ATM supports gammaherpesvirus replication by attenuating type I interferon pathway

Abstract

Ataxia-Telangiectasia mutated (ATM) kinase participates in multiple networks, including DNA damage response, oxidative stress, and mitophagy. ATM also supports replication of diverse DNA and RNA viruses. Gammaherpesviruses are prevalent cancer-associated viruses that benefit from ATM expression during replication. This proviral role of ATM had been ascribed to its signaling within the DNA damage response network; other functions of ATM have not been considered. In this study increased type I interferon (IFN) responses were observed in ATM deficient gammaherpesvirus-infected macrophages. Using a mouse model that combines ATM and type I IFN receptor deficiencies we show that increased type I IFN response in the absence of ATM fully accounts for the proviral role of ATM during gammaherpesvirus replication. Further, increased type I IFN response rendered ATM deficient macrophages more susceptible to antiviral effects of type II IFN. This study identifies attenuation of type I IFN responses as the primary mechanism underlying proviral function of ATM during gammaherpesvirus infection.

Introduction

Ataxia-Telangiectasia Mutated (ATM) protein kinase was first identified as the primary genetic lesion in Ataxia-Telangiectasia patients (Savitsky, Bar-Shira et al., 1995). Since the original discovery that placed this kinase within the host DNA damage response network, ATM has been recognized as a key player in several additional cellular signaling networks that include oxidative stress, metabolism, angiogenesis, and mitophagy (reviewed in (Guleria & Chandna, 2016)). Intriguingly, this kinase also supports replication of multiple diverse DNA and RNA viruses, including but not limited to human and mouse gammaherpesviruses (Hagemeier, Barlow et al., 2012; Singh, Dutta et al., 2013; Tarakanova, Leung-Pineda et al., 2007), alpha- and beta herpesviruses (E X, Pickering et al., 2011; Alekseev, Donovan et al., 2014), papilloma- and polyomaviruses (Moody & Laimins, 2009; Tsang, Wang et al., 2014; Jiang, Zhao et al., 2012), adenovirus (Shah & O’Shea, 2015), HCV (Ariumi, Kuroki et al., 2008), and HIV (Lau, Swinbank et al., 2005). The functions of ATM in the DNA damage response have traditionally been assumed as the mechanism underlying the proviral activity of this kinase. However, ATM has recently emerged as a highly pleiotropic kinase and it is not clear whether ATM roles outside of response to DNA breaks contribute to its proviral phenotype.

This study focuses on the role of ATM during gammaherpesvirus infection. Gammaherpesviruses infect a majority of adult population worldwide and are associated with a variety of cancers, including lymphoproliferative disease and lymphomas (Cesarman, 2014). These viruses can execute two distinct life cycles: latency and lytic replication. The switch from latent to lytic life cycle in the context of chronic infection increases the risk of virus-driven cancer (Campbell, Borok et al., 2000; Meerbach, Wutzler et al., 2008; Feng, Cohen et al., 2004; Orlandi, Paulli et al., 2001). Thus, host factors that regulate viral lytic cycle, including during chronic infection, are likely to also play a role in either restricting or promoting viral lymphomagenesis. ATM facilitates replication, reactivation, and the establishment of latency of both mouse and human gammaherpesviruses (Hagemeier, Barlow et al., 2012; Kulinski, Darrah et al., 2015a; Singh, Dutta et al., 2013; Tarakanova, Leung-Pineda et al., 2007). In the search for potential proviral mechanisms of ATM during gammaherpesvirus infection, we turned to reports that noted increased expression of interferon stimulated genes in cells from Ataxia-Telangiectasia patients (Siddoo-Atwal, Haas et al., 1996; Wood, Sankar et al., 2011). In our previous studies, we have also observed increased baseline expression of interferon stimulated genes in primary macrophages derived from ATM deficient mice (Mboko et al., 2012). Finally, ATM was recently shown to rely on STING expression in order to attenuate type I interferon (IFN) signaling (Hartlova, Erttmann et al., 2015). In this study we show that type I IFN signaling was also increased in ATM deficient primary macrophages infected with mouse gammaherpesvirus 68 (MHV68). Importantly, this increased type I IFN signaling was primarily responsible for the attenuation of MHV68 replication in the absence of ATM, indicating that the role of ATM in the DNA damage response is minimal if not dispensable for the support of gammaherpesvirus replication. Increased type I IFN signaling in ATM deficient cells was not a consequence of increased activity of endogenous retroviruses. Further, expression of negative IFN regulators was not attenuated in ATM deficient macrophages. Instead, increased type I IFN signaling in the absence of ATM facilitated antiviral effects of type II IFN.

Materials and Methods

Ethics statement

All experimental manipulations of mice were approved by the Institutional Animal Care and Use Committee of the Medical College of Wisconsin (AUA971). All animal experiments adhered to the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and the American Veterinary Medical Association Guidelines on Euthanasia.

Animals and primary cell cultures

All mouse strains used in this study were maintained at the MCW animal facility. C57BL/6J (referred to as BL6) and ATM^−/− mice fully backcrossed on the C57BL/6J genetic background were originally purchased from Jackson Laboratories (Bar Harbor, ME). IFNAR1^−/− mice on the C57BL/6 genetic background were a gift from Dr. Mitchell Grayson (Grayson, Cheung et al., 2007). ATM and IFNAR1 deficiency was combined and double deficient mice produced via crosses of ATM^+/−IFNAR1^−/− parents. Bone marrow was harvested from mice between 3 and 10 weeks of age. Primary bone marrow derived macrophages were generated as previously described (Tarakanova, Leung-Pineda et al., 2007).

qRT-PCR analysis

Total RNA was harvested, DNAse treated, reverse-transcribed, and analyzed by qRT-PCR (Mboko, Mounce et al., 2014). Analysis was performed using previously published primers (Mboko et al., 2014; Mboko et al., 2012; Mboko et al., 2016) or primers shown in Table 1. All primers used in this study were validated for sensitivity and specificity using both bioinformatic and wet lab approaches; the slope and linear range was established for each primer pair, all measurements were confined to the linear range of the particular primer pair, and minus RT controls were tested for each experimental sample.

Table 1.

Primer sequences

Primer name	Forward (5′-3′)	Reverse (5′-3′)
SOCS1	GTTGTGGAGGGTGAGATG	CAGACACAAGCTGCTACA
PIAS1	AGAAGGACCGGTAGGTATTA	CCACGCTGTCATGTGAA
NLRX1	CCTCTGATTGTGTTTGCTATG	CATCGATCCTGTGCATTTG
USP18	CGGAAGGCTTGGTCTTTA	AGGAGAGAGATCCCATGAA
RT assay primers	RT1: CATAGGTCAAACCTCCTAGGAATG	RT2: TCCTGCTCAACTTCCTGTCGAG
xMLV	TCTATGGTACCTGGGGCTC	GGCAGAGGTATGGTTGGAGTAG
mMERVK	CAAATAGCCCTACCATATGTCAG	GTATACTTTCTTCTTCAGGTCCAC

Viral Stock Preparation and Infections

Wild type MHV68 viral stocks were prepared and titered on NIH 3T12 cells (Tarakanova, Leung-Pineda et al., 2007). Bone marrow derived macrophages were infected with MHV68 at indicated multiplicity of infection (MOI) for 1 hour to allow for adsorption, and washed three times with PBS prior to medium replenishment. To measure antiviral activity of IFNγ, macrophages were mock-treated or pretreated with recombinant IFNγ (Biolegend, San Diego, CA) for 16 hours, infected with MHV68, and the same IFNγ concentration was reconstituted in the culture medium at 1 h post infection for the duration of the experiment. For IFN signaling experiments, macrophages were mock-treated or infected with MHV68, IFNγ was added after virus adsorption, and RNA harvested 8 hours later.

Reverse Transcriptase Activity Assay

Total cell lysates were harvested in lysis buffer containing 0.5% triton X-100 and protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO). Samples were freeze thawed (−80°C), centrifuged, and supernatants subjected to the reverse transcription assay. The assay, in addition to precleared cell lysate (source of RT activity), contained 0.067 mg/mL MS2 phage RNA (US Biological Life Sciences, Salem, MA) to serve as an RT template, RT1 primer specific for phage RNA sequence (Table 1), 2.67 U/μL RNAseOUT^™ (Thermo Fisher, Waltham, MA) and 50μg/mL salmon sperm DNA (Sigma-Aldrich, St. Louis, MO) to attenuate endogenous nuclease activity of the macrophage lysates. MS2 phage RNA and RT1 primer were pre-mixed separately and heated at 60°C for 2 minutes to denature RNA secondary structures and allow for primer binding before adding the remaining reagents. Reverse transcription was allowed to proceed for 45 minutes at 42°C. The RT assay was performed in duplicate for each cell lysate, one of these duplicate reactions was spiked with excess (20mU/reaction) of recombinant M-MLV reverse transcriptase (Thermo Fisher, Waltham, MA) to control for the residual activity of endogenous nucleases in individual cell lysates. Following reverse transcription reaction, samples and standards were analyzed by real time PCR using RT1 and RT2 primers (Table 1). Endogenous RT activity was calculated using a standard curve (recombinant M-MLV RT-based) that was generated for each run. Individual endogenous RT activity was further corrected based on the level of inhibition of spiked RT activity observed for each sample. RT activity was subsequently normalized to protein concentration in each sample.

Statistical analysis

Data were analyzed using GraphPad Prism software (GraphPad Software, San Diego, CA). All p values were calculated using Student’s t-test.

Results

MHV68 infection induces higher levels of interferon stimulated gene expression in ATM^−/− primary macrophages

We have previously reported that ATM facilitates MHV68 replication in primary macrophages (Tarakanova, Leung-Pineda et al., 2007), a physiologically relevant immune cell type (Rekow, Darrah et al., 2016; Weck, Kim et al., 1999). This proviral role of ATM is most obvious under conditions of low multiplicity of infection (MOI) (Fig. 1A) (Tarakanova, Leung-Pineda et al., 2007). ATM is a pleiotropic kinase that participates in diverse cellular signaling networks, making identification of the proviral mechanism challenging. Considering ATM involvement in the type I IFN signaling network (Siddoo-Atwal, Haas et al., 1996; Wood, Sankar et al., 2011), and the broad antiviral activity of type I IFN, including during MHV68 infection of primary macrophages (Wood, Mboko et al., 2013a), we examined expression of USP18, an interferon stimulated gene, in BL6 and ATM^−/− primary macrophages. Because MHV68-infected primary macrophages do not induce type II IFN expression in vitro (Goodwin, Canny et al., 2010a), levels of USP18 were used as a readout of type I IFN activity.

Figure 1. The ability of ATM to suppress type I IFN pathway is critical for the proviral role of ATM during gammaherpesvirus replication in primary macrophages.

Primary bone marrow derived macrophages from mice with indicated genotypes were mock-infected or infected at indicated multiplicities of infection (MOI) with MHV68. (A, F). Viral titers were determined at select times post infection. Data for BL6 and ATM^−/− conditions in panel F is the same as in panel A. (B–E). Total RNA was isolated at indicated hours post infection and expression of indicated interferon stimulated genes and GAPDH measured by qRT-PCR. Data are representative of 2–4 independent experiments. *p<0.05.

Under low MOI conditions that are particularly relevant for the proviral activity of ATM, MHV68 infection of BL6 macrophages induced ~25-fold increase in USP18 mRNA levels at 8 hours post infection (Fig. 1B). These elevated USP18 mRNA levels returned to baseline by 24 hours of infection, well before the completion of the MHV68 replication cycle in these cells (~48 hours under the low MOI conditions). In contrast, MHV68 infection of ATM^−/− macrophages resulted in ~115-fold higher levels of USP18 mRNA at 8 hours post infection (as compared to levels observed in mock-infected BL6 macrophages) and these mRNA levels remained elevated at 24 and 48 hours post infection (Fig. 1B). As expected, elevated USP18 expression was also observed in mock-treated ATM^−/− macrophages. Similarly, elevated levels of expression were observed for two additional interferon stimulated genes in ATM deficient macrophages (Mx-1 and IFIH, Figure 1C, D).

A 100-fold increase in the MHV68 inoculum (MOI=1) resulted in a higher induction of USP18 expression in BL6 macrophages as compared to mock-treated cultures (150-fold, 8 hours, Fig. 1E). This robust expression of USP18 in BL6 macrophages was further increased in MHV68-infected ATM^−/− macrophages, where USP18 mRNA levels were ~280-fold at 8 hours post infection as compared to those observed in mock-infected BL6 macrophages (Fig. 1E). Thus, ATM deficiency of MHV68-infected primary macrophages resulted in a significant increase of interferon stimulated gene expression, particularly under conditions of low MOI when the antiviral role of ATM is more pronounced.

The ability of ATM to suppress type I IFN pathway is critical for the proviral role of ATM during gammaherpesvirus replication

MHV68 infection induces type I but not type II IFN expression and signaling in vitro (Fig. 1B, C, (Goodwin, Canny et al., 2010a; Wood, Mboko et al., 2013b)). Further, this antiviral network suppresses MHV68 replication, in spite of multiple viral mechanisms to counter type I IFN (Hwang, Kim et al., 2009; Liang, Shin et al., 2004; Kang, Cheong et al., 2014; Zhao, Liang et al., 2015; Wu, Li et al., 2015). In addition to regulation of type I IFN, ATM is involved in multiple additional cellular networks that could be relevant for MHV68 replication. In order to specifically assess whether ATM-mediated attenuation of type I IFN signaling facilitates MHV68 replication, we generated mice with combined deficiency of ATM and type I IFN receptor (ATM^−/−IFNAR^−/−) and examined MHV68 replication in macrophages derived from these or control IFNAR^−/− mice. As expected, MHV68 replicated about 50–100-fold higher in macrophages with a single IFNAR deficiency as compared to BL6 controls. Intriguingly, ATM deficiency had no further effect on MHV68 replication in macrophages that also lacked type I IFN receptor (Fig. 1F), indicating that increased type I IFN signaling is primarily responsible for the attenuation of MHV68 replication in ATM deficient macrophages.

ATM does not regulate endogenous reverse transcription activity in primary macrophages

In a recent report, increased levels of short single stranded DNA fragments (100–500 bp) were observed in the cytoplasm of ATM deficient macrophages; this cytosolic DNA was postulated to trigger type I IFN expression and signaling via the STING pathway (Hartlova, Erttmann et al., 2015). The source of this cytoplasmic DNA remains unclear, but has been suggested to be of nuclear DNA origin due to the role of ATM in repair of double stranded DNA breaks. While ATM is critical for the repair of double stranded DNA breaks in the context of heterochromatin, it is dispensable for the efficient repair of double stranded DNA breaks occuring in euchromatin (Goodarzi, Noon et al., 2008). Because a majority of double stranded DNA breaks induced by diverse agents are found in euchromatin (75–90% of all breaks) and are efficiently repaired in the absence of ATM (Goodarzi, Noon et al., 2008), it is unlikely that the large segments of heterochromatinized DNA that may be present in ATM deficient nuclei would transverse nuclear pores and present as short fragments of ssDNA in the cytoplasm.

Considering the unlikely transport of large pieces of heterochromatin into the cytoplasm, we wanted to test a hypothesis that the small ssDNA fragments observed in the cytoplasm of ATM^−/− macrophages may be generated via the enzymatic activity of reverse transcriptase (RT)-encoding endogenous retroviruses (ERVs). ERVs constitute 8% and 10% of human and mouse genomes, respectively (Waterston, Lindblad-Toh et al., 2002; Lander, Linton et al., 2001) and are remnants of ancient retrovirus infection of the germline. Importantly, some of these elements encode a functional RT and increased expression of endogenous retroviruses is observed in several conditions, including cancer and virus infections (Argaw-Denboba, Balestrieri et al., 2017; Johanning, Malouf et al., 2017; Assinger, Yaiw et al., 2013; Mangeney, Pothlichet et al., 2005; Gonzalez-Cao, Iduma et al., 2016). Increased expression of functional RT encoded by ERVs and subsequent generation of single stranded DNA could account for the cytoplasmic DNA observed in ATM deficient conditions. Thus, we examined the effects of ATM expression and MHV68 infection on the endogenous RT activity in primary macrophages.

A low but detectable endogenous RT activity was present in mock-infected primary macrophages (~ 7×10⁻⁶ RT units/microgram of protein, Fig. 2A). This endogenous RT activity was not significantly affected by either ATM expression or MHV68 infection (Fig. 2A). xMLV, a class-I gamma-like ERV, and mMERVK, a Class-II beta-like ERV, are two distinct ERVs present in multiple proviral loci in the BL6 genome. Both presumably experienced recent integration events and encode a functional RT (Kozak, 2015; Fasching, Kapopoulou et al., 2015; Jern, Sperber et al., 2005). Using consensus primers designed to detect transcription from multiple (20–100, (Fasching, Kapopoulou et al., 2015; Yoshinobu, Baudino et al., 2009)) insertion sites for each ERV, expression of these two families was examined by qRT-PCR. Consistent with the results of the RT activity assays (Fig. 2A), neither ATM expression nor MHV68 infection significantly altered expression of these endogenous viruses (Fig. 2B, C). Of note, based on the baseline values (no RT controls), baseline expression of xMLV ERVs was considerably higher than that of mMERVK ERVs in primary macrophages. In summary, increased expression and RT activity of endogenous retroviruses is unlikely to account for the presence of immunostimulatory cytoplasmic DNA and increased type I IFN responses in ATM deficient macrophages.

Figure 2. ATM does not regulate endogenous reverse transcription activity in primary macrophages.

Primary bone marrow derived macrophages were infected as in Fig. 1; MOI of 0.01 was used in all experiments. (A). Macrophage cell lysates were harvested at 24 h post infection and endogenous reverse transcriptase was measured as described in the methods. Data were pooled from two independent experiment with two biological replicates within each experiment. (B, C). Total RNA was harvested at indicated time post infection and RNA levels of indicated endogenous retroviruses (ERV) measured by qRT-PCR using consensus primers designed to recognize and amplify most of the loci for each ERV type. Additional controls included cDNA reactions where RT was omitted (no RT). Data are representative of 2–3 independent experiments.

ATM does not affect expression of negative regulators of type I IFN

Due to the toxic nature of prolonged type I IFN signaling, a number of known negative cellular regulators limit type I IFN expression and signal transduction. Some of these negative regulators are expressed constitutively, whereas others, such as SOCS family and USP18, are induced by IFN signaling to mediate a negative feedback loop. Because ATM is involved in the regulation of global cellular gene expression, we wanted to determine whether the expression of type I IFN “brakes” was also altered in the absence of ATM. Specifically, the focus was placed on three negative IFN regulators that have been shown to be relevant in the context of herpesvirus and other viral infections. SOCS1 is an IFN-inducible Jak kinase inhibitor that suppresses both type I and type II IFN signaling in the context of multiple virus infections (Kundu, Dutta et al., 2013; Shao, Zhang et al., 2013; Charoenthongtrakul, Zhou et al., 2011; Frey, Ahmed et al., 2009). PIAS1 is a SUMO ligase that facilitates viral replication by inhibiting activated Stat1 and IRF-3; it may have additional proviral roles during EBV and HCMV replication (Chang, Lee et al., 2004; Liu, Mink et al., 2004; Lee, Kang et al., 2003; Li, Pan et al., 2013). NLRX1 is a negative regulator that associates with STING to suppress type I IFN expression, including during HSV infection (Guo, Konig et al., 2016).

Consistent with SOCS1 being an interferon stimulated gene, SOCS1 mRNA levels were increased in infected macrophages, with a larger increase observed in ATM^−/− macrophages at 8 and 24 hours post infection (Fig. 3A). PIAS1 mRNA levels were not significantly altered by MHV68 infection and were not decreased in ATM^−/− macrophages (Fig. 3B). Similarly, mRNA levels of NLRX1 were not decreased in ATM^−/− macrophages, regardless of the infection status (Fig. 3C). Thus ATM did not facilitate expression of negative regulators of type I IFN signaling during gammaherpesvirus infection.

Figure 3. ATM does not affect expression of negative regulators of type I IFN.

Primary macrophages were infected as in Figure 1; MOI of 0.01 was used for all studies. Total RNA was isolated at indicated times post infection and mRNA levels of SOCS1 (A), PIAS1 (B), and NLRX1 (C) were measured by qRT-PCR and normalized to corresponding levels of GAPDH. Data are representative of 2–3 independent experiments.

ATM^−/− macrophages are more sensitive to the antiviral effects of type II IFN

While MHV68 infection of cultured primary macrophages fails to induce detectable expression of IFNγ, macrophage cultures remain highly sensitive to type II IFN and effectively restrict MHV68 replication following addition of exogenous IFNγ (Goodwin, Canny et al., 2010b). Not surprisingly, IFNγ is a critical antiviral factor that also controls MHV68 infection in vivo (Lee, Cool et al., 2009; Lee, Groshong et al., 2009; Steed, Barton et al., 2006; Steed, Buch et al., 2007; Tibbetts, Van Dyk et al., 2002). We have recently shown that IFNγ-mediated restriction of MHV68 replication was attenuated in macrophages lacking type I IFN receptor (Mboko, Rekow et al., 2016). Our published observation in the MHV68 system is consistent with other publications that demonstrated decreased expression of Stat1 in type I IFN deficient cells and constitutive association between IFNAR1 and IFNGR2, indicating an intimate crosstalk between type I and type II IFN signaling networks (Gough, Messina et al., 2010; Takaoka, Mitani et al., 2000). Having observed increased type I IFN signaling in MHV68-infected ATM^−/− macrophages (Fig. 1), we next tested the extent to which antiviral activity of IFNγ was altered in the absence of ATM.

Primary macrophages were pretreated with low concentration of IFNγ overnight (0.1U/ml), infected with MHV68, and the same concentration of IFNγ added to the infected cells immediately post virus adsorption (Fig. 4A). IFNγ treatment of BL6 macrophages suppressed MHV68 replication for the first 2 days of infection: however, viral replication resumed by 3 days post infection (Fig. 4B). In contrast, IFNγ treatment of ATM^−/− macrophages suppressed MHV68 replication throughout the entire 5 days of the assay, in spite of continuous MHV68 replication in control ATM^−/− cultures (Fig. 4B). Thus, ATM deficiency increased sensitivity of MHV68-infected macrophages to antiviral effects of IFNγ.

Figure 4. ATM^−/− macrophages are more sensitive to the antiviral effects of type II IFN.

Primary macrophages were isolated from mice with indicated genotypes. (A) Macrophage cultures were mock-treated or treated for 16 hours with 0.1U/ml of recombinant IFNγ. Immediately following MHV68 infection (MOI 0.01), IFNγ (0.1U/ml) was added to the cultures for the remainder of the experiment. (B, C) Viral titers were measured at indicated time points. Data are representative of 2–4 independent experiments. Dashed line in C indicates baseline: viral titers on Day 0 of infection.

To determine the extent to which this increased sensitivity to antiviral effects of IFNγ was due to increased type I IFN signaling, IFNAR^−/− or ATM^−/− x IFNAR^−/− macrophages were treated and infected as in Fig. 4A and viral titers measured at 72h post infection. IFNγ treatment attenuated MHV68 replication in IFNAR^−/− macrophages, albeit not to the same extent as that observed in type I IFN competent cultures, as we previously reported (Mboko et al., 2016). Specifically, ~50-fold increase of MHV68 titers above baseline was readily observed at 72 hours post infection of IFNγ-treated IFNAR deficient cells (Fig. 4C), as compared to a ~3-fold increase in viral replication observed in IFNγ-treated BL6 macrophages at the same time point. Importantly, MHV68 titers were similarly suppressed in IFNγ-treated IFNAR^−/− and ATM^−/−xIFNAR^−/− macrophages (Fig. 4C), indicating that the increased sensitivity of ATM^−/− macrophages to the antiviral effects of IFNγ was primarily due to the increased type I IFN signaling.

IFNγ stimulation results in higher expression of antiviral genes in ATM^−/− macrophages

Having observed increased antiviral activity of IFNγ in ATM^−/− macrophages (Fig. 4), we wanted to determine the extent to which IFN-induced gene expression is altered in the absence of ATM. We focused on MNDA and IFIH, interferon induced genes that can suppress MHV68 replication in vitro (Liu, Sanchez et al., 2012). In these studies macrophages were treated with IFNγ, infected with MHV68, or treated with IFNγ immediately following MHV68 adsorption; gene expression was analyzed at 8 hours post infection/treatment (Fig. 5A). Baseline MNDA mRNA levels were increased in ATM^−/− macrophages as compared to BL6 controls, and these mRNA levels remained higher in the absence of ATM, especially in MHV68-infected conditions (Fig. 5B). While IFIH mRNA levels were similar in untreated ATM^−/− and BL6 macrophages, all experimental treatments induced a higher level of IFIH mRNA in ATM^−/− cultures (Fig. 5C).

Figure 5. Type I IFN signaling is required for higher expression of antiviral genes in IFNγ-treated ATM^−/− macrophages.

(A) Primary macrophages derived from mice of indicated genotypes were mock-treated, treated with IFNγ (10U/ml), infected with MHV68 (MOI=5) or infected with MHV68 and treated with IFNγ immediately post viral adsorption. (B–D). Total RNA was harvested at 8 hours post treatment and subjected to qRT-PCR to measure mRNA levels of MNDA and IFIH. Data are representative of 2–4 independent experiments. *p<0.05.

To determine the extent to which type I IFN contributed to the increased expression of antiviral genes in IFNγ-treated ATM^−/− cells, induction of MNDA was examined in IFNAR^−/− and ATM^−/−xIFNAR^−/− macrophages treated as in Fig. 5A. MNDA was induced by IFNγ treatment alone or in combination with MHV68 infection (Fig. 5D). However, mRNA levels of MNDA were similar in IFNAR^−/− and ATM^−/−xIFNAR^−/− macrophages regardless of the experimental condition. Thus, increased type I IFN signaling in ATM^−/− macrophages cooperated with exogenous IFNγ to increase expression of antiviral interferon stimulated genes in IFNγ-treated cells.

Discussion

In this study we show that the proviral role of ATM is primarily enacted by the ability of this kinase to attenuate the activity of type I IFN, at least in the context of gammaherpesvirus replication in primary macrophages. Because type I IFN exerts global antiviral effects, it is likely that the ability of ATM to attenuate type I IFN response also plays a role in facilitating replication of other diverse viruses that have been shown to benefit from ATM expression. While our results rule out the role of ATM in DNA damage response and repair as a mechanism for its proviral activity, other members of the DNA damage response may indeed be involved in the regulation of viral replication independent of type I IFN. In fact, expression of interferon stimulated genes is the same or even lower in macrophages lacking DNA damage response proteins H2AX or a functional Nbs1, supporting the idea that other members of the DNA damage response network may regulate viral replication in an IFN-independent manner (Mboko et al., 2012). Importantly, a better understanding of the mechanism by which type I IFN restricts gammaherpesvirus replication will also identify how ATM executes its proviral role.

How does ATM deficiency lead to the increased type I IFN signaling?

While increased expression of interferon stimulated genes was previously observed in cells from A-T patients (Siddoo-Atwal, Haas et al., 1996; Wood, Sankar et al., 2011) and in ATM^−/− primary macrophages (Mboko et al., 2012), a recent report identified STING as a critical factor for increased type I IFN signaling in ATM deficient conditions (Hartlova, Erttmann et al., 2015). STING is an ER-associated protein that integrates signaling downstream of several cytoplasmic DNA sensors to activate TBK1, with subsequent activation of IRF-3 and expression of type I IFN (reviewed in (Chen, Sun et al., 2016)). Intriguingly, ATM deficient macrophages were shown to accumulate short ssDNA fragments in their cytoplasm, a likely stimulus of the STING-dependent IFN expression (Hartlova, Erttmann et al., 2015). The source of such DNA fragments remains unclear.

Because ATM is exclusively involved in the repair of heterochromatin-associated DNA lesions (Goodarzi, Noon et al., 2008), large heterochromatinized fragments of DNA persisting in the nuclei of ATM deficient cells would not be able to physically exit the nucleus, especially in non-diving, terminally differentiated cells, such as primary macrophages. Thus, it is unlikely that the classical function of ATM in the DNA damage repair is responsible for the generation of short cytoplasmic DNA fragments in the cytoplasm of ATM^−/− macrophages. We have tested the possibility that differential expression of RT encoded by ERVs could contribute to the generation of short cytoplasmic ssDNA fragments. However, endogenous RT activity and expression of abundant, RT-encoding ERV families were not affected by ATM deficiency, ruling out this initially attractive hypothesis. We have also tested the hypothesis that differential expression of negative regulators of type I IFN expression and signaling, so called “IFN brakes”, could lead to higher type I IFN responses in the absence of ATM. However, expression of these negative IFN regulators was not attenuated in ATM^−/− macrophages, at least at the mRNA level.

An alternative process that could explain the accumulation of cytoplasmic DNA fragments stems from the role of ATM in mitophagy. Mitophagy is a specialized type of autophagy that is responsible for clearing and recycling damaged mitochondria. ATM is a positive regulator of mitophagy (Valentin-Vega, Maclean et al., 2012). Decreased clearance of damaged mitochondria in ATM deficient cells could lead to the release of mitochondrial DNA that would trigger the STING-dependent type I IFN expression. Future studies should define the origin of stimuli that trigger STING-mediated IFN expression in ATM deficient cells and determine the extent to which damaged mitochondria contribute to such phenotype.

Proviral mechanisms of ATM in vivo

ATM was initially discovered as the genetic lesion in human A-T patients. Remarkably, in spite of decreased T and B cell numbers in many (but not all) A-T humans and decreased responsiveness to immunization, these patients do not exhibit increased susceptibility to acute viral infections (Nowak-Wegrzyn, Crawford et al., 2004). Similarly, ATM^−/− mice clear acute LCMV infection with the same kinetics as wild type mice (D’Souza, Parish et al., 2011). It is tempting to speculate that increased type I IFN responses cooperate with type II IFN to restrict viral replication in A-T patients, compensating for the suboptimal adaptive immune system of these patients and facilitating effective clearance of the acute viral infection.

In contrast to what we and others observed in vitro, where ATM supports replication of herpesviruses and papillomaviruses, these chronic virus infections are poorly controlled in A-T patients and mice with global ATM deficiency (Folgori, Scarselli et al., 2010; Lankisch, Adler et al., 2013; Masucci, Berkel et al., 1984; Morio, Takahashi et al., 2009; Nowak-Wegrzyn, Crawford et al., 2004; Saemundsen, Berkel et al., 1981; Ben-Zvi, Soffer et al., 1978). This apparent dichotomy suggests that ATM is also responsible for the aspects of infected cell-extrinsic responses that are selectively required to control chronic virus infections. In support of such idea, we have shown that cell type-specific depletion of ATM in myeloid cells, a cell type that supports MHV68 latency in vivo, attenuates parameters of chronic MHV68 infection (Kulinski, Darrah et al., 2015b). Ongoing studies in our and other groups aim to define such infected cell-extrinsic immune mechanisms of ATM that are critical for the control of chronic virus infections. In summary, ATM is emerging as an important regulator of diverse antiviral immune responses, a role that likely extends beyond gammaherpesvirus infection.

Highlights.

• ATM kinase supports replication of diverse RNA and DNA viruses, including gammaherpesviruses

• ATM attenuates type I IFN signaling at baseline and during gammaherpesvirus infection

• Attenuation of type I IFN response fully accounts for the proviral activity of ATM during gammaherpesvirus replication