Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 May 18.
Published in final edited form as: Cell Chem Biol. 2017 Apr 27;24(5):605–613.e5. doi: 10.1016/j.chembiol.2017.04.006

Inhibition of eukaryotic translation by the antitumor natural product Agelastatin A

Brandon McClary 1,2,10, Boris Zinshteyn 3,10, Melanie Meyer 4,10, Morgan Jouanneau 5, Simone Pellegrino 4, Gulnara Yusupova 4, Anthony Schuller 3, Jeremy Chris P Reyes 9, Junyan Lu 6, Zufeng Guo 1,2, Safiat Ayinde 1,2, Cheng Luo 6, Yongjun Dang 7, Daniel Romo 5,*, Marat Yusupov 4,*, Rachel Green 3,*, Jun O Liu 1,2,8,*
PMCID: PMC5562292  NIHMSID: NIHMS872019  PMID: 28457705

SUMMARY

Protein synthesis plays an essential role in cell proliferation, differentiation and survival. Inhibitors of eukaryotic translation have entered the clinic, establishing the translation machinery as a promising target for chemotherapy. A recently discovered, structurally unique marine sponge-derived brominated alkaloid, (-)-agelastatin A (AglA), possesses potent antitumor activity. Its underlying mechanism of action, however, has remained unknown. Using a systematic top-down approach, we show that AglA selectively inhibits protein synthesis. Using a high-throughput chemical footprinting method, we mapped the AglA-binding site to the ribosomal A site. A 3.5-Å crystal structure of the 80S eukaryotic ribosome from S. cerevisiae in complex with AglA was obtained, revealing multiple conformational changes of the nucleotide bases in the ribosome accompanying the binding of AglA. Together, these results have unraveled the mechanism of inhibition of eukaryotic translation by AglA at atomic level, paving the way for future structural modifications to develop AglA analogs into novel anticancer agents.

Keywords: ribosome, peptidyl transferase center, translation elongation, brain cancer, conformational flexibility, drug design, molecular docking, chemical footprinting, rRNA seq

Graphical abstract

graphic file with name nihms872019u1.jpg

INTRODUCTION

Marine natural products have served as valuable sources for novel drugs and important tools for chemical biology due to their ability to bind and interfere with the functions of specific protein targets, facilitating the elucidation of various cellular processes (Cragg et al., 2009; Newman and Cragg, 2016). Agelastatin A (AglA) is a structurally unique brominated alkaloid isolated from the marine sponge Agelas dendromorpha by Pietra and coworkers in 1993 and belongs to the pyrrole-2-aminoimidazole alkaloid (PAI) family along with the structurally related congeners Agelastatins B-F (AglB-AglF) (D’Ambrosio et al., 1993)(Figure 1). Since its isolation, the unique structure of AglA has attracted the attention of numerous synthetic chemists and several total syntheses of AglA have been accomplished to date. These synthetic studies have more recently paved the way for the synthesis of new AglA derivatives that possess improved pharmacological activity (Dong, 2010; Han et al., 2013; Jouanneau et al., 2016; Reyes and Romo, 2012).

Figure 1. Chemical structures of agelastatin A and congeners.

Figure 1

Open in a new tab

Rings and key positions are labeled in the structure of agelastatin A. Structural differences between the congeners and agelastatin A are highlighted (red).

Although AglA was originally reported to exhibit potent insecticidal activity as well as toxicity to brine shrimp, it was subsequently shown to possess potent cytotoxicity activity against a panel of cancer cell lines as well as primary human umbilical vein endothelial cells (Han et al., 2013; Hong et al., 1998; Pettit et al., 2005; Stout et al., 2014). It has been reported that AglA inhibits the expression of β-catenin, osteopontin-mediated malignant cell invasion, adhesion and colony formation (Mason et al., 2008; Meijer et al., 2000). More recently, AglA and its analogs were shown to have excellent blood-brain barrier penetration, making it a promising candidate for developing drugs to treat brain cancer (Li et al., 2013). Despite its promising antitumor activity, however, the underlying molecular mechanism of action of AglA has remained elusive.

Translation, along with DNA replication and transcription, is a highly conserved, fundamental cellular process essential for cell growth and survival (Bhat et al., 2015). Inhibitors of bacterial translation have served as important antibiotics. In more recent years, a number of inhibitors of eukaryotic translation have been identified and shown to affect distinct components of the complicated eukaryotic translation machinery from initiation to elongation, including pateamine A (PatA), lactimidomycin, and mycalamide B, all of which have been investigated in our labs (Dang et al., 2011; Garreau de Loubresse et al., 2014; Low et al., 2005; Schneider-Poetsch et al., 2010). Due to their higher proliferation rate and consequently higher demand for newly synthesized proteins, cancer cells in general appear more vulnerable to inhibitors of translation, creating a therapeutic window, albeit a narrow one, for those inhibitors as potential anticancer drugs (Bhat et al., 2015). To date, homoharringtonine, a translation elongation inhibitor, has been approved by FDA as a treatment of chronic myeloid leukemia (CML), validating inhibition of translation as a viable strategy to treat cancer (Gandhi et al., 2014).

In this study, we took a systematic top-down approach to discern the mechanism of action of AglA (Titov and Liu, 2012). Upon assessing its effects on global DNA, RNA and protein synthesis, we observed that AglA inhibited both protein and DNA synthesis without affecting RNA synthesis. Using in vitro translation assays, we demonstrated that AglA inhibited protein synthesis. We further found that (1) AglA inhibited translation elongation through the use of a dual luciferase reporter under the control of an internal ribosomal entry site (IRES) element and (2) AglA inhibited peptide bond formation and eRF1-mediated peptidyl-tRNA hydrolysis in a yeast in vitro reconstituted translation system. These data suggested the peptidyl transferase center (PTC) as a potential binding site for AglA. Using a high-throughput chemical footprinting/ribosomal RNA sequencing method, we identified the A site of the 60S ribosome as the binding site for AglA. We took two other parallel approaches to gain structural insights into the interaction between AglA and the eukaryotic ribosome—molecular modeling and X-ray crystallography. We obtained a 3.5 Å resolution structure of the AglA-80S ribosome complex structure, validating the ribosome as the molecular target of AglA, and thus inhibition of translation elongation as the underlying mechanism for the antitumor activity of AglA.

RESULTS

AglA inhibits protein synthesis

We determined the effect of AglA on the proliferation of HeLa cells, a model cell line we have used to investigate the mechanism of action of antiproliferative natural products (Low et al., 2005; Schneider-Poetsch et al., 2010; Titov et al., 2011). In agreement with the results from other cancer cell lines, the IC50 of AglA for inhibition of HeLa cell proliferation was ~100 nM (Han et al., 2013; Pettit et al., 2005; Stout et al., 2014). Next, we determined the effects of AglA on three major cellular processes essential for cell proliferation: DNA replication, transcription, and translation. The effects of AglA on DNA, RNA, and global protein syntheses were assessed using incorporation of [3H]-thymidine, [3H]-uridine, and [35S]-methionine/cysteine as readouts, respectively. To minimize the potential secondary effects on these processes, we treated HeLa cells with AglA for only one hour. AglA dose-dependently inhibited incorporation of [3H]-thymidine with an IC50 of 0.39 μM and that of [35S]-methionine with an IC50 of 0.29 μM (Figure 2A, C). In contrast, RNA synthesis, as judged by incorporation of [3H]-uridine, was not significantly affected even at the highest concentration of AglA (100 μM, Figure 2A). The activity profile of AglA with selective inhibition of DNA and protein synthesis (without affecting RNA synthesis during a short-term treatment) is reminiscent of the inhibition signature of cycloheximide (CHX), a known inhibitor of eukaryotic translation elongation. Indeed, as for AglA, treatment of HeLa cells with CHX for one hour led to inhibition of incorporation of [3H]-thymidine and [35S]-methionine with minimal effects on [3H]-uridine incorporation (Figure 2B). Thus, both AglA and CHX inhibit DNA synthesis and translation (Figure 2C). We and others have previously observed that inhibition of translation can lead to inhibition of DNA synthesis, though the underlying molecular mechanism remains to be defined (Dang et al., 2011; Kuznetsov et al., 2009; Schneider-Poetsch et al., 2010; Tornheim et al., 1969).

Figure 2. Dose-dependent inhibition of translation by AglA.

Figure 2

Open in a new tab

(A, B) HeLa cells were incubated with varying concentrations of each compound in the presence of either [3H]-thymidine, [3H]-uridine, or [35S]-cysteine/methionine for 1 hr. Protein synthesis was measured by scintillation counting of trichloroacetic acid (TCA)-precipitated proteins on a filter. DNA synthesis and transcription were monitored by scintillation counting of nucleic acids bound to a filter. (C) IC50 values for AglA and CHX for inhibition of protein and DNA synthesis. Mean values ± SEM (error bars) from 3 independent experiments are shown. IC50 values are listed ± SE. (D) Drugs were added to a rabbit reticulocyte lysate (RRL) cocktail that included a control luciferase poly(A) mRNA (supplied by Promega) and [35S]-methionine was added for 1 hr. Translated product was subjected to SDS-PAGE followed by authoradiography. Abbreviations: AglA, (-)-agelastatin A; CHX, cycloheximide. See also Figure S1, S7.

The striking similarity in the activity profile between AglA and CHX suggested that AglA may also work as an inhibitor of protein synthesis. To verify that AglA directly inhibited translation, we turned to an in vitro translation assay in which a luciferase mRNA template was used to direct the synthesis of luciferase protein in rabbit reticulocyte lysate (RRL) using a conditional medium containing [35S]-methionine. AglA inhibited protein synthesis in a dose-dependent manner in the RRL system (Figure 2D). As RRL contains only the cytosolic components of the translation machinery, this inhibitory effect of AglA in vitro eliminated the possibility of an indirect effect of AglA on protein translation as might have been observed in cellular assays, suggesting that AglA likely affects a component of the eukaryotic translation machinery.

Given the essential role of protein synthesis in cell proliferation, it is expected that the anti-proliferative effects of AglA can be attributed to its inhibition of translation. To rule out the possibility that other targets exist for AglA that may also contribute to its cellular activity, we determined the IC50 values of several AglA analogs for their inhibition of in vitro translation and correlated them with the corresponding IC50 values for inhibition of cell proliferation (Figure S1A). A significant correlation (r = 0.94) was observed between the two activities of the analogs that differ by over two orders of magnitude, strongly suggesting that inhibition of translation is sufficient to account for the inhibition of cell proliferation by AglA and its analogs (Figure S1B).

AglA directly inhibits ribosome-catalyzed peptidyl-transfer

Eukaryotic translation can be subdivided into three phases: initiation, elongation and termination (Jackson et al., 2010; Kapp and Lorsch, 2004). During the initiation phase, the 40S ribosomal subunit, the initiator tRNA and associated initiation factors are recruited to mRNA to form the 43S pre-initiation complex (PIC), which is followed by eIF4A-driven scanning of the 5’-UTR of mRNA to locate the AUG initiation codon. The 60S large ribosomal subunit (LSU) is subsequently recruited to form an 80S ribosome, marking the end of initiation and the beginning of elongation. Elongation begins with the delivery of aminoacyl-tRNA into the ribosomal A site, mediated by the GTPase activity of eEF1A. This step is followed by peptidyl transfer and the eEF2-mediated translocation of peptidyl tRNA from the A to P site, while deacylated tRNA is simultaneously transferred from the P to E site.

As most known inhibitors of eukaryotic translation have been shown to block either the initiation or the elongation phase of translation, we began our search there. We first employed a bicistronic reporter mRNA in vitro with a conventional capped firefly luciferase open read frame (ORF), followed by a renilla luciferase ORF under the translational control of an HCV IRES element. HCV IRES-mediated translation initiation does not require the 5’-7-methylguanosine cap and thus bypasses the requirement for the eIF4F complex and is typically resistant to inhibitors of translation initiation (Pestova et al., 1998). AglA dose-dependently inhibited both cap-dependent and IRES-dependent translation of the two luciferases (Figure 3A). As controls, CHX, which inhibits translation elongation, similarly inhibited both cap- and HCV IRES-dependent translation whereas PatA, a translation initiation inhibitor, only inhibited the cap-dependent translation (Low et al., 2005) (Figure 3A). These results suggested that AglA, like CHX, might selectively inhibit the elongation phase of translation.

Figure 3. AglA inhibits translation elongation.

Figure 3

Open in a new tab

(A) Dual luciferase reporters with a conventional capped firefly luciferase followed by renilla luciferase under the translational control of HCV IRES were used in in vitro RRL translation assays in the presence of different concentrations of AglA, 4 μM PatA, and 4 μM CHX. (B) Stress granule induction in U2OS cells stably expressing GFP-G3BP in the presence of different compounds as indicated. Images (40x objective) were captured using an Olympus B X61 fluorescence microscope. (C) AglA inhibits dipeptide formation in vitro. Ribosome initiation complexes were pre-incubated with drug for 5 min. eEF1A, Phe-tRNAPhe, and GTP were added to complexes and dipeptide formation observed over time. Abbreviations: PatA, pateamine A. See also Figure S2.

In light of known positive and negative connections between stress granule formation and other known translation inhibitors (Dang et al., 2006; Schneider-Poetsch et al., 2010), we next looked at the effects of AglA on stress granule formation. The induction of stress granules was measured in U2OS cells stably expressing GFP-G3BP, a stress-granule marker. As expected, in the presence of arsenite, a strong induction of stress granules was observed, and pretreatment with CHX prevented stress granule formation induction by arsenite (Dang et al., 2006). Upon AglA treatment, no stress granule formation was observed, similar to the signature of CHX (Figure 3B). And, like CHX, AglA blocked stress granule formation even in the presence of arsenite. The potency of AglA in blocking stress granule formation is slightly weaker than that observed for CHX (Figure 2C).

To further narrow down the site of action of AglA during the elongation phase of translation, we used a reconstituted in vitro yeast translation assay with purified 80S complexes on an mRNA encoding a Met-Phe dipeptide, eEF1A, GTP, and aminoacyl-tRNA to determine whether AglA affected peptide bond formation. Indeed, AglA inhibited peptide bond formation in a dose-dependent manner (Figure 3C), suggesting that AglA either inhibited eEF1A action or directly bound to the ribosome itself to prevent catalysis. In an independent GTP hydrolysis assay, AglA had no effect on eEF1A-dependent GTP hydrolysis, arguing against eEF1A as the target and suggesting that peptide bond formation itself was directly affected on the ribosome (Figure S2A, S2B). Furthermore, we found that AglA inhibited eRF1-mediated peptidyl-tRNA hydrolysis in vitro from pre-assembled translation termination complexes (Figure S2C). This reaction is similar in chemistry to peptide bond formation (Brunelle et al., 2008), but depends exclusively on ribosome complexes and release factors eRF1:eRF3, further ruling out eEF1A as a target of AglA. Together, these results suggest that AglA might directly interact with the ribosome at the PTC to inhibit translation.

Identification of PTC as the binding site of AglA using chemical footprinting and molecular docking

To validate this model and confirm direct binding of AglA to the PTC of the ribosome, we performed a whole-ribosome dimethyl sulfate (DMS) protection assay using DMS-MaPseq (Zubradt et al., 2017). Purified yeast ribosomes were pre-incubated with AglA, and treated with 90 mM DMS, an alkylating reagent that methylates exposed adenine and cytosine residues on the Watson-Crick interface. Instead of using the classic method of identifying residues protected by ligands from DMS methylation using reverse transcriptase (RT) wherein the primer extension reaction is blocked (Ding et al., 2013; Moazed et al., 1986; Rouskin et al., 2013), DMS-MaPseq employs conditions that allow RT to proceed past DMS-modified nucleotides by incorporating mismatches at those methylated positions at a high frequency. Counting these mismatches by high-throughput sequencing produces a quantitative readout of the extent of chemical modification (Homan et al., 2014; Siegfried et al., 2014; Zubradt et al., 2017). Treatment of ribosomes with CHX as a control resulted in dose-dependent protection exclusively at the 25S rRNA nucleotide C2764, where CHX was previously shown to bind (Garreau de Loubresse et al., 2014; Schneider-Poetsch et al., 2010) (Figure S4). Treatment with 0.5 mM or 1.0 mM AglA produced strong (~30 fold) and specific protection of the 25S nucleotide C2821 that lies within the PTC (Figure 4B, C). The protection of C2821 by AglA from DMS-mediated methylation is markedly consistent with the docking model. Furthermore, the neighboring nucleotides, A2820, A2941, and C2942 were also protected by AglA treatment, but to a lesser extent than C2821 (Figure 4D). The level of modification at these other nucleotides was lower than for C2821 in the absence of AglA, limiting the potential measurable range of protection.

Figure 4. AglA is bound within the PTC of the larger ribosomal subunit.

Figure 4

Open in a new tab

(A, B) MA plots showing, for each rRNA nucleotide, the average DMS-dependent mutation rate on the x-axis, against the fold change upon AglA treatment on the y-axis. Nucleotides passing significance and fold-change cutoffs are orange, and AglA-protect nucleotides from panel D are labeled. (C) Fold change in mutation rate, relative to a no-DMS control, for an unaffected nucleotide (A2819), and four AglA-protected nucleotides near the P site in the 25S rRNA. (D) Molecular docking model of the interaction of AglA with the 80S ribosome of S. cerevisiae (PDBID: 4U52). The numberings correspond to the yeast 25S rRNA sequence. See also Figure S3, S4.

To gain insight into the molecular interactions between AglA and the PTC, we performed molecular docking to locate the potential binding site of AglA in the yeast ribosome and its interactions with nucleosides surrounding the PTC. AglA was docked into a model structure of the PTC of yeast 80S ribosome, which was derived from the crystal structure of yeast 80S ribosome in complex with a small molecule inhibitor Nagilactone C (Garreau de Loubresse et al., 2014). According to the docking model, AglA fits well into the PTC (Figure 4A). Among the key interactions between AglA and the PTC residues, the dihydropyrazinone (B) ring of AglA was predicted to form two hydrogen bonds with U2869 and the C2 carbonyl oxygen was predicted to form a hydrogen bond with the ribosyl oxygen of U2873. In addition, the pyrrole (A) ring of AglA is predicted to form π–π stacking interactions with C2821 and A2820 of the yeast 25S rRNA (Figure S3).

Crystal Structure of the yeast 80S ribosome-AglA complex

To further elucidate the interactions between AglA and the ribosome, we solved the crystal structure of the complex between AglA and the yeast 80S ribosome at 3.5 Å resolution (Figure 5A, Table S1). The structure allowed us to definitively identify the binding site of AglA in the ribosome. In agreement with the prediction from the molecular modeling, AglA binds to the PTC in the A site of the LSU (Figure 5B). AglA forms multiple interactions with the ribosomal RNA at the A site of the PTC (Figure 5B, C) including: (1) the bromo group on C13 of AglA forms a halogen-π interaction with U2875; (2) the pyrrole (A) ring and the amide π-system of the B ring of AglA form π-π stacking interactions with A2820 and C2821; (3) the carbonyl and NH of the dihydropyrazinone (B) ring of AglA forms two reciprocal H-bonds with U2869 (Figure 4A, 5B); and (4) the C5-hydroxyl group of AglA engages in H-bonding interactions with the carbonyl oxygen of the pyrimidinedione ring of U2873.

Figure 5. Crystal structure of AglA-80S ribosome complex.

Figure 5

Open in a new tab

(A) AglA (pink) fitted in the unbiased difference map (FO-Fc). Structure has been determined to the resolution of 3.5 Å. See Supplementary Table 1 for statistics of data collection and processing. (B) AglA (pink) forms hydrogen bonds with U2869 and U2873 and p-halogen (pyrrole bromine) interaction with U2875 of 25S rRNA (green) and electrostatic interaction with a magnesium ion (yellow). (C) Stacking interactions occur between A2819, A2820, and C2821 of 25S rRNA at the A site (green) and AglA (pink). (D) Superimposition of vacant ribosome structure (orange; PDB code: 4V88) and ribosome bound to AglA structure (green) displaying major movements of nucleotides A2404, C2821 and U2875 (black arrows) induced by the binding of AglA (pink) to the A site. See also Figure S5, S6 and Table S1.

To accommodate AglA, several nucleotide bases of ribosomal RNA (rRNA) at the A site of LSU undergo significant conformational changes as revealed by a comparison of the structures of the vacant 80S and its complex with AglA (Figure 5D). This comparison has been made after superposition of the structure of the vacant 80S A site (PDB code: 4V88) onto the structure of the AglA-80S complex A site. The residue U2875 of the 25S rRNA undergoes a major rearrangement and flips away from the center of the PTC pocket (Garreau de Loubresse et al., 2014) (Figure 5D), while the neighboring residues maintain their native conformation. Additionally, AglA induces the displacement of A2820, C2821 and, to a lesser extent, neighboring nucleotides, in order to create stable contacts with the large subunit A site pocket through the formation of π-π stacking interactions with A2820 and C2821. Moreover, the flipping-up of U2875 in the bound structure induces the displacement of A2404, probably as a result of steric interactions between these two nucleotide bases. Additionally, the base of U2873 is slightly tilted, as shown from the complex of others LSU A-site inhibitors (Garreau de Loubresse et al., 2014), but in this case establishing a new interaction with a Mg2+ ion (Figure 5D).

DISCUSSION

Since its isolation and identification over two decades ago, AglA has been subjected to intensive scrutiny for its mode of action as well as its total synthesis. The underlying molecular mechanism of its antiproliferative activity, however, has remained a mystery. In this study, we took a top-down approach to identify the target of AglA by systematically exploiting existing knowledge of different components and steps involved in eukaryotic translation. We identify and validate the A site of the 60S ribosomal subunit as the binding site of AglA, thus readily accounting for its inhibitory effect on translation. The X-ray crystal structure of the AglA-80S ribosome complex revealed further details of the interaction between AglA and the ribosome, including multiple conformational changes associated with its binding, thus paving the way for the future design and synthesis of novel AglA analogs to improve its potency and pharmacological properties.

We employed three complementary methods to gain insight into the interactions between AglA and the 80S ribosome: molecular docking, chemical footprinting with DMS-MaPseq and X-ray crystallography. Prior to the attainment of the crystal structure of the AglA-80S complex, molecular docking correctly predicted that AglA could bind within the PTC of the ribosome, with the pyrrole (A) ring of AglA forming π–π stacking interactions with C2821 and A2820 in the PTC (Figure S3). It also correctly predicted the two hydrogen bonds between the amide group of the dihydropyrazinone ring (B) of AglA and U2869. The AglA-binding site identified by chemical footprinting agreed with our early mechanistic findings and molecular docking predictions that C2821 would show the strongest protection from DMS modification by AglA. Though A2820 also exhibits about a 2-fold reduction in DMS signal upon AglA treatment, these data did not pass cutoffs for statistical significance.

The crystal structure of yeast 80S-AglA complex revealed important conformational changes at the PTC that were not predicted by molecular docking, a method that has limited capacity in handling conformational flexibility. First, AglA induced the displacement of A2820 and C2821 in order to create stable contacts with the large subunit A site pocket, through the formation of π-stacking interactions. Second, the flipping of U2875 toward AglA induces the displacement of A2404, probably due to steric interaction between these two residues. Such rearrangements are common for inhibitors binding to the A site pocket of the PTC, underscoring how natural products can fit into and modulate the conformation of the PTC of the eukaryotic ribosome. Third, the pyrimidine base of U2873 in the 25S rRNA tilts upon AglA binding to establish an additional bond with an ordered Mg2+ ion. Lastly, the C13 bromine atom of AglA forms a halogen-π-stacking interaction with U2875 (Reid et al., 2013), a quite unusual and unique feature for AglA binding to the A site of the PTC that further distinguishes it from all known elongation inhibitors.

The observation of conformational changes of the bases of rRNA upon inhibitor binding is not unique to AglA. The PTC of the ribosome is also the binding site for many other translation inhibitors (Figure S5), including anisomycin (ANI), which has been shown to form a hydrogen bond with C2821, similarly resulting in protection from chemical modification at this position (Garreau de Loubresse et al., 2014; Rodriguez-Fonseca et al., 1995). Although they occupy a similar binding pocket in the PTC, the structures of these compounds are quite distinct (Figure S5, S6) and show a distinct pattern of interaction with nearby nucleotides. Displacement of residues C2821, U2875 and A2404 seems to be dependent on the chemical structure of this particular inhibitor, rather than simply the accommodation of the inhibitor, as shown in our comparison with ANI (Figure S6A) and narciclasine (NAR) (Figure S6B). In the case of NAR, U2875 adopts a conformation close to that of the vacant 80S while ANI causes this residue to flip toward the inhibitor in a manner similar to what we observed in the AglA-80S structure (Figure S6B). A2404, by contrast, is very mobile and rearranges in different positions when comparing the inhibitor-bound and vacant ribosomes. It is interesting to note that there is little structural similarity between AglA and other known translation elongation inhibitors (Figure S5). Yet, despite their differences in size and shape, they are all accommodated by the same PTC pocket of the ribosome, likely reflecting the flexibility of the RNA-rich PTC and rendering PTC one of the most promiscuous bindings site for small molecule ligands in biology. This flexibility seems to be distinct from that observed for the majority of proteins.

The interactions between AglA and the A site of the ribosome revealed by the crystal structure provide rationale to the observed structure/activity relationships among the natural and synthetic analogs of AglA reported to date (Figure 1). Movassaghi, Hergenrother and coworkers have conducted the first systematic comparison of six naturally occurring agelastatin congeners (AglA-F) (Han et al., 2013). It was found that among them, AglA is the most potent. In comparison to AglA, AglD, in which the methyl group on N1 is removed, and AglB, which contains an additional bromine substituent on the pyrrole ring (C14), are about 3- and 15-fold less active than AglA, respectively. From the crystal structure, the N1 methyl group does not have significant contact with the ribosome; it is thus more or less dispensable without a significant loss in activity. In contrast, the addition of another bromine atom to the pyrrole ring at C14 may disrupt the π-stacking interaction with A2820 (Figure 5C). AglE is over 41-fold less potent than AglA due to methylation of the C5 hydroxyl group, which likely disrupts its hydrogen-bonding interaction with U2873. AglC suffered a 100-fold decrease in activity relative to AglA with the addition of a single hydroxyl group at the adjacent C4 position. It is possible that the additional C4 hydroxyl group competes with U2873 by forming an intramolecular H-bond with the C5 OH group. AglF, which contains a combination of structural changes found in both AglB and AglD, becomes almost inactive, though the precise underlying cause for this loss in potency is not apparent from the structure. More recently, we explored the structure/activity relationship of the pyrrole (A) ring of AglA by replacing hydrogens at C14 and C15 (Jouanneau et al., 2016). We found that substitution of hydrogen with larger substituents such as halides or methyl or aromatic groups led to either significant or complete losses in activity; we speculate that these losses may have resulted from loss of π-halogen interactions with U2875 (Figure 5B). Among all synthetic analogs of AglA reported to date, only two showed comparable or improvements in potency, those with a C13 chloro (7) or trifluoromethyl (8) substituent (Li et al., 2013; Stout et al., 2014)(Figure 1). The more electronegative chlorine and trifluoromethyl group could form stronger π-halogen interactions with U2875 and enhance the π-π stacking interactions between AglA and the nucleotide bases of A2820 and C2821 by reducing the electron density on the A ring of AglA, explaining their higher potency compared to AglA.

AglA inhibited both protein synthesis and DNA replication in HeLa cells. As a comparison, we also tested the incorporation of [3H]-thymidine, [3H]-uridine, and [35S]-methionine and cysteine in the presence of aphidicolin, an inhibitor of DNA polymerase α (Oguro et al., 1979; Spadari et al., 1982); as anticipated, only DNA replication was inhibited (Figure S7). Interestingly, CHX has a similar inhibitory effect on both protein synthesis and DNA replication, and the same phenomenon has been reported for a number of translation inhibitors (Chan, 2004). It is possible that this results from a primary effect of the drug on the synthesis of fast-turnover proteins necessary for DNA replication, suggesting the existence of a mechanism that directly couples DNA replication to translation (Abid et al., 1999; Berthon et al., 2009).

The newly unraveled activity of AglA on translation elongation also accounts for the antiproliferative activity against various cancer cell lines and explains most, though not all, cellular activities of AglA reported to date. It has been shown that AglA inhibits osteopontin-mediated malignant transformation and cell migration, which was attributed in part to inhibition of osteopontin expression (Mason et al., 2008). Given its effect on translation, it is expected that osteopontin as well as other cellular proteins including β-catenin, would be downregulated as a result of general protein synthesis inhibition by AglA. Aside from downregulation of osteopontin and β-catenin, AglA was also shown to enhance the expression of the inhibitory protein of osteopontin, Tcf-4 (Mason et al., 2008). It remains unclear how inhibition of translational elongation by AglA leads to upregulation of Tcf-4. In addition, AglA has been shown to cause a cell cycle arrest at the G2 phase (Han et al., 2013; Hong et al., 1998; Pettit et al., 2005). How global inhibition of translation causes G2 phase cell cycle arrest also remains to be further investigated.

Inhibitors of eukaryotic translation have shown great promise as leads for developing anticancer drugs. Among the compounds identified as PTC inhibitors, homoharringtonine has already been approved for use as a treatment for CML patients resistant to tyrosine kinase inhibitors such as imatinib (Moen et al., 2007), providing support for inhibition of eukaryotic translation as a viable strategy to treat certain forms of cancer. The elucidation of A site of the 80S ribosome as the target for AglA and the new structural insights into its interaction with the ribosome through the X-ray crystal structure of the AglA-80S ribosome complex are likely to facilitate the development of new derivatives with greater potency and improved pharmacological activity as new anticancer drugs.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell Lines

HeLa cells and U2OS cells were cultured in DMEM medium supplemented with 10% FBS and 1% Penicillin Streptomycin and maintained in a 5% CO2 atmosphere at 37 ° C. U2OS cells stably expressing GFP-G3BP (Dang et al., 2011) were stored in liquid N2 until needed.

METHOD DETAILS

AglA and analogs

AglA and analogs were previously synthesized as reported (Reyes and Romo, 2012; Jouanneau et al., 2016). Dried products were resuspended in DMSO and compounds were aliquoted into 10 μL tubes to prevent multiple free thaw cycles and stored at -20 ° C until needed.

Metabolic labeling

HeLa cells were used for cellular metabolic labeling experiments. HeLa cells (20,000 per well) were seeded in 96-well plates. Twenty-four hours after seeding, drugs were added at the indicated concentrations, followed by addition of an aliquot of 1 μCi of [3H]-thymidine, [3H]-uridine or [35S]-methionine (Perkin Elmer) for 1 h. Cells were washed twice with 200 μl of cold PBS and lysed by addition of 100 μl lysis buffer [20 mM Tris-HCl, pH 7.4, 1% SDS, 100 μg/ml yeast tRNA (for [3H]-thymidine incorporation and [3H]-uridine incorporation) or 25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 1% deoxycholate, 0.1% SDS, 100 μg/ml BSA (for [35S]-methionine incorporation)]. After a 20-minute incubation at 4 ° C, 100 μl of 20% trichloroacetic acid (TCA) was added and the resulting mixtures were transferred to Millipore MSFCN6B10 filter plates. After 2 hours incubation at 4 ° C, t he mixtures were filtered under vacuum, and the plates were washed twice with 100 μl 5% TCA and twice with 100 μl ethanol. The plates were dried overnight, and 50 μl of Optiphase Supermix was added to each well and incorporation of 3H or 35S was quantified by scintillation counting on 1450 Microbeta JET instrument (Perkin Elmer).

Dual luciferase reporter assay

HCV IRES dual luciferase reporter vector was linearized with BamHI (NEB) and transcribed using T7 polymerase (Promega). Reactions were carried out using the Flexi rabbit reticulocyte lysate (RRL from Promega). Briefly, each reaction was performed using 10 μL of the Flexi rabbit reticulocyte lysate 200 ng of RNA, 0.2 μL each of Met and Leu amino acid mixtures, 70 mM KCl, 2 mM DTT, and 10 U of RNaseout (Thermo-Fisher) in 20 μL with the indicated concentration of compounds. The mixtures were incubated at 30°C for 1 h and the reaction was quenched with 20 μL of passive lysis buffer (Promega), and a 10-μL aliquot was assayed for luciferase activity according to the instructions of the manufacturer (Dual-Luciferase reporter assay system; Promega).

Induction of stress granules

U2OS cells stably expressing GFP-G3BP were treated with the indicated compounds for 1 hour. Cells were pretreated with either CHX or AglA for 30 minutes before arsenite addition for 1 hour. Cells were then fixed with 4% paraformaldehyde for 10 minutes, and washed twice with PBS. Images were captured using an Olympus B X61 fluorescence microscope, equipped with a Roper Photometrics CoolSnap HQ CCD camera.

In vitro 80S initiation complex formation

80S initiation complexes were formed as previously described (Eyler and Green, 2011) with minor differences. Briefly, 3 pmol of 35S-Met-tRNAiMet was mixed with 25 pmol of eIF2 and 1 mM GTP in 1X Buffer E (20 mM Tris pH 7.5, 100 mM KOAc pH 7.6, 2.5 mM Mg(OAc)2, 0.25 mM Spermidine, and 2 mM DTT) for 10 minutes at 26°C. Next a mixture containing 25 pmol 40S subunits, 200 pmol T7-synthesized mRNA template, 150 pmol eIF1, and 150 pmol eIF1A in 1X Buffer E was added for 5 minutes. To form the 80S complex, a mixture containing 25 pmol 60S subunits, 125 pmol eIF5, 125 pmol eIF5b, and 1 mM GTP in 1X Buffer E was added for 1 minute. Complexes were then mixed 1:1 with buffer E containing 17.5 mM Mg(OAc)2 to yield a final magnesium concentration of 10 mM. Ribosomes were then pelleted through a 600 μl sucrose cushion containing 1.1 M sucrose in buffer E with 10 mM Mg(OAc)2 using a MLA-130 rotor (Beckmann) at 75,000 rpm for 1 hour at 4°C. After pelleting, ribosomes were resuspended in 25 μl of 1X Buffer E containing 10 mM Mg(OAc)2 and stored at -80°C.

In vitro peptidyl transfer and eRF1 peptidyl-tRNA hydrolysis

Ribosome initiation complexes were assembled and purified as described, containing Met-tRNAIMT in the P site and a Phe codon (UUC) in the A site. The open reading frame of the mRNA used was Met-Phe-Stop (AUG-UUC-UAA). For peptidyl transfer, Phe-tRNAPhe ternary complex was prepared by mixing 1μM Phe-tRNAPhe, 2μM eEF1A and 1mM GTP in buffer E (20 mM Tris-Cl, pH 7.5, 100 mM potassium acetate, 2.5 mM magnesium acetate, 0.25 mM spermidine, 2 mM DTT) at 26 °C for 15 min. During t his time, initiation complexes (20 nM) were incubated with either drug or DMSO for 5 minutes at 26 °C. Ternary complex was then added to each initiation complex:drug mixture to initiate the reaction. Time points were taken after 10, 60, and 120 seconds and quenched in 250 mM KOH. Samples were run on electrophoretic TLCs (Millipore) pre-equilibrated with pyridine acetate buffer (5 ml pyridine, 200 ml acetic acid in 1 liter, pH 2.8) at 1400 V for 24 min, developed using a Typhoon FLA 9500 Phosphorimager system, and quantified using ImageQuantTL (GE Healthcare Life Sciences).

For eRF1-mediated peptidyl-tRNA hydrolysis assays, initiation complexes were pelleted containing Met-tRNAIMT in the P site with the open-reading frame Met-Phe-Phe-Phe-Lys-Stop (AUG-UUC-UUC-UUC-AAA-UAA). These complexes were reacted with Phe-tRNAPhe and Lys-tRNALys ternary complexes as described above, in the presence of 1 μM eEF2 and eEF3, GTP, and ATP to promote translocation. After 5 minutes of elongation, the complexes (now with MFFFK in the P site and a stop codon in the A site) were aliquoted and incubated with DMSO or varying amounts of AglA for 1 minute. The release reaction was started by addition of eRF1:eRF3: GTP (4 μM eRF1, 6 μM eRF3, 1 mM GTP), and time points were quenched with 5% formic acid. AGQ-eRF1 (which is catalytically inactive for peptide release) was included as a negative control. Samples were run on TLCs at 1200 V 35 min in the conditions described above.

eEF1A GTPase assay

S. cerevisiae ribosomes (Acker et al., 2007) and eEF1A (Eyler and Green, 2011) were purified as previously described. Yeast phenylalanine tRNA (Sigma) was charged by incubation with phenylalanine and S. cerevisiae S100 extract (Eyler and Green, 2011), and recovered by phenol extraction and ethanol precipitation. eEF1A GTPase assays were assembled in 10 μl reactions containing 1x buffer E by addition, in order, of S. cerevisiae eEF1A (0.25 μM), charged phenylalanine tRNA (Eyler and Green, 2011) (0.25μM), 40S ribosomal subunits (0.20 μM), 60S ribosomal subunits (0.20 μM) and 0.5 μl AglA in DMSO. Reactions were started by addition of [α-32P]-GTP (Perkin Elmer) to 0.133 μM. From each reaction, 1.5μl aliquots were quenched in an equal volume of 60% formic acid at the indicated time points. GTP and GDP were separated on PEI cellulose F TLC plates (Millipore) with 0.5M KH2PO4 (pH 3.5). The dried plates were developed using a Typhoon 9410 phosphorimager system (GE Healthcare Life Sciences) and quantified using ImageQuantTL (GE Healthcare Life Sciences).

Computational Modeling

The receptor model used for molecular docking was derived from the crystal structure of yeast 80S ribosome bound to a small molecular inhibitor Nagilactone C (PDB code: 4U52). Because the whole 80S ribosome structure is too large for the docking study, the nucleotides and amino acids that were 10Å away from the ribosomal peptidyl transferase center (PTC) were deleted. Water molecules, ions and Nagilactone C were also removed. After the addition of hydrogen atoms and charges, a brief relaxation of the receptor structure was performed by using the Protein Preparation module in Maestro v7.5 (Schrödinger Inc. NY). LigPrep module in Maestro v7.5 (Schrödinger Inc. NY) was used to prepare the 3D structure of AglA. Afterwards, AglA was docked into the PTC by using Glide v4.0 (Schrödinger Inc. NY) in the extra-precision (XP) mode. All the docking poses generated by Glide XP fit well into the PTC center. Due to the structural rigidity of AglA, the generated docking poses were similar to each other, with only minor orientation differences. Therefore, the docking pose with the most negative XP GScore was chosen as the predicted binding mode and then visualized and analyzed in Pymol 0.99rc (www.pymol.org).

DMS modification

DMS treatment was performed in a final volume of 25 μl, containing 30mM K-HEPES (pH 7.5), 3mM MgOAc2, 100mM KCl, 2mM DTT, 0.5μM each of 40S and 60S yeast ribosomal subunits. For AglA treatment, 10% of AglA in DMSO was added. For CHX treatment, a 10% volume of CHX in water was added. Reactions were brought to 24μl, and pre-incubated at 26°C for 5 minutes. 1μl of 2.25M dimethyl sulfate (sigma D186309, use within 6 months) diluted in ethanol (to 90mM final concentration) was added, reactions mixed by pipetting, and incubated at 26°C for 8 minutes. Reactions were quenched by addition of 475μl of (30% 2-mercaptoethanol, 0.3M sodium acetate, pH 5.5). Reactions were isopropanol precipitated, resuspended in 200μl of 0.3M sodium acetate, pH 5.2 and extracted twice with phenol-chloroform-isoamyl alcohol (Thermo-Fisher AM9722). Reactions were ethanol precipitated with 10 μg glycogen, washed with 80% ethanol, resuspended in 40μl water, and RNA concentrations quantified by NanoDrop.

Library Preparation

Four micrograms of rRNA was fragmented by incubation at 95°C for 5 minutes with 10 mM ZnCl2, quenched by addition of EDTA to 20 mM on ice. RNA was precipitated and 3’ ends were dephosphorylated by incubating in 12.5 μl reactions of 1x PNK buffer (NEB), 1.25 μl T4 PNK (NEB) and 0.5 μl SUPERase-In (Thermo-Fisher) at 37°C for 1 hour. Reactions were run on a 10% TBE-Urea PAGE gel (Bio-Rad), alongside 10-bp DNA ladder (Invitrogen) and a slice was cut from the gel between the 60 and 70bp markers. From this point, the library preparation proceeded as described in (Zubradt et al., 2017) with the following modifications. For linker ligation, 10 pmol of pre-adenylated miRNA cloning liker 2 was used, [IDT , AppCACTCGGGCACCAAGGA/3ddC/, pre-adenylated in-house based on (Pfeffer et al., 2005). An aliquot of 10 μl Reverse transcription (RT) reactions were performed with half of the gel-purified ligated product, 1x first strand buffer (Invitrogen), 0.5 mM dNTPs, 0.5 μl SUPERase-In (Thermo-Fisher) 100 nM of complementary circularizeable RT primer (IDT, /5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSP18/C ACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTGTCCTTGGTGCCCGAGTG), 5mM DTT and 0.5 μM TGIRTIII RT (InGex) for 1 hour at 60°C. Full-leng th RT products were gel-purified. Circularized cDNA was prepared for Illumina sequencing with 11-13 cycles of PCR with forward primer (IDT, AATGATACGGCGACCACCGAGATCTACAC) and barcoded reverse primer (IDT,CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCC ). Full-length libraries were gel-purified from a 10% TBE-PAGE gel (Bio-Rad) quantified by bioanalyzer (Agilent), pooled, and sequenced on an Illumina HiSeq 2000 in 100nt single-end rapid mode.

Ribosome purification, complex formation, crystallization and crystal treatment

80S ribosomes from the yeast S. cerevisiae were purified. Crystals were prepared as described previously (Ben-Shem et al., 2011) with minor differences. Crystals were grown at 4°C by hanging-drop vapor diffusion and then treated based on the previously described protocol maintaining an increased glycerol concentration to 20% in all intermediate solutions. AglA was added at a final concentration of 250 μM in the last treatment solution, in which crystals of the 80S ribosome were finally soaked for 60 minutes prior to freezing in liquid N2.

QUANTIFICATION AND STATISTICAL ANALYSIS

Inhibition of translation by AglA

Data fitting was performed using GraphPad Prism for Windows, GraphPad Software (www.graphpad.com). Statistical values are reported in the Figure Legends (Figure 2C, Figure S1). Mean values ± SEM (error bars) from 3 independent experiments are shown. IC50 values are listed ± SE.

Sequencing data analysis

The linker sequence for all reads was trimmed using cutadapt (Martin, 2011), and the 5’-most 3 nucleotides were removed with FASTX trimmer. Any reads without an identifiable 3’ linker sequence were discarded. The trimmed reads were fed into the ShapeMapper package (Siegfried et al., 2014) to further trim the reads based on quality, and to count mismatches relative to the yeast rDNA sequence (from the UCSC genome browser, August 29th, 2011 version). The mutation rate was defined as the ratio of the number of sequence mismatches at an rRNA position, divided by the total number of trimmed reads overlapping a position. The error at a position was defined by the Poisson sampling error (Siegfried et al., 2014). Several rRNA nucleotides have in vivo methylations on their Watson-Crick face (18S 1191; 25S 645,2142,2634,2843), and reproducibly have up to 50-90% mutation rates, even in the absence of DMS treatment. These nucleotides demonstrate the quantitative nature of the mismatches introduced by the RT, but are excluded from downstream analysis. Log10-fold changes in DMS-induced mutations between treatment and control were computed, and the errors for the two datasets were propagated through the division and log transformation. To determine if any of these changes constituted significant protections or deprotections, z-scores were computed from these means and standard errors, based on a distribution with a mean of 0, the normal distribution integrated from the z score to positive or negative infinity, and tested against a p-value of 0.01, with Bonferroni correction. A 3-fold change cutoff was also instituted, based on analysis of cycloheximide titrations.

Crystal structure determination

Data of the AglA-80S complex have been collected at the X06SA beamline at the PSI-SLS (Switzerland) and at the PROXIMA-1 beamline at SOLEIL (France), finally yielding a complete dataset at maximal resolution of 3.5 Å (Supplementary Table 1). Data were processed using XDS and scaled with XSCALE (Martin, 2011). The resulting file was converted into mtz format with the XDSCONV tool and then submitted for a first cycle of rigid-body refinement in phenix.refine (PHENIX suite) (Adams et al., 2010) using, as initial model, the S. cerevisiae vacant 80S ribosome (PDB code: 4V88). Inspection of the resulting map allowed detection of positive difference density (Fobs – Fcalc) close to the A-site peptidyl-transferase center (PTC) and fitting of AglA into it. Drawing of the chemical structure of AglA was performed using MarvinSketch suite (ChemAxon, http://www.chemaxon.com/), which resulted in the 3D coordinates of the compound. Dictionary of restraints for AglA was generated by submitting the 3D coordinates to the GradeWebServer (http://grade.globalphasing.org). Iterative model building and refinement were performed using Coot (Emsley and Cowtan, 2004) and phenix.refine respectively. A protocol of positional, grouped isotropic B-factor and TLS refinement using a strong weight for geometry restraints yielded the final statistics presented in Table S1. Structure validation was performed using Molprobity (Chen et al., 2010). Ramachandran plot resulted in 90.7% favoured, 8.4% allowed and 0.9% outliers. Figures of the structure were prepared using PyMOL 1.4 (Schrödinger, http://pymol.org/).

DATA AND SOFTWARE AVAILABILITY

DMS-MaPseq data analysis software, which produces quality control information, wig files, output tables, and plots from FASTQ files is freely available at https://github.com/borisz264/mod_seq/. Raw sequencing data and mutation rates have been deposited in the gene expression omnibus with accession number GSE85619.

Supplementary Material

supplement

SIGNIFICANCE.

The structurally unique marine sponge-derived natural product AglA exhibits promising antitumor activity, particularly against brain tumors due to its excellent penetration of the blood-brain barrier. Using a multi-pronged approach, we elucidated the underlying molecular mechanism of inhibition of cancer cell proliferation by AglA, revealing the peptidyl transferase center of the eukaryotic ribosome as its target. The X-ray crystal structure of the AglA-ribosome complex has allowed for the rationalization of the existing structure-activity relationship of natural congeners and synthetic analogs of AglA and will facilitate the future design and synthesis of novel AglA analogs with improved potency and pharmacological activity as anticancer drug leads.

Acknowledgments

This work has been supported by discretionary funds, Flight Attendant Medical Research Institute (FAMRI) and and NIH sub-contract from Baylor (R37 GM052964) (J.O.L.), NIH (R37 GM052964) and the Welch Foundation (AA-1280) (D.R.), and an NRSA (5F31AT008324-02) fellowship from the NIH National Center for Complementary and Integrative Health (B.M.). B. Z. is an HHMI Fellow of the Damon Runyon Cancer Research Foundation (DRG-2250-16). This work was also supported by the French National Research Agency ANR-15-CE11-0021-01 (G.Y), European Research Council advanced grant 294312 (S.P., M.M., M.Y.) and the Russian Government Program of Competitive Growth of Kazan Federal University (M. Y.). We are grateful to the staff of PROXIMA 1 beamline at the synchrotron SOLEIL (France) and X06SA beamline at the PSI-SLS (Switzerland). Illumina sequencing was conducted at the Genetic Resources Core Facility, Johns Hopkins Institute of Genetic Medicine. We thank Dr. Haoran Xue for purification of the AglA analogs. We thank Dr. Tilman Schneider-Poetsch (RIKEN) for providing reagents and technical advice, Dr. Sarah Head for critical comments on the manuscript and members of the Liu Lab for helpful suggestions.

Footnotes

AUTHOR CONTRIBUTIONS

J.O.L. and D.R. initiated the work. J.O.L. coordinated and supervised the study. B.M. performed the metabolic labeling, dual luciferase, and stress granule assays. A.S. performed the in vitro peptidyl transfer assay. B.Z. performed and analyzed the DMS-seq assay, and the supplemental GTPase assays. J.Y., C. L. and Y. D. performed the computational modeling. M.M. and S.P. were responsible for solving the AglA-80S complex structure and for its interpretation. M.J. and J.C.R. synthesized the targeted compounds and analogs. Z.G. and S.Y. determined the IC50 values of AglA analogs for inhibition of in vitro translation and HeLa cell proliferation. J.O.L., B.M., R. G., M. Y. and D. R. analyzed the data. B. M. and J.O.L. wrote the manuscript with input from all coauthors.

Competing financial interests

The authors declare no competing financial interests.

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Jun Liu (joliu@jhu.edu).

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Abid MR, Li Y, Anthony C, De Benedetti A. Translational Regulation of Ribonucleotide Reductase by Eukaryotic Initiation Factor 4E Links Protein Synthesis to the Control of DNA Replication. Journal of Biological Chemistry. 1999;274:35991–35998. doi: 10.1074/jbc.274.50.35991. [DOI] [PubMed] [Google Scholar]
  2. Acker MG, Kolitz SE, Mitchell SF, Nanda JS, Lorsch JR. Reconstitution of Yeast Translation Initiation. In Methods in Enzymology (Elsevier) 2007:111–145. doi: 10.1016/S0076-6879(07)30006-2. [DOI] [PubMed] [Google Scholar]
  3. Adams PD, Afonine PV, Bunkoczi G, Chen VB, Davis IW, Echols N, Headd JJ, Hung LW, Kapral GJ, Grosse-Kunstleve RW, et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr. 2010;66:213–221. doi: 10.1107/S0907444909052925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ben-Shem A, Garreau de Loubresse N, Melnikov S, Jenner L, Yusupova G, Yusupov M. The structure of the eukaryotic ribosome at 3.0 A resolution. Science. 2011;334:1524–1529. doi: 10.1126/science.1212642. [DOI] [PubMed] [Google Scholar]
  5. Berthon J, Fujikane R, Forterre P. When DNA replication and protein synthesis come together. Trends in Biochemical Sciences. 2009;34:429–434. doi: 10.1016/j.tibs.2009.05.004. [DOI] [PubMed] [Google Scholar]
  6. Bhat M, Robichaud N, Hulea L, Sonenberg N, Pelletier J, Topisirovic I. Targeting the translation machinery in cancer. Nature Reviews Drug Discovery. 2015;14:261–278. doi: 10.1038/nrd4505. [DOI] [PubMed] [Google Scholar]
  7. Brunelle JL, Shaw JJ, Youngman EM, Green R. Peptide release on the ribosome depends critically on the 2’ OH of the peptidyl-tRNA substrate. RNA. 2008;14:1526–1531. doi: 10.1261/rna.1057908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chan J. Eukaryotic protein synthesis inhibitors identified by comparison of cytotoxicity profiles. RNA. 2004;10:528–543. doi: 10.1261/rna.5200204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen VB, Arendall WB, 3rd, Headd JJ, Keedy DA, Immormino RM, Kapral GJ, Murray LW, Richardson JS, Richardson DC. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr D Biol Crystallogr. 2010;66:12–21. doi: 10.1107/S0907444909042073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cragg GM, Grothaus PG, Newman DJ. Impact of natural products on developing new anti-cancer agents. Chem Rev. 2009;109:3012–3043. doi: 10.1021/cr900019j. [DOI] [PubMed] [Google Scholar]
  11. D’Ambrosio M, Guerriero A, Debitus Cc, Ribes O, Pusset J, Leroy S, Pietra F. Agelastatin a, a new skeleton cytotoxic alkaloid of the oroidin family. Isolation from the axinellid sponge Agelas dendromorpha of the coral sea. Journal of the Chemical Society, Chemical Communications. 1993:1305. [Google Scholar]
  12. Dang Y, Kedersha N, Low WK, Romo D, Gorospe M, Kaufman R, Anderson P, Liu JO. Eukaryotic initiation factor 2alpha-independent pathway of stress granule induction by the natural product pateamine A. J Biol Chem. 2006;281:32870–32878. doi: 10.1074/jbc.M606149200. [DOI] [PubMed] [Google Scholar]
  13. Dang Y, Schneider-Poetsch T, Eyler DE, Jewett JC, Bhat S, Rawal VH, Green R, Liu JO. Inhibition of eukaryotic translation elongation by the antitumor natural product Mycalamide B. RNA. 2011;17:1578–1588. doi: 10.1261/rna.2624511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ding Y, Tang Y, Kwok CK, Zhang Y, Bevilacqua PC, Assmann SM. In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features. Nature. 2013;505:696–700. doi: 10.1038/nature12756. [DOI] [PubMed] [Google Scholar]
  15. Dong G. Recent advances in the total synthesis of agelastatins. Pure and Applied Chemistry. 2010;82 [Google Scholar]
  16. Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr. 2004;60:2126–2132. doi: 10.1107/S0907444904019158. [DOI] [PubMed] [Google Scholar]
  17. Eyler DE, Green R. Distinct response of yeast ribosomes to a miscoding event during translation. RNA. 2011;17:925–932. doi: 10.1261/rna.2623711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gandhi V, Plunkett W, Cortes JE. Omacetaxine: A Protein Translation Inhibitor for Treatment of Chronic Myelogenous Leukemia. Clinical Cancer Research. 2014;20:1735–1740. doi: 10.1158/1078-0432.CCR-13-1283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Garreau de Loubresse N, Prokhorova I, Holtkamp W, Rodnina MV, Yusupova G, Yusupov M. Structural basis for the inhibition of the eukaryotic ribosome. Nature. 2014;513:517–522. doi: 10.1038/nature13737. [DOI] [PubMed] [Google Scholar]
  20. Han S, Siegel DS, Morrison KC, Hergenrother PJ, Movassaghi M. Synthesis and Anticancer Activity of All Known (−)-Agelastatin Alkaloids. The Journal of Organic Chemistry. 2013;78:11970–11984. doi: 10.1021/jo4020112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Homan PJ, Favorov OV, Lavender CA, Kursun O, Ge X, Busan S, Dokholyan NV, Weeks KM. Single-molecule correlated chemical probing of RNA. Proc Natl Acad Sci U S A. 2014;111:13858–13863. doi: 10.1073/pnas.1407306111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hong TW, Jimenez DR, Molinski TF. Agelastatins C and D, new pentacyclic bromopyrroles from the sponge Cymbastela sp., and potent arthropod toxicity of (-)-agelastatin A. J Nat Prod. 1998;61:158–161. doi: 10.1021/np9703813. [DOI] [PubMed] [Google Scholar]
  23. Jackson RJ, Hellen CUT, Pestova TV. The mechanism of eukaryotic translation initiation and principles of its regulation. Nature Reviews Molecular Cell Biology. 2010;11:113–127. doi: 10.1038/nrm2838. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jouanneau M, McClary B, Reyes JCP, Chen R, Chen Y, Plunkett W, Cheng X, Milinichik AZ, Albone EF, Liu JO, et al. Derivatization of agelastatin A leading to bioactive analogs and a trifunctional probe. Bioorganic & Medicinal Chemistry Letters. 2016 doi: 10.1016/j.bmcl.2016.02.051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kapp LD, Lorsch JR. The molecular mechanics of eukaryotic translation. Annu Rev Biochem. 2004;73:657–704. doi: 10.1146/annurev.biochem.73.030403.080419. [DOI] [PubMed] [Google Scholar]
  26. Kuznetsov G, Xu Q, Rudolph-Owen L, Tendyke K, Liu J, Towle M, Zhao N, Marsh J, Agoulnik S, Twine N, et al. Potent in vitro and in vivo anticancer activities of des-methyl, des-amino pateamine A, a synthetic analogue of marine natural product pateamine A. Mol Cancer Ther. 2009;8:1250–1260. doi: 10.1158/1535-7163.MCT-08-1026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li Z, Shigeoka D, Caulfield TR, Kawachi T, Qiu Y, Kamon T, Arai M, Tun HW, Yoshimitsu T. An integrated approach to the discovery of potent agelastatin A analogues for brain tumors: chemical synthesis and biological, physicochemical and CNS pharmacokinetic analyses. MedChemComm. 2013;4:1093. [Google Scholar]
  28. Low WK, Dang Y, Schneider-Poetsch T, Shi Z, Choi NS, Merrick WC, Romo D, Liu JO. Inhibition of eukaryotic translation initiation by the marine natural product pateamine A. Mol Cell. 2005;20:709–722. doi: 10.1016/j.molcel.2005.10.008. [DOI] [PubMed] [Google Scholar]
  29. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnetjournal. 2011;17:10. [Google Scholar]
  30. Mason CK, McFarlane S, Johnston PG, Crowe P, Erwin PJ, Domostoj MM, Campbell FC, Manaviazar S, Hale KJ, El-Tanani M. Agelastatin A: a novel inhibitor of osteopontinmediated adhesion, invasion, and colony formation. Molecular Cancer Therapeutics. 2008;7:548–558. doi: 10.1158/1535-7163.MCT-07-2251. [DOI] [PubMed] [Google Scholar]
  31. Meijer L, Thunnissen AM, White A, Garnier M, Nikolic M, Tsai LH, Walter J, Cleverley K, Salinas P, Wu YZ, et al. Inhibition of cyclin-dependent kinases, GSK-3β and CK1 by hymenialdisine, a marine sponge constituent. Chemistry & Biology. 2000;7:51–63. doi: 10.1016/s1074-5521(00)00063-6. [DOI] [PubMed] [Google Scholar]
  32. Moazed D, Stern S, Noller HF. Rapid chemical probing of conformation in 16 S ribosomal RNA and 30 S ribosomal subunits using primer extension. Journal of Molecular Biology. 1986;187:399–416. doi: 10.1016/0022-2836(86)90441-9. [DOI] [PubMed] [Google Scholar]
  33. Moen MD, McKeage K, Plosker GL, Siddiqui MAA. Imatinib: a review of its use in chronic myeloid leukaemia. Drugs. 2007;67:299–320. doi: 10.2165/00003495-200767020-00010. [DOI] [PubMed] [Google Scholar]
  34. Movassaghi M, Siegel DS, Han S. Total synthesis of all (-)-Agelastatin alkaloids. Chem Sci. 2010;1:561–566. doi: 10.1039/c0sc00351d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Newman DJ, Cragg GM. Natural Products as Sources of New Drugs from 1981 to 2014. J Nat Prod. 2016;79:629–661. doi: 10.1021/acs.jnatprod.5b01055. [DOI] [PubMed] [Google Scholar]
  36. Oguro M, Suzuki-Hori C, Nagano H, Mano Y, Ikegami S. The Mode of Inhibitory Action by Aphidicolin on Eukaryotic DNA Polymerase alpha. European Journal of Biochemistry. 1979;97:603–607. doi: 10.1111/j.1432-1033.1979.tb13149.x. [DOI] [PubMed] [Google Scholar]
  37. Pestova TV, Shatsky IN, Fletcher SP, Jackson RJ, Hellen CU. A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNAs. Genes Dev. 1998;12:67–83. doi: 10.1101/gad.12.1.67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Pettit GR, Ducki S, Herald DL, Doubek DL, Schmidt JM, Chapuis JC. Antineoplastic agents 470. Absolute configuration of the marine sponge bromopyrrole agelastatin A. Oncol Res. 2005;15:11–20. doi: 10.3727/096504005775082075. [DOI] [PubMed] [Google Scholar]
  39. Pfeffer Sïb, Lagos-Quintana M, Tuschl T. Cloning of Small RNA Molecules. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, editors. Current Protocols in Molecular Biology. Hoboken, NJ, USA: John Wiley & Sons, Inc; 2005. [DOI] [PubMed] [Google Scholar]
  40. Reid SA, Nyambo S, Muzangwa L, Uhler B. pi-Stacking, C-H/pi, and halogen bonding interactions in bromobenzene and mixed bromobenzene-benzene clusters. J Phys Chem A. 2013;117:13556–13563. doi: 10.1021/jp407544c. [DOI] [PubMed] [Google Scholar]
  41. Reyes JCP, Romo D. Bioinspired Total Synthesis of Agelastatin A. Angewandte Chemie International Edition. 2012;51:6870–6873. doi: 10.1002/anie.201200959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Rodriguez-Fonseca C, Amils R, Garrett RA. Fine Structure of the Peptidyl Transferase Centre on 23 S-like rRNAs Deduced from Chemical Probing of Antibiotic-Ribosome Complexes. Journal of Molecular Biology. 1995;247:224–235. doi: 10.1006/jmbi.1994.0135. [DOI] [PubMed] [Google Scholar]
  43. Rouskin S, Zubradt M, Washietl S, Kellis M, Weissman JS. Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo. Nature. 2013;505:701–705. doi: 10.1038/nature12894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Schneider-Poetsch T, Ju J, Eyler DE, Dang Y, Bhat S, Merrick WC, Green R, Shen B, Liu JO. Inhibition of eukaryotic translation elongation by cycloheximide and lactimidomycin. Nature Chemical Biology. 2010;6:209–217. doi: 10.1038/nchembio.304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Siegfried NA, Busan S, Rice GM, Nelson JAE, Weeks KM. RNA motif discovery by SHAPE and mutational profiling (SHAPE-MaP) Nature Methods. 2014;11:959–965. doi: 10.1038/nmeth.3029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Spadari S, Sala F, Pedrali-Noy G. Aphidicolin: a specific inhibitor of nuclear DNA replication in eukaryotes. Trends in Biochemical Sciences. 1982;7:29–32. [Google Scholar]
  47. Stout EP, Choi MY, Castro JE, Molinski TF. Potent Fluorinated Agelastatin Analogues for Chronic Lymphocytic Leukemia: Design, Synthesis, and Pharmacokinetic Studies. Journal of Medicinal Chemistry. 2014;57:5085–5093. doi: 10.1021/jm4016922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Titov DV, Gilman B, He QL, Bhat S, Low WK, Dang Y, Smeaton M, Demain AL, Miller PS, Kugel JF, et al. XPB, a subunit of TFIIH, is a target of the natural product triptolide. Nat Chem Biol. 2011;7:182–188. doi: 10.1038/nchembio.522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Titov DV, Liu JO. Identification and validation of protein targets of bioactive small molecules. Bioorganic & Medicinal Chemistry. 2012;20:1902–1909. doi: 10.1016/j.bmc.2011.11.070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tornheim K, O’Dell RG, Prosky L. Effects of cycloheximide on DNA and protein synthesis in rat liver. Proc Soc Exp Biol Med. 1969;131:601–605. doi: 10.3181/00379727-131-33935. [DOI] [PubMed] [Google Scholar]
  51. Zubradt M, Gupta P, Persad S, Lambowitz AM, Weissman JS, Rouskin S. DMSMaPseq for genome-wide or targeted RNA structure probing in vivo. Nat Methods. 2017;14:75–82. doi: 10.1038/nmeth.4057. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement
NIHMS872019-supplement.pdf (4.1MB, pdf)

RESOURCES