Abstracts of the 21th Annual Congress of the SBRA, São Paulo/SP, 02-5 August 2017

doi:10.5935/1518-0557.20170050

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-01. Guar gum improves human semen quality after crio-preservation

FG Valverde ¹, CS Souza Neto ¹, SMR Jacinto-Costa ¹, E Caldas ², GHC Silveira ², RLC Albuquerque Júnior ¹, FF Padilha ¹, IB Lima-Verde ¹

Abstract

Objective

This work aimed to evaluate the guar gum (GG) effect in cryoprotectant medium on human cryopreserved spermatozoa.

Methods

This study was done in an assisted human reproduction clinic, in association with the Tiradentes University and the Institute of Technology and Research (Aracaju/SE - Brazil). All patients who met the inclusion criteria, voluntarily, signed a consent form and were invited to participate in the research, by clarifying the terms and agreeing with the procedures to be carried out. We selected 30 normal seminal samples, collected and analyzed from July to October 2015. The samples were divided into the following groups: (I): TYB^® (Test Yolk Buffer); (II) GEYC (Glycerol Egg-Yolk Citrate); (III) GEYC containing 0,07% GG and (IV) GEYC containing 0,1% GG. After a minimum of 48 hours the samples were thawed and analysed, with fluorescent probes, the mitochondrial activity and the integrity of the plasma and acrosomal membranes of the sperm cells after the cryopreservation process. ANOVA and Tukey test were used and the of the data was performed using the statistical software GraphPad Prisma 5.0. The values were expressed as mean and standard error. Values of P<0.05 were considered statistically significant.

Results

The use of GG in groups III (85.67±2.69%) and IV (89.27±1.96%), showed plasma membrane integrity results significantly higher (P<0.05) than the control groups I (54.97±6.79%) and II (52.33±7.06%). The same was observed (P<0.05) regarding the integrity of the acrosomal membrane when groups III (87.12±2.45%) and IV (90.58±1.52%) were compared with the control groups I (54.97±6.79%) and II (52.33±7.08%). In relation to mitochondrial activity, the use of GG in groups III (10.50±1.77%) and IV (8.83±1.71%) showed similar results (P>0.05) to the control groups I (12.27±1.66%) and II (10.83±1.65%).

Conclusion

The addition of GG to GEYC improved the results of plasma membrane integrity and acrossome integrity in all cryopreserved samples. These results suggest that GG has a better cryoprotective potential when compared to TYB^® and GEYC used alone. In this way, this gum presents itself as a promising cryoprotectant agent, however, further studies are still needed to confirm the use of this polysaccharide in the cryopreservation oh human spermatozoa.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-02. Administration of ovulation inducing medication by the nursing team in an assisted reproduction center of SUS: lived experience report

JF Aderaldo ¹, EJPB Nobrega ^1,², KRN Barbosa ¹, MCGP Coelho ², KM Morais ^1,², MMGT Torres ², ALB Sant'Anna ¹, MQLMM Paiva ¹, PCS Vieira ¹, LCA Silva ¹, CL Freitas ², ARG Aquino ²

Abstract

Objective

To report nursing team's conduct and care since the medication storage to the administration of ovulation inducing medication in a public Assisted Reproduction Center.

Method

Nursing team's lived experience (employees and health multidisciplinary residence program students) between December 2013 and May 2017, in a reference high-risk newborn care public maternity school, where the center operates. The sector was inaugurated in March, 2013 and it is considered a reference service in the North and Northeast regions of Brazil. It is the only center in the country that offers medical service, medications and medication administration exclusively by the National Health Service (SUS).

Results

Among the nursing care directed to patient assistance in the assisted reproduction center are the nursing consultation, the storage and the administration of medication. The consultation is made by a nurse, aiming at clarifying patients about the treatment, medication used in the treatment, side effects and clear patient's doubts. Besides, there is the nursing follow up during preparation and administration of medication. These conducts corroborate to the treatments efficiency, as well as to the patient safety. It is important to highlight that the pharmacological treatment is fully provided by the National Health System (SUS).

Conclusion

The nursing follow-up in drug treatment favors the detection of adverse reactions, assures the administration of prescription drugs, appropriate dosage and correct handling and storage, consequently increasing the chances of a favorable outcome.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-03. Are respiratory allergies related to male fertility?

DG Reis ^1,^2,^3,⁴, JR Pariz ^1,^2,^3,⁴, VS Coutinho ^1,^2,^3,⁴, RAC Monteiro ^1,^2,³, J Hallak ^1,^2,³

Abstract

Objective

To evaluate the effect of respiratory allergies, rhinitis and sinusitis on sperm quality, sperm functional parameters and hormonal profile.

Methods

Medical records of 432 patients (22 to 69 y.o.), between 2000 and 2016, in which anamnesis revealed clinical data and self-report of respiratory allergies, sinusitis and rhinitis, were correlated with semen analyzes, sperm functional tests and sex hormones profile. The Pearson's correlation coefficient test (P<0.05) was used to evaluate the correlations between the study data.

Results

We observed a negative correlation between respiratory allergies and progressive motility (-0.124, P=0.010), total motility (-0.147, P=0.002), grade A motility (-0,129, P=0.008), sperm vitality (-0.956; P<0.001) and LH hormone (-0.475; P=0.046); and positive correlation with immotile spermatozoa (0.136, P=0.005) and T4 hormone (-0.576, P=0.005). When evaluating sinusitis, there was a negative correlation with normal morphology sperm (-0.106, P=0.033), sperm vitality (-0.956, P=< 0.001), sperm creatine kinase activity (-1,000, P=0.019), LH hormone (-0.455, P=0.058) and TSH (-0.733, P=0.025); and positive correlation with spermatozoa with abnormal sperm morphology (0.100; P=0.033). In addition, rhinitis presented a positive correlation with seminal ROS (0.937, P<0.001), estradiol (0.307, P=0.015), prolactin (0.325, P=0.011), and IGFBP-3 (1,000; P<0.001).

Conclusion

Our results indicate that respiratory allergies, rhinitis and sinusitis are related to changes in parameters that determine the male fertile pattern. This initial study allows us to suggest two mechanisms of influence of respiratory allergies in male fertility: (I) ultrastructural modifications in microtubules, dinein sheaths and ciliary membrane observed in patients with chronic respiratory disorders are similar to those observed in spermatozoa of asthenozoospermia and teratozoospermia of infertile patients; (II) hormonal and sperm function changes may be related to medications often used for patients with chronic respiratory allergies.

Financial support

Androscience/FAPESP

Ethics Committee Approval

FMUSP Ethics Committee (n°859215/2014)

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-04. ABSTRACT UNDER PRESS EMBARGO

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-05. Analysis of the age of patients seeking treatment for infertility

NT Batista ¹, LAT Batista ², LAA Batista ², BS Gomes ³, MV Machado ⁴

Abstract

Objective

Analysis of the age of patients seeking treatment for infertility.

Methods

A retrospective study was conducted analysing 1795 patients with difficulty to get pregnant from the period from January 2012 to October 2016.

Results

was observed that the majority is in the age group of 35 to 40 year old, period in which it has a fall of the remaining follicles and a decrease in the success rate in pregnancy.

Conclusion

This postponement of gestation is believed to be primarily the lifestyle in which women are taking, caring about career and financial stability, associated with lack of information about fertility.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-06. Analysis of the polymorphism association between LH gene and its receptor with poor responder versus normo responder patients submitted to induction for in vitro fertilization

AJC Meireles ¹, I Nascimento ², JB Costa ¹, PL Lorenzzoni ¹, F Nascimento ¹, JP Bilibio ^1,², TB Gama ²

Abstract

Objective

To analyze the association of LH and LHR gene polymorphisms with poor responders (PR) versus normo-responders (NR) in patients undergoing in vitro fertilization.

Methods

A case control study with patients who performed IVF. They were divided into 2 groups: PR (≤3 MII oocytes at collection) and NR (≥4 MII oocytes at collection). Two LH polymorphisms were analyzed (Codon 8 and Codon 15) and one LHR polymorphism. For this analysis, PCR was performed with subsequent sequencing using the following primers: chromosome 19, p.Trp8Arg polymorphism and pII15Thr, with primer 5 'GAAGCAGTGTCCTTGTCCCA 3'/5 'GAAGAGGAGGCCTGAGAGTT3';AndLHCGRonchromosome2, polymorphism 18insLQ, primer 5 'CACTCAGAGGCCGTCCAAG 3'/5 'GGAGGGAAGGTGGCATAGAG 3'.

Results

Mean age: NR (34.6±3.3) and PR (35.5±3.7), P=0.271. Antral follicle count NR (12.33 ± 4.63) and PR (4.29±1.59), P=0.000. 3^rd day Hormone LH NR (4.55±3.34) and PR (4.22±1.50), P=0.721. Polymorphism of LH at the codon 8: NR (86.5% TT, 13.5% TC, 0% CC) and PR (92.9% TT, 7.1% TC, 0% CC), P=0.520. Polymorphism LH, at codon 15: NR (86.5% TT, 13.5% TC, 0% CC) and PR (92.9% TT, 7.1% TC, 0% CC), P=0.520. LHR polymorphism: NR (61.5% NN, 34.6% NV and 3.8% VV) and PR (64.5% NN, 28.6% NV, 7.1% VV), P=0.903.

Conclusion

Although LH and LHR are fundamental in the development and follicular maturation, there is no association between LH gene polymorphisms studied and LHR with poor response of women submitted to in vitro fertilization. This indicates that the ovarian reserve does not seem to be influenced by changes in the LH hormone, and may only influence the result of oocyte maturation.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-07. Analysis of the polymorphism association between antimullerian hormone gene (AMH) and its R2 receptor (AMHR2) with poor responder patients versus normo responder submitted to induction for in vitro fertilization

JP Bilibio ^1,², TB Gama ², Y Maciel ², PL Lorenzzoni ¹, F Nascimento ¹, JBN Sabá Junior ¹, AJC Meireles ¹

Abstract

Objective

To analyze the association of HAM and HAMR gene polymorphism with poor responder (PR) versus normo responder (NR) in patients undergoing IVF.

Methods

A case control study with patients who performed IVF. They were divided into 2 groups: PR (≤3 MII oocytes at collection) and NR (≥4 MII oocytes at collection). A HAM (Thymine/Guanine) polymorphism and a HAMR2 polymorphism. For analysis of the polymorphism, PCR was performed with subsequent sequencing, using the following primers: chromosome 19, p.I1e49Ser polymorphism with primer C_25599842_10, and AMRH2 on chromosome 12, polymorphism c.-482A> G, primer C_27504454_10.

Results

Mean age: NR (34.6±3.3) and PR (35.5±3.7), P=0.271. Infertility (years): NR (3.92±2.68), PR (5.35±4.7), P=0.208. Antral follicle count NR (12.33±4.63) and PR (4.29±1.59), P=0.000. FSH on day 3 NR (5.01±3.57) PR (6.94±6.02) P=0.185. HAM NR (2.06±2.47), PR (0.68±0.54) P=0.017. Total oocytes NR (12.42±7.43), PR (2.12±0.94), P=0.000. Oocytes MII NR (9.83±6.25), PR (1.79±0.80), P=0.000. Polymorphism of the HAM gene (T for G): NR (57.7% TT, 40.4% TG, 1.9% GG), PR (35.7% TT, 57.1% TG, 7.1% GG), P=0.206. HAM-R2 gene polymorphism (A to G): NR (78.8% AA, 21.1% AG, 0% GG), PR (64.3% AA, 28.6% AG, 7.1% GG), P=0.117.

Conclusion

Although HAM and HAM-R2 are fundamental in follicular development and maturation, there is no association between the HAM and HAM-R2 gene polymorphisms studied with poor response of women submitted to IVF. This indicates that the ovarian reserve appears not to be influenced by HAM alterations, and may only influence the oocyte maturation result.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-08. Descriptive analysis of the effect of oxidative phosphorylation's decoupling on human semen cryopreservation

BT Lima ¹, LNG Adami ¹, RR Andretta ¹, RP Bertolla ¹, M Nichi ¹

Abstract

Objective

To evaluate the protective effect of oxidative phosphorylation's decoupling during cryopreservation of human spermatozoa.

Methods

Each seminal sample (N = 17), after being collected, was divided into two fractions that received, respectively: simultaneous treatment of oxidative phosphorylation's decoupling (Carbonyl Cyanide M-Chlorophenylhydrazone, CCCP 0,5µM) and glycolysis estimulation (D-Glucose2mM), setting up the treated group; and that did not receive any treatment, configuring the control group. Both fractions remained in heater at 37^oC for 10 minutes for stabilization. The aliquots were cryopreserved and, for thawing, kept at room temperature for 10 minutes and in heater at 37^oC for 20 min, following to centrifugal washes at 300xG for 30 minutes. Sperm analysis occurred before and after cryopreservation, through assessments of plasma membrane integrity, superoxide anion intracellular activity, acrosome integrity, mitochondrial activity and DNA fragmentation. To verify the normality of the data, the Kolmogorov-Smirnov test was used, considering alpha =5%, and then a graphical analysis of the variables under study was performed.

Results

The graphical analysis performed, correlating the effect of cryopreservation and the defined groups, demonstrates a tendency of the data to present a better maintenance of mitochondrial activity, DNA integrity and plasma membrane integrity in the treated group when compared to the control group.

Conclusion

From the results obtained it is suggested that the simultaneous treatment of decoupling of oxidative phosphorylation and stimulation of glycolysis is able to decrease the cryodamages in human spermatozoa.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-09. Can electromagnetic waves emitted by a cell phone interfere with embryonic development?

DL Simão ¹, AM Giusti ¹, RA Salvador ¹, D Til ¹, AP Senn ¹, VLL Amaral ¹

Abstract

Objective

To analyze the development of murine embryos when exposed to electromagnetic waves emitted by a cell phone.

Methods

12 F1 females (C57Bl/6xBalb/C) were stimulated intraperitoneally with 10IU eCG (Novormon - Schering - plow^®) and after 48 hours with 10IU hCG (Vetecor-Hertape Calier^®) for greater embryonic recruitment. After 36 hours following mating, the females were killed in CO₂/ O₂ chamber. The uterine tubes were collected and washed with GV Hepes medium (Ingámed^®) for the collection of the 2-cell embryos. Embryos (n = 240) with adequate morphology were selected and separated into 3 culture groups in GV Blast medium (Ingámed^®) supplemented with 10% Ingame Serum (Ingámed^®). Group 1: Maintained in the incubator until the end of the experiment; Group 2: withdrawn from the incubator 1x/day, for 5 minutes, without exposure to the cell phone; Group 3: Retired from the incubator 1x/day, for 5 minutes, exposed to the cell phone connected to the wi-fi and playing a video (mute). All culture plates were kept heated (37°C) while outside the incubator.

Results

The hatch rate on the fourth day of in vitro development was significantly higher (P<0.05) in group 3 (26.2%), when compared to group 2 (13.7%). However, they did not differ on the fifth day of development (60.5%, 67.5%, and 70%) for groups 1, 2 and 3, respectively.

Conclusion

Embryo exposure to cellular electromagnetic waves did not interfere with hatching rates, however, an accelerated embryonic development was observed when compared to the other groups.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-10. Association between adenomyosis and implantation failure in IVF/ICSI cycles: a systematic review

T Magalhães Aguiar ¹, LFO Henrique ¹, JA Dias Jr ¹

Abstract

Objetive

To analyze the possible association between adenomyosis and implantation failure in IVF/ICSI cycles. Methods: Review of the medical literature, through the search of publications in the form of scientific papers written in the English language, in MEDLINE and PUBMED databases in the last 10 years using the following descriptors: adenomyosis, implantation failure, IVF.

Results

Fifteen (15) scientific papers were found. After the application of the exclusion criteria, six (06) publications were selected, with 02 (two) control cases, 04 (four) retrospective cohorts in the period 2011 to 2016.

Conclusion

It was not possible to determine causality nexus betweeen adenomyosis and implantation failure in IVF/ICSI cycles through this research. Methodologically well-designed studies are needed in order to continue research.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-11. Behavioural and physiological profile of oligospermic patients

JF Aderaldo ¹, EJPB Nobrega ^1,², MMGT Torres ², DESM Marques ², KRN Barbosa ¹, LCA Silva ¹, PCS Vieira ¹, MCGP Coelho ², ALB Sant'Anna ¹, MQLMM Paiva ¹, KM Morais ^1,²

Abstract

Objective

To Identify behavioural and physiological aspects of oligospermic patients in an assisted reproduction center of the National Health System (SUS). It is known that infertility factors vary for various reasons, among which is life style. Being spermatogenesis dynamic, it is possible to alter a seminal profile by means of new habits.

Methods

64 oligospermic patients (concentration below 1.0x106 spermatozoa/mL) that underwent spermogram between February 2016 and May 2017 were selected. Confirmatory exams (repetitions) were excluded in order to avoid slant and vasectomized patients (reversed or not). It was created a spreadsheet to store data: age, body mass index, physical activity, smoking habits, use of alcohol and use of medication.

Results

The sperm concentration average was 0.17 sptz/ mL, varying between 0.0 e 1.0 sptz/mL. Age average was of 37 years old, varying from 18 to 69 years old. Body mass index average was 27 kg/m², varying between 19 e 51 kg/m². Out of the 64 patients, 51% do regular physical activities, 4% are smokers and 36% make use of alcohol. 25% of the patients make use of regular medication, from which 44% are antihypertensive drugs, 25% are gastroprotecting drugs, 19% are antidiabetics and 12.5% are cholesterol regulators.

Conclusion

The profile identification has proved satisfactory, for all factors seems to be correlated to overweight. The initial identification of this profile will allow further studies concerning this same group of patients in partnership with the Urology, Psychology, Cardiology, Nutrition and Physical Education sectors of the University Hospital.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-12. A successful case of genetic pre-implantation study for amiotrophic lateral sclerosis

J Polisseni ¹, JV Rosa ¹, F Polisseni ¹, CM Assunção ¹, LM Coutinho ¹, JPJ Caetano ¹

Abstract

Objective

Pre-implantation genetic study case report (PGD) after ICSI in a patient with two parental cases of Amyotrophic Lateral Sclerosis (ALS), degenerative and progressive neurological disease, with motor neuron involvement.

Methods

In June 2016, a 32-year-old patient underwent an ICSI cycle followed by PGD through STR and SNP-array (Karyomappings) and CGH-array (Comparative Genomic Hybridization by Microarray) binding.

Results

In the ICSI cycle, 22 mature oocytes were obtained, with a fertilization rate of 95.5% (21/22) and blastocyst rate of 66.7% (14/21). All blastocysts were biopsied, frozen and the material sent for genetic analysis. First, nine embryos were analyzed, two of which presented a parental haplotype at risk for ALS disease. Then two embryos considered normal for ALS were submitted to the CGH-array and the two presented euploid, which were thawed and transferred to the patient in a new cycle. The patient had a twin pregnancy, uneventfully, with the birth of two healthy children at 32 weeks of gestation.

Conclusion

It was evidenced the relevance of the study of ALS through PGD post ICSI in patients with parental cases, since it is a disease related to genetic factors. The genetic diagnosis for monogenic disease was able to modify the risk of having children affected by ALS, since it still represents a serious disease, with no cure so far.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-13. Extended co-culture of epithelial and stromal cells from endometrium in a three-dimensional model

CT Rodrigues ¹, AB Machado ^1,², A Germeyer ², T Strowitzki ², H Von Eye Corleta ¹, I Brum ¹, E Capp ^1,²

Abstract

Objective

Three-dimensional cultures provide, in vitro, a closer condition of the tissue organization. Objective. Develop a three-dimensional culture of primary endometrial cells for 20 days.

Methods

Endometrial tissues were obtained from patients that underwent hysteroscopy (33.6±4.3 age). Exclusion factors: post menopause, diabetes and neoplasm. Epithelial and stromal cells were physically and chemically dissociated, isolated by filtration and cultivated separately. For threedimensional culture, stromal cells (2x105/mL) were mixed with extracellular matrix Matrigel^® (90%); after solidification, epithelial cells (1x105/mL) were seeded on top of the matrix/ stromal-cells complex. The co-culture was maintained for 20 days, and the median was changed every 48 hours. Morphology, differentiation and cellular growth were evaluated by inverted light microscopy every 24 hours.

Results

In the bi-dimensional culture, epithelial cells had typical cuboid shape and aggregated around a common point. Stromal cells had fusiform and star-like shape. In the three-dimensional culture, the epithelial cells were attached in day 1; revealed high levels of invasion to the matrix in day 5; and aggregated into circular complex structures from day 8 onwards. These structures had an inner lumen inside, suggesting glands formation, and grew in size until day 20. Stromal cells were viable until day 20, proliferating normally beneath the epithelial layer.

Conclusion

It was established a three-dimensional coculture model of primary endometrial cells, that maintained viable for 20 days. The cells preserved the characteristics of differentiation, proliferation and organization, making possible the use of this model for futures studies of embryo implementation.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-14. How are the couples who performed in vitro fertilization and had no children?

BR De Marchi ¹, CL Fácio ¹, LA Machado-Paula ¹, LF Previato ¹, E Araújo Filho ¹

Abstract

Objective

Investigate whether couples that underwent in vitro fertilization are together after years of the treatment, whether they had done something to fulfill the desire to have children and what they recommend to other couples who have not had children.

Methods

Fifteen women underwent in vitro fertilization (1999-2009) were interviewed by telephone call (March-April/2017).

Results

One couple was divorced for reasons other than the lack of a child and 1 became a widow. One patient said that feels excellent, 3 said that are very fine, 8 said that are fine, 1 said that feels normal, and 1 is frustrated. Six said that did not have to look for something to fulfill their desire; 5 adopted; 1 cared for her husband with leukemia for almost 20 years; 1 said that her nephew filled the lack of a child; 1 said to do charities; 1 said nothing fills the lack of a child and she feels incomplete. Regarding the recommendations to other couples, 8 said that it is not only child that brings happiness; 4 said to insist on treatment until when it is possible or adopt and 3 said to believe in what God prepares for each one.

Conclusion

Years after the treatment, 13 couples remained together. Through the results, we concluded that the majority sought other means to feel good and fulfilled, and most of couple obtained a functional interpretation of the negative result and thus they did not acquire emotional and behavioral losses to give continuity to their lives.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-15. Comparative analysis using the second follicular wave to recover oocytes in poor-responders submitted to in vitro fertilization (IVF): preliminary results of duo-stim against pure second-wave

C Gomes ¹, T Domingues ^1,², T Bonetti ^1,², P Serafini ^1,³, E Motta ^1,²

Abstract

Objective

Based on the knowledge that physiologically 2-3 follicular waves occur during menstrual cycle, a new strategy for ovarian stimulation with dual follicular aspirations in the same cycle (DuoStim) has been applied. This study evaluated if a modification on the DuoStim protocol, rescuing only the second-wave, could produce similar results and avoiding two collections.

Methods

This preliminary analysis included 11 low ovarian-reserve patients (low ovarian response in a previous cycle with standard stimulation, AMH <1ng/mL and AFC <10) undergoing IVF. Five patients underwent a standard DuoStim protocol (DuoStim) with two oocytes collections. Six patients started a conventional protocol and due to poor response, stop medications and re-started stimulation two days after natural ovulation for a Second-Wave rescue (SecondWave).

Results

Demographic characteristics in DuoStim and Second Wave were similar: Age (37.2±2.5 versus 37.5±1.2; P=0.765), BMI (21.9±3.0 versus 20.1±1.7; P=0.144), AMH (0.6±0.6 versus 06±0.4; P=0.712) and AFC (6.4±2.9 versus 4.7±2.4; P=0.261). Mean number of oocytes collected in DuoStim was 4.0±2.3 during the 1st collection and 2.4±2.9 in 2nd, with the sum of 6.4±2.7 recovered, compared to 6.2±5.0 aspirated oocytes in the SecondWave protocol (P=0.854).

Conclusion

Despite of preliminary outcomes and low number of patients, stimulation just after the peak of gonadotrophins to produce the natural ovulation seems to be a possibility to rescue cycles in low-responder patients, showing similar recovered oocytes if compared to DuoStim protocol and also avoiding extra-follicular aspirations. Overall, the benefit of SecondWave approach is to save a probably cancelled cycle, allowing to produce viable embryos.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-16. Comparison of culture embryos in different oxygen tensions

R Azambuja ¹, V Reig ¹, A Tagliani-Ribeiro ¹, D Kvitko ¹, L Proença ¹, S Flach ¹, L Okada ¹, R Petracco ¹, A Petracco ¹, M Badalotti ¹

Abstract

Objective

To compare de culture of embryos under low oxygen (5% O₂) concentration, versus atmospheric tension of oxygen (~20%).

Methods

The study was performed from January 2015 to May 2017, with 972 patients that were divided in 2 groups. One group of embryos was placed in a low oxygen tension (5%) and another group with 20% O₂. All embryos were cultured up to blastocyst stage. Fertilization, cleavage, and blastocyst rates were compared. As well as pregnancy rate for the patients that performed fresh embryo transfer. All parameters were analysed by T test (P<0.05).

Results

The group with 5% O₂ concentration had 440 patients, with an average age of 36.6 years old. In this group the fertilization rate was 76.1%, cleavage 99.2% and blastulation rate of 53.1%. In the 20% O₂ concentration, with 532 patients the average age was 35.1, and it was observed 79.8%, 99.2%, and 52.0% of fertilization, cleavage, and blastulation rate. Pregnancy rate was 52.9% for 5% O₂ concentration and 50.4% for 20% O₂ concentration. No difference (>0.05) was observed between the groups in any of the parameters evaluated.

Conclusion

Although no difference was found between the incubators, new studies are necessary in order to define if there is an incubator that is better than the other to culture embryos to blastocyst stage.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-17. Comparison between the cycle of cryopreservation of oocytes in oncological and non-oncological patients

C Moraes ¹, E Xavier ¹, AL Campos ¹, V Marinho ¹, JP Caetano ¹, I Batista ¹, F Cordeiro ¹, R Marinho ¹

Abstract

Objective

To retrospectively analyze cases of cryopreservation of oocytes performed between 2010 and 2017 at Clínica Pró-Criar.

Methods

Analysis of medical records and database of patients who underwent oocyte cryopreservation cycles.

Results

A total of 209 oocyte cryopreservation cycles were analyzed, of with 183 (87.5%) were due to social preservation and 26 (12.5%) were due to oncological treatment, with a mean cycles/patient of 1.16 and 1.13, respectively. The mean age in both groups was 35.1 years. The group of non-cancer patients was composed of 29.2% of married women and 70.1% of single women. 2,074 oocytes (mean of 11.3 oocytes per cycle) were obtained, 1,639 mature (MII) (mean of 8.9 oocytes) were frozen. Per patient, we had a mean of 13.1 oocytes obtained, with a mean of 10.3 MII frozen. The group of cancer patients consisted of 52.1% of married women and 47.9% of single women and the most incident cancer was breast cancer (46.1%) followed by Hodgkin's lymphoma (15.4%). 358 oocytes (mean of 13.7 oocytes per cycle) were obtained with frozen 262 MII (mean of 10.1 MII). Per patient, we had a mean of 15.5 oocytes obtained with an average of 11.4 frozen MII.

Conclusion

The main cause of oocyte cryopreservation was the postponement of motherhood for personal reasons. The mean number of oocytes obtained and frozen did not differ in the two groups indicating that the cancer probably did not affect the fertility of the patient.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-18. Total criopreservation of embryos or transfer in fresh cycles?

L Okada ¹, R Azambuja ¹, A Tagliani-Ribeiro ¹, D Kvitko ¹, L Proença ¹, S Flach ¹, J Michelon ¹, R Petracco ¹, A Petracco ¹, M Badalotti ¹

Abstract

Objective

To evaluate if the total cryopreservation of the embryos brings some benefit in the results of pregnancy.

Methods

The results of 369 cycles of follicular aspiration were analyzed between January 2016 and April 2017, separated into 2 groups: A, 266 cycles with fresh embryo transfer, at day 5 of culture; and B, 103 cycles where the embryos, that reached the blastocyst stage, at day 5 or day 6 of culture, were cryopreserved by the vitrification technique, with subsequent thawed embryo transfer. The statistical analysis was the chi-squared test (P<0.05).

Results

In group A, the mean age of the patients was 35.55 years, and the pregnancy, clinical pregnancy and abortion rates were 51.13%, 42.82% and 11.40%, respectively. In group B, the mean age was 33.72 years, and the results of pregnancy, clinical pregnancy and abortion rates were 57.28%, 53.40% and 14.55%, respectively. There were no statistical differences in any of the parameters analyzed (P=0.2888, P=0.0683, P=0.5618, respectively) between the two groups.

Conclusion

The results obtained in the groups showed no difference between transferring fresh embryos or performing complete cryopreservation of the embryos, with subsequent transfer, although it tended to have a better clinical pregnancy rate in group B. Transfer of embryos in the blastocyst stage presented favorable and satisfactory results in both groups. Therefore, the policy of total cryopreservation can be a benefit, reducing the risks of ovarian hyperstimulation syndrome.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-19. Outcomes of an egg-sharing program

A Tagliani-Ribeiro ¹, R Azambuja ¹, SW Flach ¹, L Okada ¹, D Kvitko ¹, L Proença ¹, J Michelon ^1,², D Farinati ¹, R Petracco ^1,², F Badalotti ^1,², A Petracco ^1,², M Badalotti ^1,²

Abstract

Objective

To assess the results of the egg donation program from its creation (2001) until 2016 at Fertilitat Clinic - Porto Alegre.

Methods

This is a descriptive study, where were analyzed the mean age, pregnancy rate, abortion and live births of oocyte donor and recipient patients participating in the egg donation program.

Results

During the 15 years of existence, the egg-sharing program has contemplated 382 patients, of which 182 participated as donors of oocytes and 200 as recipients. The mean age of donors was 30.5 years and recipients 43.4 years. The mean number of inseminated eggs was 6.1 for donors and 6.5 for recipients. A total of 473 cycles were performed, and in 420 cycles the transfers were performed. The pregnancy rates were similar in both groups, 45% (donors) and 46% (recipients) (P=0.909), the clinical pregnancy rate was 41% on donors and 35% on recipients (P=0.373). The abortion rate was also similar, 16% in the donor group and 12% in the recipient group (P=0.558). In the donor group we had 68 live births and 55 live births in the recipient group. In 43 cycles, all embryos were frozen due to the transfer cancellation. Conclusion: This data collection shows a very similar result, despite the visible difference of age between both groups. Thus, our program provides real chances of pregnancy to those patients who, for various reasons, need to join the egg donation program as an oocyte recipient.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-20. Do embryos transferred on the fourth and fifth day get similar rates of pregnancy?

TDP Silva ¹, LS Arruda ², M Pozzer ¹, MB Bueno ¹, N Sartori ², CA Link ², VM Lazzari ¹

Abstract

Objective

To classify transferred embryos on the 4^th day of development and to compare pregnancy rates with those of transferred embryos on the 5^th day.

Methods

Analysis of embryo images of 192 couples who underwent in vitro fertilization at the ProSer Fertility and Reproductive Clinic in 2016. 98 couples performed the transfer on the 4^th day and 94 couples performed the transfer on the 5^th day. In both groups, the patients included were less than 40 years old. To classify the morulae, a scoring system was used to evaluate the degree of compaction and fragmentation, obtaining a global score from A to D. Pregnancy rates were compared by the Fischer exact test with P<0.05 considered significant.

Results

Embryos degrees A and B of 4^th and 5^th days presented no significant difference (P=0.30) in pregnancy rates. There was no significant difference between rates of AB morulae and initial blastocysts transferred on day 4 (P=0.33). When initial blastocysts transferred on day 4 and blastocysts of day 5 AB were compared, pregnancy rates were significantly better for the transfers performed on day 4 (P=0.03). Grades C and D embryos did not show significant differences between 4^th and 5^th days (P=0.09).

Conclusion

Embryos transferred on day 4 of development present rates as good as those of day 5; when these are initial blastocysts, rates are even better. We conclude that the transfer on day 4 brings good results to the routine of assisted reproduction clinics.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-21. Does the zygote morphology remain a helpful parameter for embryo selection?

MIR Kulmann ¹, CG Basso ¹, M Hoher ¹, NP Oliveira ¹, G Frantz ¹, CG Dutra ¹, A Bos-Mikich ², N Frantz ¹

Abstract

Objective

Our previous studies suggest that nucleolar morphologic scores are predictive of aneuploidy rates in <40 year old patients even when comparing same quality blastocysts. In this context, the aim of the present study was to assess how nucleolar morphology affects the implantation rate in blastocyst transfers of <40 year old patients.

Methods

This is a retrospective observational study performed from January 2014 to December 2016. Morphology parameters of 247 embryos from 160 frozen embryo transfer cycles were analyzed, where it was possible to track the implantation outcome. Zygotes were classified according to the Z-score system. Furthermore, blastocysts were scored according to Gardner and Schoolcraft grading system and categorized in BL1 (AA, AB or BA), BL2 (BB or CB) and BL3 (BC or CC).

Results

The overall implantation rate was 32,8%. Poor nucleolar morphology was associated with decreased implantation rate of BL1 blastocysts. BL1/Z1-Z2=47,9%, BL1/Z3-Z4=11,1% (P<0.05). Additionally, we observed a trend towards decreased implantation rate in association with poor nucleolar scores when comparing BL2 blastocysts. BL2/Z1-Z2 = 27,3%, BL2/Z3-Z4=21% (P=0.5726). Regarding BL3 blastocysts, the implantation rate of BL3/ Z1-Z2 embryos was 16% whereas only one BL3/Z3-Z4 embryo was transferred resulting in an unsuccessful implantation.

Conclusion

Our data suggest that a combined assessment of nucleolar and blastocyst morphology, not just blastocyst morphology, should be applied to select most suitable embryos to implant in <40 year old patients.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-22. Effect of melatonin and caffeine supplementation on the structural and functional characteristics of pre-cryopreservation and post-thaw spermatozoa

JR Pariz ^1,^2,^3,⁴, C Ranéa ^1,^2,^3,⁴, VS Coutinho ^1,^2,^3,⁵, DG Reis ^1,^2,^3,⁵, RAC Monteiro ^1,^2,^3,⁴, J Hallak ^1,^2,^3,⁴

Abstract

Objective

to investigate the effect of melatonin and caffeine supplementation on the structural and functional characteristics of pre-cryopreservation and post-thaw spermatozoa.

Methods

This prospective study used 30 normozoospermic seminal samples cryopreserved with modified Human Tubal Fluid without supplement or 2mM Melatonin. After thawing, the samples were analyzed or supplemented with 2mM of caffeine. At the end of the experiments, we obtained 4 groups: Post-thaw samples without supplementation (CONT), samples supplemented with caffeine (CAF), melatonin (MEl) and caffeine+melatonin (CM). Seminal parameters for count, motility and kinetics (SCA^® software), mitochondrial activity (diaminobenzidine), evaluation of DNA fragmentation (SCSA^® method) and dosage of radical oxygen species levels (ROS; luminescence) pre-cryopreservation and post-thaw were carried out with or without supplementation. The data were analyzed by the paired Student's t-test and by one-way analysis of variance with repeated measurements, followed by Holm-Sidak test.

Results

We observed reduction in sperm concentration (P<0.001), total (P<0.001) and progressive (P<0.001) motility, kinetic parameters (P<0.009) and mitochondrial activity (P<0.001), and increased of DNA fragmentation (P=0.046) and ROS (P=0.052) production in CONT samples. When supplemented with CAF and MEL, we observed an increase in progressive motility in the CAF (P=0.005) and CM (P=0.048) groups, and an increase in mitochondrial activity in CM group (P<0.05).

Conclusion

Cryopreservation has negative effects on seminal quality and ROS levels, and that the combination of caffeine and melatonin supplementation in pre-cryopreservation and post-thaw samples proved to be an important tool to be applied in cryopreserved samples to act as substances that stimulate sperm motility.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-23. Effect of age of menarche in amount of gonadotropin in patients submitted to assisted reproductive techniques

AVS Moraes ¹, M Approbato ¹, LK Magela ¹, FLP Carnesi ¹

Abstract

Objectives

In work recent multicenter, was detected that menarche before 13 years anticipates the menopause (Mishra et al. 2017). In this way we assess the effect of anticipation of menarche in the amount of gonadotropin used in inducing patients undergoing assisted reproductive techniques.

Methods

retrospective study, with 71 data collection records of patients over 35 years subject to assisted reproduction techniques reproductive laboratory of the hospital das clínicas of the federal University of Goiás in the period of 2015 and 2016. Used schema with GnRH antagonist. Data collected: age of menarche, age of the patient, quantity of total gonadotropin on induction, antral follicles count (CFA) and basal FSH and evaluated by Mann Whitney test, P=0.05. Two groups were compared, G1 (menarche before 13 years) and G2 (menarche after 13 years). For comparability of groups were paired, CFA age and basal FSH.

Results

the median of gonadotropin in the group G1 was 2325UI and G2 of 2250UI difference is not significant (P =0.44).

Conclusion

The median of amount gonadotropin total required in induction of patients to assisted reproduction although not significant, was higher in the Group of menarche before the 13 years than in the group with more than 13 years, what could suggest a smaller ovarian reserve in patients with menarche before 13 years. It is possible that with a larger sample can detect a difference between the groups.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-24. Effect of age of menarche in antral follicle count and FSH levels in patients undergoing assisted reproductive techniques

AVS Moraes ¹, M Approbato ¹, LK Magela ¹, FLP Carnesi ¹

Abstract

Objective

In work recent multicenter, was detected that menarche before 13 years anticipates the menopause (Mishra et al. 2017). In this way we evaluate if the age of menarche could influence the ovarian reserve (antral follicle count-CFA-and basal FSH levels) in patients undergoing assisted reproductive techniques.

Methods

retrospective study, with 71 data of patients over 35 years subject to assisted reproduction techniques reproductive laboratory of the hospital das clínicas of the federal University of Goiás in the period of 2015 and 2016. Used GnRH antagonist protocol. Data collected: age of menarche, age of the patient, count of antral follicles (CFA) and basal FSH. We used the Mann Whitney test. Were separated two groups, G1 (menarche before 13 years) and G2 (menarche after 13 years). For comparability of paired groups the age groups.

Results

the two groups met as middle age 39 years. The median was higher in basal FSH G1 (7.03; P=0.31) than in G2 (6.6; P=0.31). The CFA in Group 1 was 4.5, less than in Group 2 (5.0; P=0.41).

Conclusion

The median of basal FSH group with menarche before 13 years was slightly higher than patient with menarche after 13 years. The CFA was lower in the group with menarche before 13 years. Although not significant, future comparisons with the largest number of cases could find less ovarian reserve in patients with menarche before 13 years.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-25. Effect of embryo biopsy for pre-implantation genetic diagnosis in the beta-hCG levels

L Munhoz ^1,², H Park ^1,², TCS Bonetti ^1,³, AL Invitti ³, PC Serafini ^1,², ELA Motta ^1,³

Abstract

Objective

The selection of a chromosomally normal embryo seems to result in higher gestation rates, however doubts remain regarding possible deleterious effects of the embryo biopsy on implantation. This study evaluates whether laboratory manipulation with the cell removal has an impact on beta-hCG levels comparing pregnancies of biopsied or non-biopsied embryos.

Methods

Observational study of positive results of beta-hCG in IVF cycles in 2016 at Huntington-Ibirapuera. The study was divided in two groups: positive hCG with embryo biopsy (study) and without biopsy (control). The data were pairwise compared (t-test) and the model adjusted by multiple linear regression.

Results

445 pregnancies were analyzed, 282 (63.4%) with embryo biopsy and 163 (36.4%) without biopsy. The pairwise analysis demonstrated a difference in beta-hCG values between biopsied and non-biopsied groups (P=0.014). Although the adjustment of the model using the co-variables: time between embryo transfer and beta-hCG dosage and gestational sacs number demonstrated embryo biopsies are not significant (P=0.323). The model also indicates that beta-hCG values are greater as larger the dosage interval (P<0.01) and higher the number of gestational sacs (P<0.01).

Conclusion

The hCG levels were not influenced by the embryo biopsy in comparison to the control group. Thus, if laboratory manipulation causes trauma to reproductive potential, it is not reflected in the chorionic gonadotrophin levels.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-26. Efficacy of follicular flushing during oocyte retrieval

MCS Maia ¹, YAR de Lima ¹, TM da Silva ¹, RSA Sasaki ¹, EAB Fleury ¹, FC Approbato ¹, MS Approbato ¹

Abstract

Objective

To determine if the follicular flushing during oocyte retrieval could significantly increase the number of oocytes in patients undergoing in vitro fertilization treatment.

Methods

A prospective, non randomized study was conducted in which 42 procedures of transvaginal follicular aspiration guided by ultrasonography had been evaluated in the period from January to May 2017. After direct aspiration of follicle, follicular flushing followed for two times. The number of oocytes recovered in the direct aspiration and in the first and second follicular flushing was registered. All follicles with diameter greater than 10mm were aspirated. For the calculations the Wilcoxon test (Z) were used, with a fixed level of 95% confidence. P<0.05 was considered statistically significant.

Results

335 follicles were aspirated and 228 oocytes were retrieved (recovery rate 68%). The mean of follicles aspirated per patient was 6 (range 4 to 15). Of the 228 total oocytes, 156 (68.4%) were retrieved from the initial aspiration, 44 (19.3%) from the first follicular flushing and 28 (12.3%) and from the second flushing. It had significant increase (P=0.0001) in the number of retrieved oocytes during the first follicular flushing when compared with the direct aspiration of the follicle. The same results were registered when compared the second follicular flushing with the direct aspiration of the follicle (P=0.0001) and with the first follicular flushing (P=0.0002).

Conclusion

We conclude that follicular flushing significantly increases the number of oocytes retrieved. Future investigations are needed to establish the advantages of routine follicular flushing in assisted reproduction procedures.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-27. Embryo euploidy rate by next generation sequencing is related to female age but not to the number of embryos generated

CD Martinhago ¹, KRN Endo ¹, MA Oliveira ¹, AA de Melo ¹, AMM Dias ¹, GS Pereira ¹, DT Schneider ², SC Esteves ²

Abstract

Objective

To determine the influence of female age and embryo cohort size on the frequency of blastocyst euploidy of infertile couples.

Methods

Women who underwent preimplantation genetic screening(PGS) for on day 3 embryos, balanced translocations, single gene diseases, polar body biopsy, and embryos generated from oocyte donation were excluded. Trophectoderm cells from blastocysts were analyzed by Next Generation Sequencing(NGS). The proportion of euploid embryos was calculated per female age categories and number of blastocysts. The percentage of women with at least one euploid blastocyst was also determined across all studied categories. Frequencies were compared using Chi-square test.

Results

Were biopsies 752 blastocyst from 286 infertile couples(93.98%) yielded NGS data whereas 46 blastocysts (6.02%) provided cells with degraded DNA caused by nucleated biopsied cells or low embryonic quality. The mean±SD female age was 37.43±3.52 years. Overall, the % euploid embryos was significantly lower in women aged 35-39 and 40-42 than <35, and between 35-39 and 40-42 across all embryo cohort sizes (P=0.01 or less). No difference was observed in the frequencies of euploid blastocyst across embryo size categories within the same female age. The proportion of patients with at least 1 euploid blastocyst was lower in the small cohort size (14) across all age groups than in the larger cohorts(>4) (P<0.001).

Conclusion

Blastocyst euploidy rates decrease as a function of increased female age but not with embryo cohort size. The chances of achieving at least 1 euploid embryo are increased irrespective of the age group if at least 5 blastocysts are available for biopsy and NGS analysis.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-28. There is effect of carnosine antioxidant treatment's different concentrations during seminal human processing?

LNG Adami ¹, BT Lima ¹, RR Andretta ¹, RB Bertolla ¹, M Nichi ¹

Abstract

Objective

To evaluate the effect of different carnosine concentrations treatment during seminal process in human sperm.

Methods

The seminal samples (n = 22) were divided into three groups: control (C) with only Percoll layers (80% and 40%) and seminal sample; antioxidant 1 (C1) containing the Percoll layers supplemented with 20mM of carnosine and sample; and antioxidant 2 (C2) containing the Percoll layers supplemented with 50mM of carnosine and sample. All of groups were submitted to seminal process through discontinuous density gradient during 20 minutes at 600xG, after they were washed with human tubal fluid culture medium (HTF) during 10 minutes at 600xG. After processing, spermatozoa were evaluated for acrosome integrity, mitochondrial activity, vitality and DNA fragmentation. Groups were compared using Kolmogorov-Smirnov test to normality, Mauchly test to sphericity of data and General Linear Model (GLM) test with Bonferroni post hoc test, considering alpha =5%, by SPSS21.

Results

The supplementation with concentration of carnosine 20mM led to an improvement of mitochondrial activity to spermatozoa when compared to control group.

Conclusion

The carnosine supplementation in seminal samples may have a beneficial effect on mitochondrial sperm activity, softening the possible damage caused by seminal processing.

Funding Support

Fapesp 2016/13822-7

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-29. Pregnancy due to in vitro fertilization in a patient who has a 46XY karyotype

ICB Batista ¹, EBS Xavier ¹, CS Monteiro ¹, LMA Maia ¹, RR Campos ¹, IKDC Cruzeiro ¹

Abstract

Objective

Present a clinical case of pregnancy due to IVF treatment with egg donation in patient with karyotype 46 XY and probable diagnosis of SRY chromosomic region suppression and revision of literature regarding this gonadal dysgenesis.

Method

Clinical follow-up during high complexity treatment with assisted reproductive techniques and subsequent maternal-fetal support to the patient VDR. Gathering patient data from medical history from the first admission at UFMG's HC in 2008 until nowadays.

Results

VDR, 26 years old, no pregnancy, referred to UFMG-HC gynecological endocrinology clinic in 2008 to follow up the diagnosis of primary amenorrhea with karyotype 46 XY. Bilateral gonadectomy was made in 2009 and estradiol-progesterone combined hormone therapy was initiated in 2008 and kept until the beginning of the egg donation treatment in 2016. Patient had induced telarch and menarche at age 26. Endovaginal ultrasound at egg donation: uterus with 13.93 cc volume and 3.7mm endometrium. Endometrial preparation was made with oral estradiol. Patient received 11 oocytes from donnor, which were inseminated with spouse semen. 10 eggs were successfully fertilized and two blastocysts were transferred and one was frozen. Patient evolved with monoembryonic pregnancy and is currently receiving high risk pre-natal care.

Conclusion

The frequency of SRY chromosomic region suppression cases is 1:20.000 individuals. The case here summarized indicate the need for a full clinical, laboratorial and imaging investigation over primary amenorrhea cases to set a definitive diagnosis and specific treatment. The VDR patient was diagnosed with primary gonadal insufficiency, and egg donation was the recommended infertility treatment.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-30. Importance of telephone call by psychologist to patients during the assisted reproduction treatment

BR de Marchi ¹, CL Fácio ¹, LA Machado-Paula ¹, LF Previato ¹, E Araújo Filho ¹

Abstract

Objective

Investigate what patients undergoing assisted reproduction treatment thought to receive phone calls after oocytes aspiration procedure and if they would like to continue receiving phone calls after embryo transfer and beta hCG result.

Method

We interviewed 106 patients who underwent in vitro fertilization (October/2016-April/2017). Patients received a questionnaire after embryo transfer. The psychologist contacted all patients by telephone after oocytes aspiration to know about their feelings during this process, and through questionnaire responses it was possible to assess whether it would be valid to continue with this contact.

Results

78 patients wanted to receive phone calls after procedures and 28 did not. Of those who wanted it, 17 said it relieved their anxiety; 17 wanted someone to talk; 12 felt receiving more attention from the clinic; 9 felt calm; 5 said it increased their confidence in the treatment; 3 felt emotional equilibrium; 2 felt relief from anxiety; 1 said it improved her self-esteem and 12 did not justify. In relation to 28 patients who did not want to receive calls, 10 said that were fine; 3 were taking therapy elsewhere; 3 did not want to do psychological counseling at the clinic; 1 said she knew that could count on the psychological support of the clinic and 11 did not justify.

Conclusion

As a further support, 73% of them liked or wanted to receive phone calls after aspiration, transfer and beta hCG. They identified a greater emotional support for the treatment with this method used by the clinic.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-31. Influence of strict morphology evaluation pre intra uterine insemination and treatment outcomes

L Lopes ^1,², C Nogueira ¹, F Maluf ², I Coelho ², R Medugno ¹, V Lampa Jr ¹

Abstract

Objectve

The strict Kruger morphology is one of the seminal parameters evaluated when there is a need for investigation of male causes for infertility. Several studies with controversial opinions have evaluated the possible relation between the isolated diagnosis of teratozoospermia and the results of assisted reproduction.

Methods

We evaluated a series of 339IIU cycles performed in our service, of which only couples diagnosed with infertility without associated female factors were selected. They were divided in two groups: group I - without seminal changes and group II - with exclusive alterations in the morphology below 4% of Kruger. The outcome was pregnancy.

Results

Among 195 patients evaluated without any seminal alteration the pregnancy rate was 11.79% while in the teratozoospermia group alone (144 patients) it was 10.41%. There was no difference in pregnancy outcomes when evaluated exclusively for teratozoospermia alone in infertile patients.

Conclusion

We can assume that the strict Kruger morphology can not be considered as a determining factor in the indication of assisted reproduction and also in the proposed treatment modality when evaluating other surveys in the literature. Further studies are needed to better elucidate the real interference of sperm morphology and infertility.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-32. Influence of obstructive and non-obstructive azoospermia in the efficiency of ICSI

J Polisseni ¹, CM Assunção ¹, NF Oliveira ¹, F Polisseni ¹, JV Rosa ¹, LM Coutinho ¹, JPJ Caetano ¹

Abstract

Objective

To evaluate the efficiency of ICSI in patients who underwent testicular puncture/biopsy, having obstructive (OA) and non-obstructive (nOA) causes, as the exclusive cause of infertility.

Methods

Retrospective analysis, by the selection of medical records of the Zona da Mata Mineira clinic from 2010-2017. The first part of the study included only patients with azoospermia who underwent testicular puncture/biopsy followed by ICSI. The effect of the azoospermia etiology, comparing ICSI cycles, between OA (n=48) and NOA (n=28) was evaluated. The second part focused on the effect of ICSI-OA-NOA efficiency compared to fresh ejaculate (FE) ICSI (n=1006). Rates of fertilization, freezing, clinical pregnancy and abortion were analyzed using the chi-square test (P<0.05).

Results

Part I: rates of fertilization, freezing and clinical pregnancy were lower in the cases of NOA in relation to OA (75.2%, 25.9%, 39.3% vs. 80.5%, 30.9%, 50.0%) and the NOA group had a higher abortion rate (18.2% vs. 12.5%), with no statistical significance. Part II: data showed lower fertilization rate results for NOA when compared to FE (75.5% vs. 83.7%), (P<0.05). There was no statistical difference between OA, NOA and FE for freezing and abortion rates (P> 0.05). However, OA had a higher clinical pregnancy rate in relation to FE (50.0% vs. 35.1%), P<0.05.

Conclusion

It is assumed that ICSI cycles presented better prognosis in OA when compared to NOA and FE, because it is associated with normal parathyroid tissue and spermatogenesis.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-33. Irritability and gastric disorders may be related to alterations of male fertile pattern

DG Reis ^1,^2,^3,⁴, JR Pariz ^1,^2,^3,⁴, VS Coutinho ^1,^2,^3,⁴, RAC Monteiro ^1,^2,³, J Hallak ^1,^2,³

Abstract

Objective

To correlate gastritis, burning, reflux and higher irritability behavior with hormonal, seminal and sperm functional parameters.

Methods

Medical records of 432 patients (22 to 69 y.o.), between 2000 and 2016, in which anamnesis revealed clinical data of gastritis, gastric burning, reflux and irritability, were correlated with semen analyzes, sperm functional tests and sex hormones profile. The Pearson's correlation coefficient test (P<0.05) was used to evaluate the correlations between the study data.

Results

We observed negative correlation between gastritis and non-progressive spermatozoa (-0.134; P=0.006) and the presence of anti-spermatozoa antibodies (-0.189; P=0.008); and a positive correlation with spermatozoa with abnormal morphology (0.191, P<0.001), round cell concentration (0.312, P=0.001) and reactive oxygen species (ROS) in seminal plasma (0.644, P=0.032). When evaluating burning sensation in stomach, there was positive correlation with seminal ROS (0.853; P=0.002) and IGBP-3 (1,000; P=0.0003). In addition, irritability showed a positive correlation with seminal pH (0.148, P=0.006), spermatozoa with abnormal morphology (0.124, P=0.012), spermatozoa with normal morphology (Kruger) (0.126, P=0.012), and TSH; P=0.016). Of the patients evaluated with gastric burning, 31.12% use some type of medication.

Conclusion

Our results indicate that irritability and gastric disturbances are related to the parameter that determines the male fertile pattern. We advocate a hypothesis of habits such as self-medication, the indiscriminate use of omega, diet and effects, as well as negative effects on male fertility, contributing to an increasing incidence of male infertility.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-34. The freezing of eggs and the preservation of genetic heritage in face of the new sexual identity configurations

NP Oliveira ¹, MIR Kullmann ¹, CG Basso ¹, J Chagas ¹, S Mattiello ¹, CG Dutra ¹, N Frantz ¹

Abstract

Introduction

The acceptance of diversity in sexual identities, the development of surgical techniques and hormonal treatments associated with the recent advances in the preservation of gametes and embryos, presents, in current clinical consultations, unusual opportunities to collaborate with the new configurations formed in family and couples relations.

Case report

A 19-year-old transsexual patient, BMI 31, with polycystic ovary syndrome and HAM of 5.54, came to consult with her mother to freeze her eggs before starting a hormonal treatment for sexual reassignment. Ovarian stimulation was performed with recombinant FSH. GnRH antagonist in the flexible protocol was prescribed for LH wave blocking. For oocyte maturation, 2 injections of agonist analogue of GnRH were applied, 36 and 24 hours prior to follicular puncture. The patient responded to the stimulation with more than 30 follicles, and collected 43 eggs from these 38 M2 (metaphase II) that were vitrified with standard protocol (Ingamed Ltda). In the intersubjective relationship of the mother to the daughter it was not evident who would have originally desired to preserve the genetic heritage. Their decision was accepted by the team as an option for the future.

Comments

The factors of identity and individual desire of each one, regarding the expectations for later use of the eggs, was not specified. Many questioning factors still arise in the face of these new configurations, encouraging the multidisciplinary team to constantly study and update.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-35. The impact of nutrition on the assisted reproduction success

MIR Kulmann ¹, RL Silvestrim ¹, NP Oliveira ¹, CG Basso ¹, GN Frantz ¹, C G Dutra ¹, N Frantz ¹

Abstract

Introduction

The impact of nutrition on the assisted reproduction success.

Case report

The couple sought treatment for the first time in February 2016. She, 31 years old, was diagnosed with Marfan Syndrome. He, 32 years old, had normal seminal parameters, elevated BMI, and history of bariatric surgery (2010). The couple purpose was to perform a Pre-implantation Genetic Diagnosis (PGD) to avoid the transmission of the genetic condition. The first follicular puncture (July, 2016), resulted in 9 MII oocytes, of which only 2 fertilized. The embryos did not reach the blastocyst stage and, therefore, there was no embryo biopsy. Before further attempt, nutritional monitoring was suggested. The couple was advised to avoid consumption of sugars, margarine, gluten, soy, soft drinks and processed juices and reduce the use of coffee and flours. On the other hand, they were instructed to consume nuts, almonds, fruits, vegetables, olive oil and to supplement omega 3, vitamin D and probiotics. During nutritional treatment, she maintained BMI within normal range and he receded one degree in the pattern of obesity (from obesity II to obesity I). In November 2016, the couple obtained 14 MII oocytes, 10 fertilized and 7 biopsied blastocysts. The embryos were vitrified (Ingámed Ltda) for future transfer. The genetic diagnosis verified that 3 embryos were free of the mutation under consideration. In February 2017, 2 blastocysts were devitrified (Ingámed Ltda) and transferred. After 12 days, the Beta-HCG test was positive and a single gestation was confirmed by ultrasound, currently having 20 weeks.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-36. Does the time interval between seminal liquefaction and cryopreservation interferes in the cell viability?

AM Giusti ¹, JX da Silva Neto ¹, D Lutz ¹, RA Salvador ¹, D Till ¹, A Senn ¹, VLL Amaral ¹

Abstract

Objective

To analyze the effect of time on pre-cryopreservation spermatic viability.

Methods

Samples from eight normozoospermic donors were analyzed by means of sperm parameters (motility and vitality) and classified (A-G) according to tail edema through the hyposmotic test (HOST). Each sample was divided into 3 groups (T0, T1 and T2), cryopreserved at the times: zero, one hour and two hours after liquefaction, respectively. The diluting medium Ingá Sperm Freezing (Ingámed^®) was used at a 1:1 ratio and the samples packed in 0.5mL straw. The straws were kept under refrigeration for 20 minutes (4±2°C), 10 minutes in liquid nitrogen vapor and stored in a cryogenic cylinder. The straws were thawed and heated for 30 minutes (37°C) and unpacked in heated medium Washing mHTF (Life Global^®) supplemented with 10% Ingámed Serum (Ingámed^®), centrifuged for 5 minutes at 1500 rpm, the supernatant removed and resuspended in the same medium. After incubation at 37°C for 5 minutes, the same initial parameters were analyzed.

Results

Progressive motility, total motility and vitality of fresh sperm presented a gradual decrease with time. The mean rates of recovery of postcryopreservation total motility were higher (P=0.02) for group T0 (38.9%) than T1 (22.6%) and T2 (24.3%). Recovery rates of vitality did not differ between groups. In the HOST test, no differences were observed between groups as to the class of spermatozoon tail edema.

Conclusion

The longer time interval, post-liquefaction, interferes negatively in the recovery rates of post-cryopreservation total motility.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-37. Fertility preservation of male oncological patients: seminal quality assessment and assisted reproduction results

L Lopes ^1,², C Nogueira ¹, R Ambar ^1,², G Pires ², R Spirandelli ², G Seixas ¹

Abstract

Objective

Seminal cryopreservation is a fertility preservation option for male patients with diagnosis of neoplasms who may have some damage in spermatogenesis due to cancer treatment or the disease itself. Some recent studies show results regarding pre-freezing and assisted reproduction seminal quality in cases of oncological patients preservation.

Methods

We analyzed a database of 176 patients who opted for seminal cryopreservation after neoplastic diagnoses from 2005 to 2017.

Results

They are usually referred by urologists with 40.14% (diagnosis of testicular or prostate cancer). About 17% required assisted reproduction treatment after an average period of 3 years after freezing, but only 7.38% used the preserved semen. The seminal quality varied according to the type of neoplasia, about 19.3% had already presented alterations in the volume and 39.7% of the patients had alteration in the seminal concentration. In 27 cycles of assisted reproduction, 6 pregnancies were obtained, at a rate favoring in vitro fertilization with ICSI of 28.57%. No pregnancy was obtained with intrauterine insemination cycles. We observed a low number of referrals from non-urological patients for the preservation of oncological patients fertility.

Conclusion

There was a relative low utilization of the preserved gametes in assisted reproduction, however the results obtained were satisfactory once that most of these patients already had some initial seminal alteration. Nevertheless, we should encourage and guide patients to the option of cryopreservation as maintenance of the fertile potential of these individuals.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-38. WITHDRAWN

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-39. Testicular pathology is not altered in obese infertile men who present semen analyses, sperm functional tests, electron microscopy and testis histology in obese infertile patients

C Ranéa ^1,^2,^3,⁴, JR Pariz ^1,^2,^3,⁴, VS Coutinho ^1,^2,^3,⁵, DG Reis ^1,^2,^3,⁵, RAC Monteiro ^1,^2,^3,⁴, IMI Ciccone ^1,^2,^3,⁴

Abstract

Objective

To evaluate the effect of obesity (BMI and body fat percentage evaluation) in seminal and functional parameters, testicular histology and hormonal profile.

Methods

We included data from 83 medical records of infertile patients aged 21 to 45 y.o., classified according to body fat percentage (BFP) according to bioimpedance values [eutrophic ≤19% (n = 27), high ≥19%(n = 56)] and BMI [eutrophic (n = 34; 18.5≥ BMI ≤24.9kg/m²), overweight (n = 31; 25.0≥ BMI ≤29.9 kg/m²) and obesity (n = 18; BMI ≥30 kg/m²). Patients were submitted to semen analysis and complementary sperm function tests: anti-sperm antibodies (ASA), creatine kinase activity (CK), reactive oxygen species (ROS) and ultrastructural morphology by electron microscopy (EM). Testicular histology according to Johnsen and Copenhagen criteria and sexual hormones were included. Were used Student's T test and analysis of variance for statistical analysis.

Results

Grade A motility decreased in overweight and obesity groups when compared to the eutrophic group. Grade C motility increased in overweight and obesity groups, compared to the control group. We observed an increase in percentage of anti-sperm antibodies in the overweight group (P<0.05). Patients with BFP >19% had a reduction in progressive motility and reduced sperm maturation by CK activity (P<0.05). We did not observe significant alterations in the hormonal profile, testis histology and maturation of sperm chromatin in patients with excess of fat tissue.

Conclusion

Excessive body fat has a negative effect on the final steps of spermatogenesis, demonstrated by reduced total progressive motility, increased forms of immature sperm and high anti-sperm antibodies.

Financial support

Androscience/CNPq - PIBIC.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-40. Psychologist's labor perceptions of their work in clinics of assisted reproduction in Curitiba

M Carvalho ¹, RC Cruz ¹

Abstract

Objective

Infertility treatment needs multidisciplinary work, in which psychology's importance is emphasized as a working area in this context. Objective- to analyze psychologist's perception about their work in clinics of assisted reproduction.

Method

qualitative study by means of semi structured interview and application of a scale about the involvement with work, with 5 psychologists who work in clinics of assisted reproduction or do their activities by indication of health professionals, family or patients, in a private office. The testimonies were transcribed and analyzed, establishing categories after it.

Results

all participants were women, they showed satisfaction and positive involvement with their work. The aspects noticed as positives were: work with people, moment of listening, vitalization and the goal of pregnancy achieved. The negative points were: no appreciation of psychology, goal of pregnancy not reached and frustration. The challenges described were prejudice and lack of time for study and update. Four participants perceived the psychology as an influence to a better patient's prognosis, through the level's improvement of stress/anxiety and for offering a space of listening. One participant perceived the improvement of life's quality with no relation with the results obtained in infertility treatment.

Conclusion

all participants perceived positively their work in clinics, however, the biggest difficulty was the lack of professional appreciation. They point to the disciplinary integrity as essential and that their work is fundamental, improving the patient's anxiety, stress and quality of life. Maping out psychologist's perceptions in this area is important for reflection and think other ways of intervention.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-41. Polymorphisms of the GSTT1 and GSTM1 genes and polycystic ovarian syndrome

M Azevedo ¹, M Gomes ¹, T dos Santos ¹, M Balarin ¹, M F Lima ¹, E Resende ¹, M Cintra ²

Abstract

Objective

This study aimed to identify the association between GSTT1 and GSTM1 deletion polymorphisms with polycystic ovary syndrome (PCOS).

Methods

The study was approved by the UFTM Ethics Committee. This study analyzed the GSTM1 and GSTT1 polymorphisms of 219 women (110 patients with PCOS and 109 controls). Patients with Polycystic Ovarian Syndrome were diagnosed according to the Rotterdam criteria. The blood samples was collected from the participants and the genomic DNA was extracted by the phenol:chloroform:isoamylic method. The analysis for the deletion polymorphisms of the GSTT1 and GSTM1 genes was performed by the multiplex polymerase chain reaction, the PCR products were analyzed on 1.5% agarose gel. The 480 bp band corresponded to the presence of the GSTT1 gene, the 312 bp band corresponded to the CYP1A1 gene control of reaction, and the 219 bp band corresponded to the presence of GSTM1 gene. The data were compared by the Chi-square test, and the significance level was set at 5% (P<0.05).

Results

The frequency of the polymorphisms did not show differences between patients and controls for GSTM1 (X² = 1.73, P=0.24) and GSTT1 (X²=0.12, P=0.85). The analysis of the combined genotypes also did not present significant differences (X²=2.59, P=0.46).

Conclusion

In the sample examined, there is no association between polymorphisms of GSTM1 and GSTT1 genes and Polycystic Ovary Syndrome.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-42. Fertility preservation in patients with breast cancer

AK Bartmann ^1,², LFI Silva ^2,³, PRCGP Souza ¹, H Gomes ¹, L Gonçalves ¹, RS Gomes ¹, FN Melo ¹, AL Fernandes ¹, ACS Matthes ¹

Abstract

Objective

Breast cancer is the second most common type of cancer in women in Brazil and worldwide. The treatment is based on surgery and chemotherapy/radiotherapy and often results in ovarian failure. Women of childbearing age who survive the disease express reproductive desire, which is why providing preservation of fertility has become of vital importance.

Objective

To carry out a review on the fertility preservation of patients with breast cancer and to propose a tool of easy research that guides oncologists and specialists in Assisted Reproduction.

Methods

A bibliographic review of articles on the subject was carried out in databases: MEDLINE, LILACS, SciELO, Cochrane and PubMed. We found 534 articles between years 2010 and 2017. We chose 20 articles considered relevant and with a higher level of scientific evidence.

Results

From the analyzed articles, we can deduce that 1) there are several chemotherapy regimens for breast cancer that are classified according to the risk of developing ovarian failure in: high, intermediate, low, very low or no risk and risk unknown; And that, 2) there are currently 5 fertility preservation methodologies that are offered according to woman's age: cryopreservation of embryos, oocytes or ovarian tissue, oophoropexy and ovarian function drug suppression.

Conclusion

There is a clear need for women who will undergo chemotherapy and/or radiotherapy to be aware on the risks of ovarian failure, as well as oncologists and mastologists.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-43. Proposal for a check list of safe surgery applied to a center of reproductive medicine

G Soares ¹, B de Mattos ¹, FS Corrêa ¹, BRM Morais ¹, A de Souza ¹

Abstract

Objective

To propose a checklist to perform safe surgery in a Center of Reproductive Medicine, drawing a connection between the bibliography and the professional experience.

Methods

This is a bibliographical survey, searching on books, articles and documents published by the WHO, Ministry of Health and Anvisa carried out in the Virtual Health Library database using the descriptor "safe surgery".

Results

The concept of safe surgery involves measures adopted to reduce the risk of adverse events, that is, incidents that result in harm to the patient and that may occur before, during and after surgeries. Safe and quality care is necessary in the way to obtain National and International Accreditation. This checklist was constructed based on the ten goals of safe surgery described in the WHO Safe Surgery Protocol, 2008, focusing on the three verification times: SIGN IN (prior to anesthetic induction), TIME OUT (before incision), and SIGN OUT (before the patient leaves the operating room) facing the type of surgical activity of a Human Reproduction Center.

Conclusion

The construction of a practical instrument that can be followed as a checklist to guide the implantation of safe surgery, thus improving the quality of care provided. The next step will be to promote the engagement of the clinical and nursing staff, to validate the instrument and measure the patient's perception.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-44. Screening of Zika Virus in asymptomatic patients to be submitted to Assisted Reproduction Techniques in Curitiba

RD Delle Donne ^1,², MP Bonow ^1,², JA Lucca ¹, VB Rosa ¹, CM Hillesheim ¹, AG Schuffner ¹

Abstract

Objective

To evaluate the results of the screening tests for Zika virus carried out by infertile couples in Curitiba.

Methods

Collection of the results of the screening tests for Zika virus carried out by infertile couples in a private clinic in the city of Curitiba. Results of serology (IGM) and PCR performed between April/2016 and March/2017 were included.

Results

There were 351 serologies (IGM) in the period. Of these, 342 (97.4%) were negative, three (0.9%) were positive and six (1.7%) were indeterminate. Of the nine PCR tests performed, all were negative. The three serologies (IGM) positive were from different patients, none had the disease confirmed after the follow-up, as well as in patients with undetermined serology.

Conclusion

Until February 2017, more than 70,000 Zika cases were reported in Brazil. In 2016 the incidence was drastically lower in the South region (1/100 thousand inhabitants) than in the Central-West, Southeast, Northeast and North regions (101.6, 37.6, 34.9 and 16.8/100 thousand inhabitants respectively). A study in the Southeast region found a similar proportion (1.3%) of positive serologies and the cost of the tests was equivalent to 1.2 days of treatment with drugs for ovarian stimulation. In addition to the financial question, screening in asymptomatic patients may lead to delayed treatment initiation. In some cases, this delay can lead to worse results and to greater anxiety in patients. Thus, the validity of disease screening for asymptomatic patients is questioned, especially in a region where the incidence of the disease is much lower.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-45. Case report of Zika Virus during the controlled ovarian hyperstimulation: results from oocytes

E Araújo Filho ¹, CL Fácio ¹, LA Machado-Paula ¹, CD Martinhago ², LF Previato ¹

Abstract

Introduction

Zika virus (ZIKV) is transmitted by Aedes aegypti, first report in Brazil in 2015.

Case report

A 37-year-old female, indicated for in vitro fertilization (IVF) due to bilateral tubal factor, initiated ovulation induction on day 2 of the menstrual cycle. One day later, she traveled with her mother and sister, taking the medications. She returned and came to ultrasound on day 5 of the medication, showing skin rash on the trunk and legs, spreading to limbs. She reported that her mother and sister began same symptoms. Patient had 37°C, mild low back pain and joint pain no significant. Complete blood count (CBC) did not show platelets and leukocytes alterations. It was drawn blood of the patient and husband to test ZIKV by PCR. She offered to follow treatment until oocyte aspiration, as far as the clinic took care of the spendings. Oocyte aspiration was made 36 hours after hCG administration. It was retrieved 7 oocytes in MII stage donated for study. PCR results for ZIKV in the blood was positive for her, and negative for husband, showing that he was not infected sexually. Analysis of oocytes was performed using RT-PCR in real time to detect RNA of the ZIKV. The results were positive for 2 oocytes which RNA of the ZIKV was present.

Comments

This result shows the importance of testing the couples submitted to assisted reproduction techniques because the risk of contaminating the embryo is real. This is the first report in the literature.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-46. Case report: dizygotic twin pregnancy after transfer of a single embryo

PA Manfroi ¹, TG de Carvalho ¹, S Galbinski ¹, A Nacul ¹, LPC Baptista ¹

Abstract

Introduction

Single embryo transfer (SET) is a reasonable option to avoid multiple pregnancies in patients who undergo assisted reproduction treatment. However, in rare cases, multiple pregnancies can occur even after SET. Even rarer are cases of dizygotic twins resulting from this procedure.

Objective

To describe a case of dizygotic twinning following a single fresh embryo transfer after intracytoplasmic sperm injection (ICSI).

Case report

A 39 year-old woman and her 42 year-old partner (with normospermia) had an 11 years history of infertility. The couple had a 13 years-old son. Her medical history revealed endometriosis and tubal pathology. After ovarian stimulation with FSH, hMG and GnRH, ICSI was performed in two oocytes. One of them had normal fertilization and was transferred on day 2. We report a dizygotic twin pregnancy after a single embryo transfer. One male and one female infants were delivered by cesarean section at 37 weeks of gestation. The boy was born weighing 2,735 g and the girl 3,330 g.

Comments

Although in general twin pregnancies following SET are considered to be monozygotic, this case was diagnosed as dizygotic because of the different infant sexes. This is probably explained by a spontaneous pregnancy occurring during treatment. Because of the known risks associated with multiple pregnancies, cases like these highlight the importance of contraception or sexual abstinence during the treatment period.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-47. Oncofertility: case report

MM dos Santos ¹, GA Brum ¹, HM Nakagawa ¹, AA Silva ¹, ACP Barbosa ¹, JR Iglesias ¹

Abstract

Introduction

Due to technological advances in oncology, providing early diagnosis and treatment, we are faced with a higher cure rate, allowing these women the opportunity to raise offspring and fulfill the dream of being a mother. We will exemplify two cases with favorable outcomes.

Case report

R.T.C, 35 years old, had mastectomy after breast cancer, and was attended for oocyte cryopreservation before radiotherapy. A protocol with leuprolide and FSH-r 150UI and hCG-r 250mcg was used, and 21 eggs were retrieved and vitrified at MII stage. She returned for cryotransfer and estradiol valerate protocol 6mg/day was prescribed for endometrial preparation. Three D3 embryos were transferred with BHCG negative result. An year later, a new attempt was made with the same protocol and cryotransference of 3 embryos in D3 resulted in BHCG positive and a twin pregnancy was obtained with cesarean section due to premature amniorrexis at 30 weeks. The offsprings weighted RN1 1,2 kg and RN2 1,4 kg. Neonatal ICU was necessary for about one month.

C.I.N, 36 years old, had left breast cancer, was going through chemotherapy and came for egg vitrification. She was submitted to an antagonist protocol with FSH-r 225UI and hCG-r 250mcg for trigger. Eight eggs were vitrified in MII stage. She returned for cryotransfer and in the third trial she used estradiol valerate 6mg/day and transdermic estradiol 50mcg 3/3 days. Three D3 embryos were transferred with BHCG positive and resulted in a single gestation with cesarean section at 37 weeks and 6 days, the healthy offspring weight was 2,520kg.

Comments

Assisted reproduction techniques came to guarantee a reproductive future for patients with neoplasias who will undergo antineoplastic treatments.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-48. ABSTRACT UNDER PRESS EMBARGO

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-49. Reversing vasectomy pre-IVF improves outcomes?

C Nogueira ¹, IH Yoshida ^1,², LS Lopes ^1,², FL Vilarino ¹, EB Cordts ^1,², WAP de Carvalho ^1,², CP Barbosa ^1,²

Abstract

Objective

To compare the results of fertilization and pregnancy rates among couples who did or did not reverse the vasectomy pre IVF.

Methods

A retrospective study was conducted between January 2010 and December 2016. 152 couples were selected and separated into 2 groups: Group 1: patients who reverted vasectomy pre-IVF (n=46) with masturbation or PESA collection. Average female age was 33 years old. Group 2: patients who did not reverted vasectomy (n = 106) and underwent PESA. Average female age was 34 years old. The rates of fertilization and pregnancy were evaluated.

Results

The Group 1 fertilization and pregnancy rate was 67% and 37%, and Group 2, 68% and 34%, respectively. There was no statistically significant difference between groups.

Conclusion

Although the patients in Group 1 performed the vasectomy reversal pre-IVF, in some cases it was still necessary to perform the PESA. Therefore, performing the reversal does not appear to be clinically advantageous, nor does it improve clinical and laboratory results.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-50. Next generation sequencing in blastocysts of young woman with translocation in critical region XQ: case report

IH Yoshida ^1,², M Santos ^1,², MS Tanada ¹, CZ Berton ¹, EB Cordts ^1,², WAP de Carvalho ^1,², CP Barbosa ^1,²

Abstract

Introduction

The genes present on the X chromosome are essential for normal ovarian function. The "critical region Xq" comprises from Xq13 to Xq28 and translocations in such regions may result in the deregulation of gene expression causing defect in ovarian formation. Patients with these translocations have 18% of probability to obtain euploid embryos. Because of that, the objective of this paper is to describe the case of a patient undergoing IVF treatment with chromosome translocation, 46, XX, t (9; X) (q22; q28).

Methods

Female gender patient, 29 years old, married, menarche at 12 years, with regular cycles of 04 days and without any gynecological surgery. It has a karyotype 46, XX, t (9; x) (q22; q28) presenting a secondary infertility. The couple underwent IVF treatment. 14 MII oocytes were collected and fertilized by ICSI. Embryos were taken for extended culture and 5 (35.7%) became blastocyst. All were submitted to biopsy and vitrification. The biopsied cells were stored in appropriate solutions and sent to the genetic analysis laboratory for next generation sequencing (NGS).

Results

Four blastocysts (80%) were diagnosed with aneuploidy and one (20%) 46, XX. The embryo transfer has not been performed yet.

Conclusion

PGD is critical for couples with chromosomal abnormalities. The young age of the patient allowed a greater number of oocytes collected, resulting in a greater chance of obtaining a healthy blastocyst.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-51. Should gynecologists routinely request AMH and counsel patients on family planning?

M Höher ¹, MIR Kulmann ¹, M Fortis ¹, A Bos-Mikich ², N Frantz ¹

Abstract

Objective

To assess the proportion of women, based on AMH exam, that may be at risk of a diminished ovarian reserve.

Methods

This is a retrospective cohort study of 432 women who attended a gynecologist appointment at a private fertility clinic and performed serum AMH measurement between January 2013 and December 2016. These patients were selected in order to mimic the general population of women in reproductive age.

Results

Most prevalent infertility reasons were male factor (39.6%), tubal factor (34%) and endometriosis without ovarian endometrioma (19.7%). Independently of age, 26.8% of the patients presented serum AMH levels below the 25^th percentile, considered the cut point of ovarian reserve. More importantly, 10.4% of the women were classified below the 10^th percentile, which means that their ovarian reserve was reaching a critical point. Interestingly, all age groups had significant proportions of women below these critical percentiles. In the <30 years old group, 20.8% and 12.5% of women were respectively below the 25^th and 10^th percentiles. The percentage of women in other age groups classified below the critical percentiles (25^th and 10^th) were respectively: 21% and 10.1% (30-34 years old group), 23.9% and 9.8% (35-40 years old group), and 41.2% and 10.8% (>40 years old group).

Conclusion

This study strongly suggests the inclusion of AMH exam in the gynecologists routine practice for all patients in reproductive age that wish to establish their own biological family, regardless whether they are younger than the critical age point of 35-37 years.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-52. D-Mannose binding sites: the amount is more important than expression pattern?

CF Silveira ¹, LG Bahamondes ¹

Abstract

Objective

The potential for fertility has declined in the world and in Brazil. There was a need to reassess the patterns of seminal normality according to WHO data in its last edition. For the laboratory, it is well known that there is a need to complement the seminal evaluation with functional tests. One of the tests is the expression of the D-mannose binding sites. Its expressed on the sperm plasma membrane after biochemical and molecular modulations during the capacitation allowing the interaction with the oocyte and consequently the acrosomal reaction and then the penetration, thus concluding the fertilization process. But the literature in the last 30 years has failed to establish a marking pattern for fertile patients that could be confronted with the markings appearing on semen samples from sub-infertile or infertile men. From these considerations our aim was to bring together the types of expression patterns of D-mannose binding sites along with the acrossomal integrity observed in sperm from fertile men.

Methods

To do so, we carry out a review of the literature through expressive sites such as Lilacs, Pubmed and Virtual Health Library, using the keywords.

Results

Our result was to find different expression patterns, but one fact caught our attention: subfertile groups as candidates for in vitro fertilization, with low morphology and/or varicocele, also presented expression D-manose binding sites, but they were not able to maintain the acrosomal integrity, independently of the incubation time.

Conclusion

We conclude that the functional test may be feasible if, instead of the studies attempting to standardize a type of labeling, they were able to quantify the expression D-manose binding sites along with the acrosomal integrity.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-53. The use of preimplantation genetic diagnosis-PGD to avoid materno-fetal blood group incompatibility in RH-sensitized women

CD Martinhago ¹, MA Oliveira ¹, AMM Dias ¹, GS Pereira ¹, AM Azzolini ¹, PRQ Estrada ¹, KRN Endo ¹

Abstract

Introduction

The use of preimplantation genetic diagnosis-pgd to avoid materno-fetal blood group incompatibility in rh-sensitized women.

Case report

Case one, the patient was homozygote for Rh Ce alleles and her husband presented Rh Ce and Rh cE alleles. The patient was sensitized with the c antigen by blood transfusion and consequently had anti-c antibodies. Case two, the patient presented RHD negative phenotype (Rh-negative), her husband had RHD positive phenotype (Rh-positive), they had a child with RHD positive phenotype (Rh-positive), whom alloimmunized the patient with D antigen once she was not given the anti-D injection. In both cases, the couple wanted to select embryos to avoid perinatal haemolytic disease caused by incompatibility of the Rh system of maternal and fetal blood. DNA was collected from couples for genetic linkage study and haplotype determination. The couple sought an assisted human reproduction laboratory to undergo in vitro fertilization. Pools of cells from blastocysts were collected and sent for analysis at Chromosome Medicina Genômica Laboratory were embryos were genotyped. The comparison between genotypes allowed the determination of Rh alleles from each embryo and they also were subjected to preimplantation genetic screening (PGS) by next-generation sequencing. In case one, the couple had 2 embryos, only one with Rh alleles compatible to implantation, but the preimplantation genetic screening revealed aneuploidies in both embryos, so none of them was transferred to uterus. In case two, the couple had 1 embryo with Rh alleles compatible to mother's blood and also normal for PGS, chosen for transfer. Patient got pregnant confirmed and RHD negative fenotype was confirmed using cell-free fetal DNA.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-54. Time interval between hCG administration and ICSI does not affect blastocyst formation nor reproductive outcomes after blastocyst transfer

MW Barbosa ^1,², MM Santos ¹, GA Brum ¹, HM Nakagawa ¹, IO Cabral ¹, SS Soares ¹, WP Martins ³

Abstract

Objective

To evaluate the influence of time interval between human chorionic gonadotropin (hCG) administration and intracytoplasmatic sperm injection (ICSI) in the development of blastocyst.

Methods

Retrospective cohort study. Inclusion criteria was fresh blastocyst embryo transfer performed between January 2015 and December 2016 at a private center for assistance in human reproduction. Results in each group were stratified according to the time interval between hCG and ICSI: 38-40h (n=21) and 40-42h (n = 17). Main outcome measures were blastocyst formation rate and live birth rate per cycle. Statistical analysis were performed by Mann-Whitney test and relative risk (RR), with the precision of the estimates assessed by the 95% confidence interval (CI).

Results

Median patient age was higher in the group 40-42h (38 vs. 34, P=0.01). Number of oocytes aspirated per patient, number of oocytes injected per patient and number of embryos transferred were not statistically different between groups. The overall blastocyst formation was not different between the two groups: RR=0.95 [CI 95% 0.74, 1.22]. The total cycle efficiency (percentage of embryos transferred and frozen per two pronuclei [2PN]) was comparable for the two time intervals: RR=0.96 [CI 95% 0.74, 1.25]. There was no significant difference in the live birth rate between the two groups: RR=0.67 [CI 95% 0.31, 1.44].

Conclusion

Time interval between hCG administration and ICSI does not affect blastocyst formation rate, neither reproductive outcomes after blastocyst embryo transfer.

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-55. ABSTRACT UNDER PRESS EMBARGO

JBRA Assist Reprod. 2017 Jul-Sep;21(3):276–292.

P-56. Ovarian tissue vitrification is more efficient than slow freezing to preserve ovarian stem cells in CF-1 mice

PB Terraciano ^1,², TA Garcez ¹, I Durli ^1,², CP Kuhl ¹, LS Ayres ¹, RA Schneider ¹, J Festa ¹, E Pilar ⁴, CF Ferreira ², EP Passos ^1,², E Cirne-Lima ^1,^2,³

Abstract

Objective

This study aimed to investigate the efficacy of different mice ovary cryopreservation protocols (vitrification and slow freezing), comparing Mouse Vasa Homologue (MVH-stem cell marker) expression and viability of the ovary.

Methods

Female CF1 aged 40-45 days and weighing 29.29g±2.9 was randomly divided in three groups: control, vitrification or slow freezing. Ovaries were surgically removed after euthanasia, rinsed in saline solution and cryopreserved. The control group wasn't cryopreserved and went through the same analyses. For vitrification protocol were used the VitKit Freeze (Irvine Scientific) and for slow freeze were used Ethilene Glycol (EG) 1.5M as cryoprotectant. After 30 days, the ovaries were thawed/ warmed following specific protocol and primordial, primary, pre antral and antral follicles were count in hematoxylin-eosin slides (HE). Immunocytochemistry assay for MVH was carried out, since MVH+ and MVH-follicles were counted. The right and left ovary of the same animal were separately cryopreserved for different analysis.

Results

The slow freeze group had a higher number of not marked MVH cells (P=0.012). HE results showed no difference in the proportion of high-quality primordial, primary and pre antral follicles after thawing/warming in the slow freezing or vitrification. The antral follicle count was higher in vitrification group (P=0.004), although it displayed lower viable single cells in comparison with control and slow freeze groups (P=0.043).

Conclusion

Although both protocols showed similar results in the histological analysis for follicular counts, the vitrification protocol was significantly better for preserving the ovarian stem cell population.

PERMALINK

Abstracts of the 21th Annual Congress of the SBRA, São Paulo/SP, 02-5 August 2017

P-01. Guar gum improves human semen quality after crio-preservation

FG Valverde

CS Souza Neto

SMR Jacinto-Costa

E Caldas

GHC Silveira

RLC Albuquerque Júnior

FF Padilha

IB Lima-Verde

Abstract

Objective

Methods

Results

Conclusion

P-02. Administration of ovulation inducing medication by the nursing team in an assisted reproduction center of SUS: lived experience report

JF Aderaldo

EJPB Nobrega

KRN Barbosa

MCGP Coelho

KM Morais

MMGT Torres

ALB Sant'Anna

MQLMM Paiva

PCS Vieira

LCA Silva

CL Freitas

ARG Aquino

Abstract

Objective

Method

Results

Conclusion

P-03. Are respiratory allergies related to male fertility?

DG Reis

JR Pariz

VS Coutinho

RAC Monteiro

J Hallak

Abstract

Objective

Methods

Results

Conclusion

Financial support

Ethics Committee Approval

P-04. ABSTRACT UNDER PRESS EMBARGO

P-05. Analysis of the age of patients seeking treatment for infertility

NT Batista

LAT Batista

LAA Batista

BS Gomes

MV Machado

Abstract

Objective

Methods

Results

Conclusion

P-06. Analysis of the polymorphism association between LH gene and its receptor with poor responder versus normo responder patients submitted to induction for in vitro fertilization

AJC Meireles

I Nascimento

JB Costa

PL Lorenzzoni

F Nascimento

JP Bilibio

TB Gama

Abstract

Objective

Methods

Results

Conclusion

P-07. Analysis of the polymorphism association between antimullerian hormone gene (AMH) and its R2 receptor (AMHR2) with poor responder patients versus normo responder submitted to induction for in vitro fertilization

JP Bilibio

TB Gama

Y Maciel

PL Lorenzzoni

F Nascimento

JBN Sabá Junior

AJC Meireles