Overexpression of plastid terminal oxidase in Synechocystis sp. PCC 6803 alters cellular redox state

Abstract

Cyanobacteria are the most ancient organisms performing oxygenic photosynthesis, and they are the ancestors of plant plastids. All plastids contain the plastid terminal oxidase (PTOX), while only certain cyanobacteria contain PTOX. Many putative functions have been discussed for PTOX in higher plants including a photoprotective role during abiotic stresses like high light, salinity and extreme temperatures. Since PTOX oxidizes PQH₂ and reduces oxygen to water, it is thought to protect against photo-oxidative damage by removing excess electrons from the plastoquinone (PQ) pool. To investigate the role of PTOX we overexpressed rice PTOX fused to the maltose-binding protein (MBP-OsPTOX) in Synechocystis sp. PCC 6803, a model cyanobacterium that does not encode PTOX. The fusion was highly expressed and OsPTOX was active, as shown by chlorophyll fluorescence and P₇₀₀ absorption measurements. The presence of PTOX led to a highly oxidized state of the NAD(P)H/NAD(P)⁺ pool, as detected by NAD(P)H fluorescence. Moreover, in the PTOX overexpressor the electron transport capacity of PSI relative to PSII was higher, indicating an alteration of the photosystem I (PSI) to photosystem II (PSII) stoichiometry. We suggest that PTOX controls the expression of responsive genes of the photosynthetic apparatus in a different way from the PQ/PQH₂ ratio.

This article is part of the themed issue ‘Enhancing photosynthesis in crop plants: targets for improvement’.

1. Introduction

The plastid terminal oxidase (PTOX) is a plastohydroquinone:oxygen oxidoreductase that is important for carotenoid biosynthesis and plastid development in higher plants. PTOX is found in the chloroplasts of higher plants, in red and green algae and in some cyanobacteria [1]. In cyanobacteria it is predominantly found in marine species as well as in filamentous nitrogen-fixing species, but it is lacking in the most studied model cyanobacterium Synechocystis sp. PCC 6803 (hereafter Synechocystis). Since PTOX is present in marine and in nitrogen-fixing cyanobacteria, it may play an important physiological role related to specific metabolic requirements in these species. It has been proposed that in marine phytoplankton, PTOX may be essential to survive under iron starvation. The marine cyanobacterium Synechococcus WH8102 exhibits significant alternative electron flow to O₂ under Fe starvation [2]. Similar observations have been reported for the green alga Ostreococcus [3].

The physiological role of PTOX in photosynthesis is not well understood [4,5]. Plants grown in moderate light under non-stress conditions have low PTOX concentrations (about 1 PTOX protein per 100 PSII; [6]). In contrast, elevated PTOX levels have been found in a number of plant species exposed to abiotic stresses such as high light and high temperatures [7,8], high light and drought [9], salinity [10], low temperatures [11] and high intensities of visible [12] and UV light [13]. PTOX has been proposed to act as a safety valve by protecting the plastoquinone pool from overreduction. At the same time, by oxidizing plastoquinol, PTOX reduces the number of electrons available for photosynthetic electron flow. In Thellungiella halophila exposed to salt stress, PTOX levels were increased and its activity accounted for 30% of the PSII activity [10], indicating that PTOX may be more efficient when present in higher amounts. However, tobacco and Arabidopsis that overexpress PTOX were shown to suffer from photo-oxidative stress and carbon starvation [14–17].

In cyanobacteria, respiration and photosynthesis share many components in the thylakoid membrane including plastoquinone (PQ), the cytochrome b₆f complex (cyt b₆f) and cytochrome c₆ and plastocyanin. Cytochrome c₆ donates electrons to photosystem I (PSI) or to the aa₃-type cytochrome c oxidase complex (Cox). PQ accepts electrons from photosystem II (PSII), from several dehydrogenase complexes (NDH-1 and NDH-2) and from succinate dehydrogenase (for a recent review, see [18]). Additionally, a ferredoxin quinone reductase (FQR) may provide electrons to PQ ([18]). Plastoquinol (PQH₂) donates electrons to the cyt b₆f complex, to the cytochrome-bd quinol oxidase (CYD) and to PTOX when present. In mutants lacking the terminal oxidases, no phenotype was observed in Synechocystis [19,20] or in Synechococcus PCC 7002 [21] under photoautotrophic conditions. However, mutants lacking the alternative respiratory oxidases and the Cox showed reduced growth and suffered from photoinhibition when grown under rapidly changing light, while they did not show a phenotype when grown under continuous light or under a 12 h dark–light cycle [22]. The presence of Cox is essential for viability under low light [23] and either Cox or cytochrome bd-quinol oxidase (Cyd) is required for survival in photoperiod regimes (12 h high light/12 h dark) [22]. The roles of individual respiratory terminal oxidases in the light have been investigated recently in Synechocystis and it has been shown that Cyd and the flavodiiron proteins Flv1,3 play a major role in the light, while dark respiration can be mainly attributed to Cox activity [24].

Cyanobacteria contain flavodiiron proteins (Flv) that play a role in protection against photo-oxidative stress. Flvs are crucial for the survival of cyanobacteria under highly dynamic fluctuations of light intensities and light quality [25]. Synechocystis contains four Flvs (Flv1-4), with Flv1 and Flv3 serving in a ‘Mehler-like’ reaction catalysing the reduction of O₂ to H₂O at the acceptor side of PSI using NAD(P)H as electron donor [26]. Flv2 and Flv4 have a role comparable to that of PTOX keeping the PQ pool oxidized [27,28]. It has been recently proposed that they act also on the midpoint potential of the secondary quinone acceptor Q_B thereby stabilizing forward electron transport and avoiding the generation of singlet oxygen by charge recombination reactions in PSII [29]. Furthermore, the deletion of the flv4-2 operon results in a partial detachment of the phycobilisome antenna from the PSII reaction centre ([28,29]; for a recent review see [25]). In cyanobacteria that contain Flv2, Flv4 and PTOX, the physiological role of these enzymes and their interplay are unclear.

To study the impact of functional PTOX expression in Synechocystis, PTOX from rice (OsPTOX) was overexpressed. The effect of PTOX was determined by chlorophyll fluorescence, P₇₀₀ measurements and by NAD(P)H fluorescence. PTOX overexpression changed the redox state of the cells, keeping them more oxidized, and altered the PSI : PSII stoichiometry.

2. Material and methods

(a). Growth conditions

Cultures of Synechocystis sp. PCC 6803 were grown photoautotrophically in an incubator at 32°C in a CO₂-enriched atmosphere and under continuous light (90 µmol photons m⁻² s⁻¹). The medium composition is described in [30]. When appropriate, media were supplemented with kanamycin (50 µg ml⁻¹).

(b). DNA manipulations and strain construction

The MBP-OsPTOX fusion construct from plasmid pHMGW-OsPTOX [31] was excised using BamHI and XbaI, and ligated to BamHI and AvrII digested pPSBA2 [32], creating pKF1. Kanamycin resistance was introduced in pKF1 by a BamHI fragment extracted from pUC4-K and ligated to BamHI-digested pKF1, resulting in pKF1-K, in which MBP-OsPTOX fusion replaced the psbA2 open reading frame (orf). Plasmids were sequenced to ensure correct cloning. pKF1-K was used to transform Synechocystis sp. PCC 6803 as described in [33]. To ensure construct integration in the psbA2 locus, and complete segregation of the chromosomes, Km^r transformants were verified by PCR using the primer pair AF1: CTGAACATCGACAAATACATAAGG and AR1: GCAGTTACCATTAGAGAGTC. Several transformants satisfied the above requirements; one of them, designated KF, was further analysed. The strain D4D, overexpressing the rod linker LR10 of the phycobilisomes under the control of the psbA2 promoter, was constructed as described in [30].

(c). Preparation of cell extracts

For Synechocystis sp. PCC 6803, 10 ml of cells, at OD₅₈₀ = 2, were collected and resuspended in 1 ml of Tricine (50 mM, pH 8) containing complete protease inhibitor (Roche), then broken by vortexing for 6 min with glass beads. Unbroken cells and glass beads were removed by centrifugation at 5000g for 2 min. The supernatant was used as total cell extract. Chlorophyll concentration was used to ensure equivalent loading on a SDS-PAGE (0.05 mg per lane). Membranes, mostly thylakoids, were separated from supernatants by ultracentrifugation at 80 000 rpm for 15 min. Membrane-containing pellets were washed at least twice to remove non-specifically bound soluble proteins.

(d). Chlorophyll quantification

10 µl of total cell extract were added to 1 ml 100% methanol, vortexed and centrifuged 1 min at 21 000g at room temperature. The supernatant was used to determine the absorption at 666 nm. The absorption was divided by the chlorophyll extinction coefficient in methanol (76 ml mg⁻¹ cm⁻¹) to obtain the chlorophyll concentration.

(e). Gel electrophoresis and immunoblotting

Proteins were separated using denaturing Tris-Tricine PAGE. For immunoblot analysis, proteins were transferred to PVDF membranes. Blots were blocked with TBS (50 mM Tris–HCl pH 7.6, 150 mM NaCl), 0.1% Tween 20 and 5% non-fat milk powder, and incubated with anti-PTOX (1 : 1500 dilution, gift from M. Kuntz, Grenoble). After washing, bound antibodies were revealed with a peroxidase-linked secondary anti-rabbit antibody (1 : 30 000 dilution, Agrisera, Vännäs, Sweden) and visualized by enhanced chemiluminescence. Images were generated using a cooled CCD camera (Chemi Smart 5000, Vilber Lourmat) and ImageJ software.

(f). O₂ measurements

Measurements of O₂ production (PSII activity) were performed in a liquid-phase oxygen electrode chamber (Hansatech Instruments, Norfolk, England) with entire cells (10 µg chl ml^–1) at 32°C using 0.5 mM 2,6-dichloro-p-benzoquinone (DCBQ) (dissolved in ethanol) as electron acceptor. PSI activity was measured with thylakoids (10 µg chl ml^–1) as O₂-uptake in the presence of 10 µM 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) 5 mM ascorbate, 30 µM 2,6-dichlorophenolindophenol (DCPIP) and 500 µM methylviologen (MV).

(g). Chl fluorescence measurements

Chlorophyll fluorescence was monitored using a pulse amplitude fluorometer (101–103 PAM, Walz, Effeltrich, Germany). Experiments were carried out on entire cells at a chl concentration of 0.5 µg ml⁻¹ at 30°C in 1 cm path length stirred cuvettes. As actinic light, red light was used (650 nm, 280 µmol photons m⁻² s⁻¹). Saturating flashes (400 ms) were given to probe the maximum fluorescence level.

(h). P₇₀₀ measurements

P₇₀₀ absorption changes in the near infrared (810 minus 860 nm) were performed using the P₇₀₀ module of a standard PAM (PAM 101-103, Effeltrich, Germany; [34]). Measurements were made on entire cells in 1 × 1 cm open cuvettes at a chl concentration of 10 µg ml⁻¹ at 32°C in the absence and presence of 20 µM DCMU, 300 µM MV, 80 µM 2,5-dibromo-6-isopropyl-3-methyl-1,4-benzoquinone (DBMIB) and 80 µM KCN. Red light (RG 650) was used as actinic light. The induction kinetics with onset of light allow the estimation of the PSI turnover by determining the rate of light-induced charge separation k_i using a first-order exponential growth fit (y = y₀ + A_e^−ki/t) and the proportion of reduced P₇₀₀ (amplitude difference in presence of KCN and in absence of all inhibitors). First-order exponential growth is observed in the presence of DBMIB (and without KCN), where the donors to P₇₀₀ are oxidized in darkness thanks to cytochrome oxidase (rate of donation to) so that charge separation depends only on photon absorption by PSI antennae. The signal due to full P₇₀₀ photooxidation was obtained in the presence of DCMU, MV, DBMIB and KCN. The three first inhibitors allow donation to and recombination to be minimized or eliminated whereas KCN allows P₇₀₀ to be fully reduced before illumination.

(i). NAD(P)H fluorescence

Light-induced measurements of NAD(P)H fluorescence were performed at 32°C using the NADPH/9-AA module of a DUAL-PAM (Walz, Effeltrich, Germany) in a square 1 × 1 cm open cuvette with cell suspensions at 4–5 µg chl ml⁻¹. Fluorescence is excited at 365 nm by an LED and is detected by a photomultiplier (PM) between 420 and 580 nm, this wavelength region being selected with a broad-band colour filter. The cells were resuspended in fresh media and incubated for 6–10 min at 32°C in darkness inside the spectrometer before data acquisition. The cell suspension was stirred between measurements, with stirring being stopped 30 s before data acquisition (noise was larger with stirring). The measuring frequency was set at 100 Hz in darkness and was increased to 5000 Hz under continuous illumination (red actinic light at 95 µmol photons m⁻² s⁻¹).

3. Results

(a). Effect of PTOX overexpression on cellular growth

Synechocystis was transformed with the translational fusion (OsMBP-PTOX) [31], placed under the control of the strong psbA2 promoter in the psbA2 locus. Total segregation of the resulting recombinant strain, denoted KF, was confirmed by PCR (figure 1). As a control, the strain D4D [30], expressing the LR10 rod linker of the phycobilisome under the control of the psbA2 promoter, was included in the study to show whether the absence of psbA2 had an effect on photosynthetic performance. Insertions in the psbA2 locus are thought to be neutral since the growth rate of psbA2-deletion mutant was comparable to that of the wild-type [35]. Moreover, this locus was used for the expression of many genes in Synechocystis (e.g. [30,32,36,37]). OsMBP-PTOX expression in Synechocystis was compared to that of E. coli by SDS-PAGE and PTOX immunodetection (figure 2). As expected, OsMBP-PTOX was clearly visible (about 75 kDa) in total extracts of induced E. coli (iEc), compared to total extracts of uninduced E. coli (uEc), but it was also visible, albeit less intense, in total extracts of the recombinant Synechocystis (tKF), compared to total extracts of the wild-type (tWT). Moreover, when cytoplasmic (sKF) and membrane (mKF) fractions were separated by ultracentrifugation, OsMBP-PTOX was clearly found associated to the membrane fraction (figure 2a). PTOX immunodetection confirmed the identity of the expressed protein (figure 2b).

Figure 1.

Construction of KF, the recombinant Synechocystis strain expressing PTOX. (a) Structure of the construct inserted in the psbA2 locus. A grey arrow represents the orf encoding His-MBP-PTOX fusion, white boxes represent upstream and downstream psbA2 regions, bent arrow represents psbA2 transcription-start site and white arrows represent positions of the PCR primers. aphI encodes kanamycin resistance, the selection marker used for the genetic transformation. (b) PCR analysis of the WT, D4D and KF genomes. A 1.4-kb fragment was amplified from the WT, while larger fragments (2 kB for D4D and 4 kB for KF) were amplified from strains harbouring an insertion in the psbA2 locus, cpcD in D4D and MBP-OsPTOX in KF.

Figure 2.

Detection of MBP-OsPTOX in E. coli and in Synechocystis. Two amounts (4 µg and 10 µg) of each extract were separated on two identical denaturing PAGEs, one was Coomassie stained (a), while the other one (b) underwent western-blot analysis with an antibody directed towards the Arabidopsis thaliana PTOX. uEc and iEC, total extracts from uninduced and induced E. coli, respectively; t, s and m, total, soluble and membrane extracts, respectively, from KF or from WT. Masses of the molecular marker are indicated on the left and position of the recombinant PTOX is marked by an asterisk.

To show that the expressed PTOX protein is active in KF, chlorophyll fluorescence was measured (figure 3). After switching off the actinic light, the wild-type showed a post illumination fluorescence rise which is caused by a reduction of the PQ pool in the dark by the NDH-complexes and other dehydrogenases. KF did not show this specific transient fluorescence rise showing that the presence of PTOX prevents PQ pool reduction in the dark.

Figure 3.

Post-illumination fluorescent transient in Synechocystis wild-type and KF cells. Actinic red light (650 nm, 280 µmol photons m⁻² s ¹) was set on after 120 s for 180 s. Saturating flashes were given to probe the maximum fluorescence level. Black trace, wild-type; red trace (lower trace after AL off), KF. Three biological replicates have been measured and a representative trace for each strain is shown. (Online version in colour.)

The expression of PTOX did not have an impact on the growth of the cells in liquid culture when grown at 50 (low light; LL), 90 (growth light; GL) or 150 (high light; HL) µmol photons m⁻² s⁻¹, as shown in figure 4. The absorption spectra showed no significant difference between wild-type and KF when grown at 90 µmol photons m⁻² s⁻¹ (figure 5a). The control strain D4D showed an increase in the absorption at 620 nm indicating more phycocyanin. When diluted cultures were grown at high light (500 µmol photons m⁻² s⁻¹) using light-emitting diodes instead of fluorescent light tubes, the absorption band corresponding to the phycobilisomes (620 nm) was lower in KF and D4D compared to the wild-type (figure 5b). In all strains when grown at high light, the absorbance at 680 nm decreased indicating a loss of chlorophyll while the absorbance at 485 nm increased, indicating an increase in carotenoids in response to the light stress. In the wild-type the ratio of phycobilisomes to chlorophyll increased, indicating that the light quality was different when diodes were used instead of fluorescence tubes. The increase of the carotenoid content as a response to high light may depend not only on the light intensity but also on the light quality, an aspect that was not investigated in the present study.

Figure 4.

Comparison of growth under different conditions. Growth curves of wild-type (black symbols) and KF (white symbols) suspension cultures grown at 32°C under growth light (GL, squares; 90 µmol photons m⁻² s⁻¹), moderate high light (HL, circles; 150 µmol photons m⁻² s⁻¹) and low light (LL, triangles; 50 µmol photons m⁻² s⁻¹). Average values from three biological replicates are presented for each parameter measured with standard error (mean ± s.e.; n = 3).

Figure 5.

Room-temperature absorption spectra of Synechocystis PCC 6803 wild-type, D4D and KF. (a) Cells were grown under control conditions (32°C; 90 µmol photons m⁻² s⁻¹) and (b) under high light conditions (32°C; 500 µmol photons m⁻² s⁻¹). Three biological replicates have been measured and a representative trace for each strain is shown. The spectra were normalized to the absorption at 440 nm.

(b). Effect of PTOX overexpression on the cellular redox state

We addressed the question whether PTOX competes with linear electron transport by measuring PSI activity via the absorption of . The signal of was first measured without any addition and then in the presence of the inhibitors DCMU, MV, DBMIB and KCN (figure 6). DCMU binds in the Q_B binding pocket of PSII and inhibits electron donation from the primary quinone acceptor Q_A to the PQ pool. MV in low concentration prevents charge recombination in PSI. DBMIB binds to the Q_o site of the cyt b₆f complex and inhibits electron flow to PSI. KCN, an inhibitor of the cytochrome c oxidase, was added to make sure that all P₇₀₀ was in its reduced state in the dark. Upon onset of the actinic light, in the wild-type, P₇₀₀ became quickly oxidized and then transiently reduced before it reached finally a stable level of . Only 60% of P₇₀₀ was oxidized in the absence of the inhibitors, while more than 80% of P₇₀₀ in KF was oxidized. In the presence of DCMU almost the maximum signal was obtained in KF, while in the wild-type the signal size was significantly smaller. Addition of DBMIB gave the maximum signal in KF, while this was not the case in the wild-type. KCN addition increased the total signal size in the wild-type, while this was not the case in KF. After turning off the actinic light, the reduction kinetics were significantly faster in the wild-type than in KF while there was no significant difference observed between wild-type and D4D (table 1). Without inhibitors, the t_1/2 was 3 times faster in the wild-type (and in D4D), and in the presence of DCMU it was two times faster than in KF. In the presence of DCMU linear electron transport from PSII is blocked, but respiratory and cyclic electron transport can still take place in cyanobacteria. This shows that more quinol is available for electron donation through the cyt b₆f complex to PSI in wild-type than in KF, while in KF the PQ pool is largely oxidized. In the presence of DBMIB, cyclic electron flow is blocked and the re-reduction of is slowed down by a factor of about 8 in wild-type and by a factor of about 4.5 in KF. In the presence of KCN, no further effect is seen in KF while in the wild-type the reduction was slightly slower than in the presence of DCMU and DBMIB. This is consistent with the small but significant increase in the absorption signal in the presence of KCN in the wild-type. The decay kinetics were similar in wild-type and D4D (table 1), showing that the difference in KF was due to the overexpression of PTOX and not to the lack of psbA2.

Figure 6.

Effect of electron transport inhibitors on absorption kinetics. After short dark incubation, 5 s actinic red light (114 µmol photons m⁻² s⁻¹) was used to illuminate (a) wild-type and (b) KF cells with no additive (black curve). Then the following inhibitors were added subsequently: 20 µM DCMU (red curve), 300 µM MV and 80 µM DBMIB (green curve) and 80 µM KCN (blue curve). Three biological replicates have been measured and a representative trace for each strain is shown.

Table 1.

Half-time of the P⁺₇₀₀ absorption decay. A single exponential fit was used to determine the half-time of reduction in the absence and presence of different electron transport inhibitors in wild-type and KF cells after 5 s illumination with 114 µmol photons m⁻² s⁻¹ red actinic light. Average values from three biological replicates are presented for each parameter measured with standard error (mean ± s.e.; n = 3).

	t1/2 reduction (s)
	wt	KF	D4D
no addition	0.097 ± 0.004	0.247 ± 0.016	0.090 ± 0.007
+ 20 µM DCMU	0.177 ± 0.022	0.900 ± 0.027	0.193 ± 0.022
+ 80 µM DBMIB	0.677 ± 0.035	0.653 ± 0.020	0.607 ± 0.020
+ 80 µM KCN	0.910 ± 0.044	0.877 ± 0.098	0.847 ± 0.020

To estimate the PTOX activity, different intensities of red actinic light were used (figure 7). When P₇₀₀ oxidation was measured at different light intensities, the difference in the number of available electron donors to was even more visible than in the presence of the different inhibitors. At low light intensity (19 µmol photons m⁻² s⁻¹), 30% of the maximum signal (477 µmol photons m⁻² s⁻¹) was obtained at the end of the illumination in wild-type while 60% was obtained in KF. Furthermore, at 114 µmol photons m⁻² s⁻¹ the transient re-reduction of was seen in the wild-type but was absent in KF. The transient re-reduction reflects electron donation from PSII and/or respiratory and/or cyclic electron flow possibly combined with recombination with reduced PSI acceptors. At the highest intensity used (477 µmol photons m⁻² s⁻¹) this transient re-reduction was also seen in KF. At the lowest light intensity PTOX is able to compete efficiently with electron donation through the cyt b₆f complex to PSI in KF. At the highest light intensity the electron donation through the cyt b₆f complex to PSI outcompeted PTOX since the transient re-reduction is observed. The absolute signal of was larger in KF than in the wild-type.

Figure 7.

absorption kinetics at different light intensities. After short dark incubation, actinic red light was used to illuminate (a) wild-type and (b) KF cells with different light intensities for 10 s: 19 µmol photons m⁻² s⁻¹ (black curve); 114 µmol photons m⁻² s⁻¹ (dark-grey curve) and 477 µmol photons m⁻² s⁻¹ (light grey curve). Three biological replicates have been measured and a representative trace for each strain is shown.

The PTOX activity is also seen after turning off the light (figure 7). After illumination with 19 µmol photons m⁻² s⁻¹ the reduction of was significantly slower in KF than in the wild-type, showing that less electrons are delivered from PQH₂ to PSI. At intermediate light intensity (114 µmol photons m⁻² s⁻¹) the reduction of was much slower in KF indicative for PTOX activity. At the highest intensity, however, reducing equivalents seem to accumulate in the light so that the reduction is even faster than at the lowest intensity in KF. PTOX activity seems not be sufficient at this light intensity to keep the PQ pool oxidized. In the wt the reduction of was slower at the highest light intensity. This may reflect very efficient CO₂ fixation lowering the re-reduction rate by cyclic electron flow.

At intermediate light intensity (114 µmol photons m⁻² s⁻¹) the reduction of was much slower in KF. At this light intensity, the rate of CO₂ fixation is most likely just matching the rate of the NADPH production by the linear electron flow and no excess of reducing equivalents is available to feed back into the chain after the transition from light to dark. At the highest intensity, however, reducing equivalents seem to accumulate in the light so that in KF the reduction is even faster than after illumination with the lowest intensity. The similarity in fast reduction at 19 µmol photons m⁻² s⁻¹ and at 477 µmol photons m⁻² s⁻¹ suggests that the Calvin Benson cycle was not fully activated at 19 µmol photons m⁻² s⁻¹ and that therefore a comparable amount of reducing equivalents accumulated in low light and at 477 µmol photons m⁻² s⁻¹ when assimilation was saturated.

To show whether the ratio of PSI/PSII was changed in KF compared to that of the wild-type and D4D, PSI and PSII activity were measured (table 2). PSI activity was comparable in all strains while PSII activity was decreased in KF in comparison to wild-type and D4D, indicating that KF has a higher PSI/PSII ratio than the other strains. CO₂ fixation and respiration were similar in all strains.

Table 2.

Comparison of electron transport activity between wild-type and KF cells. Photosynthetic activity of the whole chain was measured as O₂-evolution in the light (500 µmol photons m⁻² s⁻¹) without artificial electron acceptors and dark respiration as O₂-consumption with the oxygen electrode. PSII activity was measured on whole cells with DCBQ as electron acceptor. PSI activity was measured on isolated thylakoid membranes with 10 µM DCMU, 30 µM DCPIP, 5 mM ascorbate and 500 µM methylviologen as electron acceptor. Average values from three biological samples are presented for each parameter measured with standard error (mean ± s.e.; n = 3).

	Wt (µmol O2 mg chl−1 h−1)	KF (µmol O2 mg chl−1 h−1)	D4D (µmol O2 mg chl−1 h−1)
PSII activity	288 ± 4	224 ± 15	320 ± 26
PSI activity	326 ± 17	337 ± 9	302 ± 17
CO2 fixation	163 ± 21	161 ± 21	170 ± 21
dark respiration	32 ± 7	27 ± 5	38 ± 10

The induction kinetics with onset of light allow the estimation of the PSI turnover by determining the rate of light-induced charge separation k_i using a first order exponential growth fit (y = y₀+A_e^−ki/t) and the proportion of reduced P₇₀₀ (amplitude difference in presence and absence of all inhibitors). The photosynthetic turnover was determined from the steady state level under continuous illumination at 114 µmol photons m⁻² s⁻¹ (figure 6), where the output flux from PSI should be equal to the input flux due to PSII photochemistry. The output flux of electrons from PSI (flux of PSI = k_i × proportion of reduced P₇₀₀) depends on PSI charge separation rate k_i, which was determined in the presence of DBMIB. Comparing the output fluxes between wild-type and KF allows us to calculate the input flux in both strains. This results in a linear flux of electrons of 11.5 ± 2.3 e⁻ PSI⁻¹ s⁻¹ for wild-type and 3.3 ± 0.4 e⁻ PSI⁻¹ s⁻¹ for KF. Red actinic light above 650 nm, which has been chosen for this experiment, is preferentially exciting photosystem I and not photosystem II. The capacity of PSII electron transport in KF was about 25% less than in wild-type (table 2). Taking into account the lower amount of PSII in KF than in wild-type, the linear flux of electrons is about 7.4 e⁻ PSI⁻¹ s⁻¹ lower in KF than in the wild-type.

To show whether the presence of PTOX modifies the reduction state of the cells, we measured NAD(P)H fluorescence (figure 8). In wild-type, actinic light induced an increase in the fluorescence showing the production of NADPH. Turning off the light, the fluorescence decreased to a lower level than initially observed in the dark and increased during the next two min in the dark to the original level. The transient decrease in fluorescence can be explained by NADPH consumption by CO₂ assimilation. In KF the level of the signal was lower in the dark, increased to a comparable level to the wild-type in the light and, after turning off the light, reached within one min the original dark level. This shows that the NAD(P)H pool was highly oxidized in KF, while it was partially reduced in the wild-type. No sign of a transient fluorescence undershoot was observed in KF as seen for the wild-type. KCN did not change the fluorescence in KF. In the presence of KCN in the wild-type, during the first seconds of illumination, the fluorescence transiently decreased as in the absence of KCN. After turning off the light, the fluorescence dropped to the same level as seen in the absence of KCN before the same high-reduction state of the NAD(P)H pool was reached, as observed prior to illumination. The level of the steady-state fluorescence in the dark was reached faster in the presence of KCN since respiration was inhibited and no NAD(P)H was consumed by the respiratory pathway. In D4D, the NAD(P)H pool was in a more oxidized state than in the wild-type but less oxidized than in KF. After turning off the actinic light, the fluorescence decreased transiently as in the wild-type and reached the same fluorescence level as observed prior to the illumination. In contrast to the wild-type, a small transient overshoot was observed. In the presence of KCN, the NAD(P)H pool in the dark was almost as reduced as in the wild-type.

Figure 8.

Kinetics of NAD(P)H fluorescence. After 6–10 min dark incubation actinic red light (95 µmol photons m⁻² s⁻¹) was switched on for 50 s to illuminate wild-type (a), KF (b) and D4D cells (c) in the absence and presence of 100 µM KCN. The measuring frequency was 100 Hz during dark and was switched to 5000 Hz during illumination with actinic light. The traces were normalized to the value obtained immediately after onset of actinic light. Three biological replicates have been measured and a representative trace (average of 4 measurements) for each strain is shown. Black traces, no addition; grey traces, +100 µM KCN.

4. Discussion

MBP-OsPTOX fusion had been successfully expressed in Synechocystis (figure 2), and PTOX activity was detected by measuring the rise after illumination with actinic light via chlorophyll fluorescence, by absorption and NADPH fluorescence (figures 3 and 6–8). This is, to our knowledge, the first report of a peripheral membrane protein expressed in cyanobacteria. Deleting psbA2 for the expression of a protein did not alter the PSI/PSII ratio and the reduction kinetics, as shown for D4D (tables 1 and 2), however, in D4D the cellular redox state of the cells was slightly different from in the wild-type (figure 8).

According to the literature, in higher plants PTOX may act as a safety valve under abiotic stress conditions and may play an important role in acclimation to harsh environments [7–13]. Overexpressing PTOX in higher plants has either no effect [38] or evoked oxidative stress [14,16]. When PTOX1 from Chlamydomonas reinhardtii was expressed in tobacco, a strong phenotype was observed and plants suffered from starvation [14,15]. OsPTOX expression in Synechocystis did not affect growth under standard growth conditions (light intensities between 50 and 150 µmol photons m⁻² s⁻¹, figure 4). In contrast, overexpression of flv3 using the psbA2 promotor has been shown to improve growth and incorporation of CO₂ into metabolites under standard growth conditions [37]. High levels of Flv3 allow reduction of O₂ at PSI and the generation of a proton gradient and extra ATP, while O₂ reduction by PTOX does not lead to proton pumping through the cyt b₆f complex. This may be the reason why overexpression of PTOX did not stimulate growth under standard conditions. When KF was grown in high light, a bleaching at 625 nm was observed. The same was observed, although to a lower extent, in D4D, indicating a loss of the light harvesting phycobilisomes (figure 5b). Loss of phycobilisomes is described as an acclimation response to nutrient deprivation and may protect against photodamage [39]. In the case of KF, the loss of phycobilisomes is only seen in high light, suggesting that this effect is caused by the high light stress rather than by nutrient starvation [40,41]. The increase in the absorption at 475 nm under high light in all strains reflects an increase in carotenoid content, which is an acclimation strategy of the cells and helps to protect against photo-oxidative stress since carotenoids act as antioxidants [42].

As shown in figures 6 and 7, PTOX efficiently competes with PSI for electrons from the PQ pool. It is generally accepted that PTOX has a low activity compared to photosynthetic electron flow. The maximum rate of PTOX was reported to be 4.5 e⁻ s⁻¹ PSII⁻¹ for PTOX2 in C. reinhardtii [43] and 0.3 e⁻ s⁻¹ PSII⁻¹ in tomato [44]. We calculated here a lowering of the linear flux by 5 e⁻ PSI⁻¹ s⁻¹ in the presence of high amounts of PTOX, which is in the same order of magnitude as has been reported for PTOX2 in C. reinhardtii. In both C. reinhardtii and in Synechocystis, the PSI/PSII ratio is variable and depends on growth conditions [45] so that the published rate of PTOX2 and the one of OsPTOX determined here cannot be easily compared in a quantitative way.

The presence of PTOX affected the cellular redox state as seen by the absence of the KCN effect on the P₇₀₀ signal (figure 6) and, more clearly, by the NAD(P)H fluorescence (figure 8). As shown in figure 6, the maximum P₇₀₀ signal was obtained in the wild-type only in the presence of KCN, while KCN had no effect on KF. In the wild-type a small fraction of accumulated in the dark when the cytochrome c oxidase was active, indicating that a small fraction of reductants were diverted to this enzyme. Inhibition of the cyt c oxidase or the presence of PTOX allowed complete reduction of in the dark. In KF, the NAD(P)H pool was completely oxidized in the dark (figure 8) and KCN had no effect, in accordance with the P₇₀₀ measurements (figure 6). Knockdown mutants of the mitochondrial alternative oxidase (AOX) in the diatom P. tricornutum showed a high reduction state compared to the wild-type [46], in line with the observations made here for KF. In the wild-type, NAD(P)H fluorescence curves show dynamic changes upon light/dark transition, as has been reported previously [47]. In the light, the initial fast rise is followed by a transient decrease. This transient decrease may indicate an onset of NAD(P)H consumption by metabolic pathways. In the presence of KCN this dip was more pronounced, indicating that it may be linked to respiration. At the end of the illumination, a large undershoot is observed before the dark level of fluorescence is re-established both in the presence and absence of KCN. Restoration of the redox state of the NAD(P)H/NAD(P)⁺ pool was faster in the presence of KCN, indicating that this phase reflects an interplay of respiration with glycolysis and the Krebs cycle or the oxidative pentose phosphate cycle.

The presence of high amounts of PTOX changed the PSI/PSII ratio. In KF a higher level of oxidized P₇₀₀ was measured (figure 6) and the PSII activity was lower than in the wild-type (table 2). PTOX seems not only to control the redox state of the PQ pool but also to play a role in signalling. According to the general view in the literature, an oxidized PQ pool is expected to have the opposite effect on the PSI/PSII ratio in higher plants and cyanobacteria [48–50]. In contrast to these reports, however, it has also been shown that the thiol redox state regulates the expression of psbA in Synechococcus PCC 7942. Thiol oxidants prevented the light-induced expression of psbAII/III, while dithiothreitol induced it [51]. The redox state of KF is more oxidized than of wild-type, which may have an impact on the oxidation state of the thioredoxins and other thiol-containing proteins involved in redox regulation. Oxidation of thiols may affect signalling but may also have more direct effects on the assembly of the photosystems. It has been reported recently that a redoxin controls the level of PSI by affecting its assembly [52]. PTOX has been suggested to be an important component of redox sensing in higher plants [53] and this redox sensing may involve the redoxin system. Alternatively, redox signalling via PTOX activity may occur via carotenoid biosynthesis intermediates [54] or by its participation in ROS signalling. PTOX generates superoxide anion radicals in a side reaction depending on substrate availability [31]. Superoxide is dismutated to H₂O₂ and O₂. H₂O₂ sensing involves a PerR orthologue and three histidine kinases in Synechocystis PCC 6803 (for review see [42]). Such signals may increase the expression of PSI and decrease the expression of PSII genes contrary to the still unknown signal related to the redox state of the PQ pool.

Data accessibility

This article has no additional data.

Authors' contribution

K.F., G.A. and A.K.-L. designed the study, carried out the experiments and analyses. A.K.-L. and K.F. drafted the manuscript, and all authors contributed to writing the final version of the paper. All authors gave final approval for publication.

Competing interests

We have no competing interests.

Funding

K.F. was supported by the Agence Nationale de la Recherche, ANR-CYPHER. G.A. and A.K.-L. were supported by the CNRS.