analysis, was used to normalize the rbCl expressions. The relative expression profile of rbCl was obtained according to the 2−ΔΔCt method41. Plants grown without stresses treatments (controls) were selected as calibrator to calculate the ΔΔCt.

Acknowledgements

This study was supported by Grant n° 2013/04819-4 São Paulo Research Foundation (FAPESP). We are grateful by technical support provided by Rafael Rebes Ziliani in the physiological measures. A.V.C.P. received a TT3 scholarship Grant n° 2014/07830-1 São Paulo Research Foundation (FAPESP). L.G.E.V. is supported by a research fellowships from National Counsel of Technological and Scientific Development (CNPQ) (CNPq). L.M.T. is supported by a doctor degree scholarship from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).

Author Contributions

A.F.R., G.M.S. and L.G.E.V. conceived and designed the experiments. A.V.C.P. and L.M.T. performed the abiotic stress experiments. A.F.R. and L.M.V. carried out the RT-qPCR assays and analyzed the data. A.F.R. and L.G.E.V. wrote the manuscript. G.M.S. provided intellectual input and revised the manuscript. All authors read and approved the final manuscript.

Competing Interests

The authors declare that they have no competing interests.

Footnotes

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.González AT, Morton CM. Molecular and morphological phylogenetic analysis of Brachiaria and Urochloa (Poaceae) Mol Phyl Evol. 2005;37:36–44. doi: 10.1016/j.ympev.2005.06.003. [DOI] [PubMed] [Google Scholar]
  • 2.Dias-Filho, M. B. Diagnóstico das pastagens no Brasil. Empresa Brasileira de Pesquisa Agropecuária. Documentos n°402. Embrapa Amazônia Oriental Belém, Brasil. ISSN 1983-0513 (2014).
  • 3.Kozera B, Rapacz M. Reference genes in real-time PCR. J Appl Genetics. 2013;54:391–406. doi: 10.1007/s13353-013-0173-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Andersen CL, Jensen JL, Orntoft TF. Normalization of real time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identified genes suited for normalization, applied for a bladder and colon cancer data sets. Cancer Res. 2004;64:5245–5250. doi: 10.1158/0008-5472.CAN-04-0496. [DOI] [PubMed] [Google Scholar]
  • 5.Vandesompele J, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3:1–12. doi: 10.1186/gb-2002-3-7-research0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – Excel-based tool using pair-wise correlations. Biotechnol Lett. 2004;26:509–515. doi: 10.1023/B:BILE.0000019559.84305.47. [DOI] [PubMed] [Google Scholar]
  • 7.Silver N, Best S, Jiang J, Thein SL. The comparative delta-Ct method: Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Molecular Biology. 2006;7 doi: 10.1186/1471-2199-7-33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Xie F, Xiao P, Chen D, Xu L, Zhang B. Mir. Deepfinder: a mirna analysis tool for deep sequencing of plant small RNAs. Plant Mol Biol. 2012;80:75–84. doi: 10.1007/s11103-012-9885-2. [DOI] [PubMed] [Google Scholar]
  • 9.Silveira ED, Ferreira MA, Guimarães LA, Silva FR, Carneiro VTC. Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha. BMC Plant Biol. 2009;9 doi: 10.1186/1471-2229-9-84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Parry MAJ, Keys AJ, Madgwick PJ, Carmo-Silva AE, Andralojc PJ. Rubisco regulation: a role for inhibitors. J Exp Bot. 2008;59:1569–1580. doi: 10.1093/jxb/ern084. [DOI] [PubMed] [Google Scholar]
  • 11.Gimeno J, Eattock N, Van Deynze A, Blumwald E. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR. PlosOne. 2014;9 doi: 10.1371/journal.pone.0091474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhu J, et al. Reference gene selection for quantitative real-time PCR normalization in Caragana intermedia under different abiotic stress conditions. PlosOne. 2013;8 doi: 10.1371/journal.pone.0053196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Guo J, Ling H, Wu Q, Xu L, Que Y. The choice of reference genes for assessing gene expression in sugarcane under salinity and drought stresses. Sci. Rep. 2014;4 doi: 10.1038/srep07042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Qi S, et al. Reference Gene Selection for RT-qPCR Analysis of Flower Development in Chrysanthemum morifolium and Chrysanthemum lavandulifolium. Frontiers in Plant Science. 2016;7 doi: 10.3389/fpls.2016.00287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Martins PK, et al. Selection of reliable reference genes for RT-qPCR analysis during developmental stages and abiotic stress in Setaria viridis. Sci. Rep. 2016;6 doi: 10.1038/srep28348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Paolacci AR, Tanzarella OA, Porceddu E, Ciaffi M. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Mol Biol. 2009;10 doi: 10.1186/1471-2199-10-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Huang L, et al. Evaluation of candidate reference genes for normalization of quantitative RT-PCR in switchgrass under various abiotic stress conditions. Bioenerg Res. 2014;7:1201–1211. doi: 10.1007/s12155-014-9457-1. [DOI] [Google Scholar]
  • 18.Svitkin YV, et al. The requirement for eukaryotic initiation factor 4A (elf4a) in translation is in direct proportion to the degree of mRNA 5′ secondary structure. RNA. 2001;7:382–394. doi: 10.1017/S135583820100108X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Huang L, et al. Identification of candidate reference genes in perennial ryegrass for quantitative RT-PCR under various abiotic stress conditions. PLoSOne. 2014;9 doi: 10.1371/journal.pone.0093724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Browning K. The plant translational apparatus. Plant Mol Biol. 1996;32:107–144. doi: 10.1007/BF00039380. [DOI] [PubMed] [Google Scholar]
  • 21.Carvalho K, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): Identification and validation of new genes for qPCR normalization. Mol Biotechnol. 2013;53:315–325. doi: 10.1007/s12033-012-9529-4. [DOI] [PubMed] [Google Scholar]
  • 22.Martin RC, Hollenbeck. VG, Dombrowski JE. Evaluation of reference genes for quantitative RT-PCR in Lolium perenne. Crop Sci. 2008;48:1881–1887. doi: 10.2135/cropsci2007.10.0597. [DOI] [Google Scholar]
  • 23.Dombrowski JE, Martin RC. Evaluation of reference genes for quantitative RT-PCR in Lolium temulentum under abiotic stress. Plant Sci. 2009;176:390–396. doi: 10.1016/j.plantsci.2008.12.005. [DOI] [Google Scholar]
  • 24.Lin Y, et al. Validation of potential reference genes for qPCR in maize across abiotic stresses, hormone treatments, and tissue types. PlosOne. 2014;9 doi: 10.1371/journal.pone.0095445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fu CX, et al. Genetic manipulation of lignin reduces recalcitrance and improves ethanol production from switchgrass. PNAS. 2011;108:3803–3808. doi: 10.1073/pnas.1100310108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Saathoff AJ, Tobias CM, Sattler SE, Haas EJ, Twigg PS. Switchgrass contains two cinnamyl alcohol deshydrogenases involved in lignin formation. Bioenergy Res. 2001;4:120–133. doi: 10.1007/s12155-010-9106-2. [DOI] [Google Scholar]
  • 27.Hong SY, Seo PJ, Yang MS, Xiang F, Park CM. Exploring valid reference genes for gene expression studies in Brachypodium distachyon by real-time PCR. BMC Plant Biology. 2008;8 doi: 10.1186/1471-2229-8-112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Chen Y, et al. Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. Plant Cell Rep. 2015;34:1825–1834. doi: 10.1007/s00299-015-1830-9. [DOI] [PubMed] [Google Scholar]
  • 29.Kumar K, Muthamilarasan M, Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setaria italica L.) subjected to abiotic stress conditions. Plant Cell Tiss Organ Cult. 2013;115:13–22. doi: 10.1007/s11240-013-0335-x. [DOI] [Google Scholar]
  • 30.Shivhare R, Lata C. Selection of suitable reference genes for assessing gene expression in pearl millet under different abiotic stresses and their combinations. Sci. Rep. 2016;6 doi: 10.1038/srep23036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yan X, et al. Reference gene selection for quantitative Real-Time PCR normalization in Reaumuria soongorica. PlosOne. 2014;9 doi: 10.1371/journal.pone.0104124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yamori W, Hikosaka K, Way DA. Temperature response of photosynthesis in C3, C4, and CAM plants: temperature acclimation and temperature adaptation. Photosynth Res. 2014;119:101–117. doi: 10.1007/s11120-013-9874-6. [DOI] [PubMed] [Google Scholar]
  • 33.Rizhsky L, Liang H, Mittler R. The combined effect of drought stress and heat shock on gene expression in tobacco. Plant Physiol. 2002;130:1143–1151. doi: 10.1104/pp.006858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Goulas E, et al. The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show differential sensitivity to short- and long-term exposure to low temperature. The Plant Journal. 2006;47:720–734. doi: 10.1111/j.1365-313X.2006.02821.x. [DOI] [PubMed] [Google Scholar]
  • 35.Pelloux J, Jolivet Y, Fontaine V, Banvoy J, Dizengremel P. Changes in Rubisco activase gene expression and polypeptide content in Pinus halepensis M. subjected to ozone and drought. Plant, Cell and Env. 2001;24:123–131. doi: 10.1046/j.1365-3040.2001.00665.x. [DOI] [Google Scholar]
  • 36.Desimone M, Henke A, Wagner E. Oxidative stress induces partial degradation of the large subunit of ribulose-1,5-bisphosphate carboxylase/ oxygenase in isolated chloroplasts of barley. Plant Physiol. 1996;111:789–796. doi: 10.1104/pp.111.3.789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 38.Bowman SM, et al. A novel RNA binding protein affects rbCl gene expression and is specific to bundle sheath chloroplasts in C4 plants. BMC Plant Biol. 2013;22:13–138. doi: 10.1186/1471-2229-13-138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ruijter, J. M. et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 37, e452009. [DOI] [PMC free article] [PubMed]
  • 40.Ramakers C, Ruijter JM, Deprez RH, Moorman AF. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett. 2003;339:62–66. doi: 10.1016/S0304-3940(02)01423-4. [DOI] [PubMed] [Google Scholar]
  • 41.Livak JK, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES