Skip to main content
NCBI home page
Ecology and Evolution logoLink to Ecology and Evolution
. 2017 Jun 30;7(16):6172–6187. doi: 10.1002/ece3.3153

Populations genetically rifting within a complex geological system: The case of strong structure and low genetic diversity in the migratory freshwater catfish, Bagrus docmak, in East Africa

Rose Komugisha Basiita 1,2,✉, Kyall Richard Zenger 1, Dean Robert Jerry 1
PMCID: PMC5574809  PMID: 28861223

Abstract

The complex geological history of East Africa has been a driving factor in the rapid evolution of teleost biodiversity. While there is some understanding of how macroevolutionary drivers have shaped teleost speciation in East Africa, there is a paucity of research into how the same biogeographical factors have affected microevolutionary processes within lakes and rivers. To address this deficiency, population genetic diversity, demography, and structure were investigated in a widely distributed and migratory (potamodromous) African teleost species, Ssemutundu (Bagrus docmak). Samples were acquired from five geographical locations in East Africa within two major drainage basins; the Albertine Rift and Lake Victoria Basin. Individuals (N = 175) were genotyped at 12 microsatellite loci and 93 individuals sequenced at the mitochondrial DNA control region. Results suggested populations from Lakes Edward and Victoria had undergone a severe historic bottleneck resulting in very low nucleotide diversity (π = 0.004 and 0.006, respectively) and negatively significant Fu values (−3.769 and −5.049; p < .05). Heterozygosity deficiencies and restricted effective population size (N eLD) suggested contemporary exposure of these populations to stress, consistent with reports of the species decline in the East African Region. High genetic structuring between drainages was detected at both historical (ɸST = 0.62 for mtDNA; p < .001) and contemporary (microsatellite F ST = 0.460; p < .001) levels. Patterns of low genetic diversity and strong population structure revealed are consistent with speciation patterns that have been linked to the complex biogeography of East Africa, suggesting that these biogeographical features have operated as both macro‐ and micro‐evolutionary forces in the formation of the East African teleost fauna.

Keywords: aquaculture, Bagrus, genetics, Lake Victoria, microevolution

1. INTRODUCTION

East African freshwater systems possess a diverse teleost fauna shaped by a complex geological history, including large‐scale tectonic movements, volcanic activity, and significant uplifting (Danley et al., 2012; Sturmbauer, Baric, Salzburger, Rüber, & Verheyen, 2001; Verheyen, Salzburger, Snoeks, & Meyer, 2003). The East African Rift (EAR) Valley, which was formed by tectonic uplift, is the major geological structure that has forged the general hydrographical network in Africa (Giddelo, Arndt, & Volckaert, 2002; Pinton, Agnèse, Paugy, & Otero, 2013) and created various freshwater habitats. For instance, major continental river systems were particularly impacted by the regional uplift, including the Nile, Congo, and Zambezi Rivers (Baker & Wohlenberg, 1971; Roberts et al., 2012). Evolutionary and geological processes such as fragmentation, hydrological connectivity, river reversal, and desiccation, among others (Danley et al., 2012; Johnson et al., 1996; Russell & Johnson, 2001), were responsible for the creation and maintenance of these habitats in which substantial numbers of aquatic taxa were isolated.

Freshwater lakes and rivers within the EAR (i.e., Lake Edward, Lake Albert, Lake George, Lake Tanganyika, Lake Malawi), and the largest tropical freshwater body, Lake Victoria (which lies outside the EAR), are habitats to one of the world's most biologically diverse aquatic faunas. For instance, prior to the introduction of the Nile perch, Lates niloticus, into Lake Victoria, the lake had between 350 and 600 endemic cichlids (Helfman, 2007; Turner, Seehausen, Knight, Allender, & Robinson, 2001). Geological evidence suggests a former connection of Lake Edward to Lake Victoria by late Pleistocene rivers, which were subsequently truncated by uplifting causing river reversal and a break in connectivity of lake systems (Lévêque, 1997). Presently, connectivity of these lakes is restricted to Lake Edward, which is connected to both Lakes George and Albert (via the Kazinga Channel and Semliki River, respectively). The Lake Edward‐George system provides a biogeographic confluence between the Victorian and Albertine freshwater fauna (Thieme et al., 2005). Despite this hydrological connectivity between lakes in the EAR through rivers and channels, biogeographic barriers are evident including the Semliki rapids and falls, which descends 300 m from Lake Edward to Lake Albert (Lowe‐Mcconnell, 1993, 2009), although Greenwood (1966) considers these Semliki rapids as inefficient barriers. To the right of Lake Albert are the Murchison Falls along the Victoria Nile River, another biogeographical barrier separating the Albertine rift system (includes Lakes Edward, George and Albert) from Lake Victoria. This barrier has been documented as an effective obstacle in preventing, for instance, Nile perch stocks in Lake Albert from migrating into Lakes Kyoga and Victoria (Basiita et al., 2011; Hopson, 1972).

Africa's freshwater systems are degrading at a very high rate with over 80 species listed as critically endangered, 116 species endangered and up to 103 threatened (Thieme et al., 2005). As elsewhere in Africa, the unique East African teleost faunas in both riverine and lacustrine freshwater habitats are currently under threat due to natural and anthropogenic pressures, with many species experiencing rapid population declines. Relative to other environments, biodiversity declines are at their highest in freshwater lacustrine bodies owing to the level of compartmentalization that naturally exists among these large water systems (Ricciardi & Rasmussen, 1999). The natural divides of freshwater bodies over evolutionary timescales seemingly deem them important as far as defining management units for biodiversity. Any interventions such as aquaculture developments, restocking existing water bodies, fishing zoning, and breeding grounds that are geared toward mitigating the declines resulting from natural and anthropogenic pressures need to take into account evolutionary significant units in the region.

Although numerous studies have looked at fish diversity, composition, and endemism, to understand biogeographic processes and speciation in Africa (Craig, 1992; Elmer et al., 2009; Pinton et al., 2013; Sato et al., 2003), very few fish studies have looked at genetic signatures left by biogeographical processes below the level of species (i.e., among populations). Unraveling antecedent genetic signatures among populations may not only help understand the processes that have led to their evolution and adaption in recent timescales, but more importantly, will assist with the identification of genetically divergent populations and/or evolutionally significant units that can be integrated into the formation of contemporary management plans.

Bagrus docmak (Ssemutundu) is a freshwater catfish with a widespread distribution in African freshwater rivers including the Nile, Chad, Niger, Volta, and Senegal. It is also found in Lake Victoria as well as the Rift Valley Lakes Edward, George, Albert, Tanganyika, Malawi, and Turkana (Aruho, Basiita, Kahwa, Bwanika, & Rutaisire, 2013; Golubtsov, Darkove, Dgebyadze, & Mina, 1995; Goossens, 2015; Greenwood, 1966; Mwanja et al., 2014). The fish species is potamodromous migrating from lakes to rivers during rainy seasons and from deep waters to shallow sandy bottoms to spawn (Chapman et al., 2012; Thieme et al., 2005). Bagrus docmak is an important species currently commercially fished from the wild, but also is a species with high aquaculture potential, largely because of its attractive attributes including size, taste, flesh quality, and overall commercial importance (Alhassan & Ansu‐Darko, 2011; Aruho et al., 2013; Mwanja et al., 2014). Bagrus docmak used to be listed as threatened by the IUCN, and the species’ overall population status where it occurs is currently unknown. Additionally, the natural populations of this species are in decline and are under threat, especially in East Africa where the species has become very rare (Aruho et al., 2013). Population declines of B. docmak are a result of environmental and anthropogenic pressures, such as introductions of exotic species (i.e., Nile perch, Lates niloticus) and habitat degradation (Chapman & Chapman, 2003; Chapman, Chapman, Kaufman, Witte, & Balirwa, 2007; Dickson, Jagwe, Longley, & Dalsgard, 2012; Hauser, Carvalho, Pitcher, & Ogutu‐Ohwayo, 1998; Kudhongania, Twongo, & Ogutu‐Ohwayo, 1992; Ogutu‐Ohwayo, 1990, 1993; Olowo & Chapman, 1999). Elucidation of B. docmak's population genetic structure is crucial for the species’ future management given its high conservation and commercial importance. Additionally, the species’ widespread distribution throughout Africa, along with its potamodromous migratory life history, identifies it as an ideal candidate to examine how the complex geological history of East Africa shapes evolution of the fish fauna biodiversity at below the species level.

2. METHODS

2.1. Study area

Samples of B. docmak were collected from five water systems across the species’ distribution in central East Africa (from Lakes Albert, Edward and Victoria; and Rivers Victoria Nile and the Kazinga Channel) (Figure 1). Lakes Albert and Edward are located in the western arm of the East African Rift Valley commonly referred to as the Albertine rift, while Lake Victoria is outside.

Figure 1.

Figure 1

Open in a new tab

Map showing lakes and rivers (sampling locations within East Africa) and number of individuals of Bagrus docmak collected from each location. The inset at the top right corner denotes the distribution of B. docmak across Africa

2.2. Sample collection and laboratory procedures

Fin clips of B. docmak were obtained from commercial fishers at each of the five sampling locations (Figure 1). Samples were collected under animal ethic approval number A1824 issued at James Cook University (JCU). All fin clips were preserved in 20% dimethyl sulfoxide (DMSO) saturated with sodium chloride salt (Amos, 1991; Dawson, Raskoff, & Jacobs, 1998) and transported to the Molecular Ecology and Evolution Laboratory (MEEL) in Townsville, Australia, where they were stored at −20°C until extraction. DNA extractions and polymerase chain reaction (PCR) assays were also carried out at MEEL.

Total genomic DNA was extracted using a modified CTAB protocol (Wilson, 1990) and later using the Bioline Isolate II Genomic DNA kit. The CTAB protocol involved a digestion step using a CTAB buffer with 200 μg of Proteinase K incubated at 55°C for 2 hr, followed by a 24:1 chloroform: isoamyl alcohol purification (700 μl of chloroform–isoamyl and centrifugation at 13,200 rpm for 20 min), and an ethanol precipitation (2.5× 100% EtOH: 1:10× 5 mol/L NaAce and centrifugation at 16,000 g for 30 min, 1× 70% EtOH at 16,000 g for 20 min). Genomic DNA was re‐suspended in 25 μl of 1× TE (10 mmol/L Tris–HCl, 1 mmol/L EDTA, pH 8.0). DNA quality was estimated based on 0.8% agarose gel electrophoresis, and quantity was assessed using a ND‐1000 Spectrophotometer (Nano‐Drop® Technologies). For some inhibited samples that failed to amplify during PCR, DNA was re‐extracted using a column based Bioline Isolate II Genomic DNA kit following manufacturer's protocol. Briefly the protocol involved a prelysis stage using 180 μl Lysis buffer with 25 μl of protease K incubated at 56°C. 200 μl of G‐3 lysis buffer was added and further incubated for 10 min at 70°C. 210 μl of 100% EtOH were then added to alter the buffer conditions prior to two (GW1 and GW2) buffer washes. The eluted DNA was stored at −80°C prior to downstream PCR.

DNA from 175 individuals was genotyped at 12 polymorphic microsatellite loci, Bd04, Bd18, Bd01, Bd02, Bd12, Bd09, Bd06, Bd20, Bd05, Bd03, Bd14, and Bd10 (Appendix 3) (Basiita et al. in Goossens, 2015). Forward primers were fluorescently labeled using the 5‐dye system (6‐FAM, VIC, NED, PET, and LIZ GS‐500 size standard), and all reverse primers were pigtailed (Brownstein, Carpten, & Smith, 1996) to ensure consistent amplification and minimize stuttering. A total of 20 μl PCR reactions were run on Biorad C1000 thermocycler under the following conditions: an initial denaturation at 95°C for 5 min, 6 cycles of 95°C for 30 s (denaturation)/59°C for 90 s (annealing)/72°C for 30 s (extension), 10 cycles at reduced annealing temperatures of 57, 55, and 53°C, prior to a final extension at 60°C for 30 min (Basiita et al. in Goossens, 2015). Visualization of PCR product was performed on an ABI‐3730 instrument (Applied Biosystems) using a 5‐standard dye system (6‐FAM, VIC, NED, PET, and LIZ GS‐500 size standard) at the Georgia Genomics Facility, USA. Alleles were scored using Genemarker 2.4 (Softgenetics), and checked for genotyping errors and null alleles in Microchecker 2.2.3 (Van Oosterhout, Hutchinson, Wills, & Shipley, 2004).

The Mitochondrial control region (D‐loop) was amplified in 93 individuals from the five locations. Initially, catfish oligonucleotide primers, MT16498H and L19 (Chenoweth & Hughes, 1997) were used to amplify the D‐loop mitochondrion region to obtain B. docmak sequences that were then used to design more robust species‐specific primer pairs. Primers specific to Bagrus spp. were designed using a free online software, primer3 (Rozen & Skaletsky, 2000). A forward (BagDF2)–TTGAGGGTTGGTGGTTTCTT and reverse (BagDR2)–AAACTATTTTCTGTAAATGCATAAT) primer pair were designed and tested for specificity in B. docmak via PCR. A total of 25 μl reaction volume was used; 2.5 μl 10× buffer, MgCl2 1.5 mmol/L, dNTPs 0.2 mmol/L, B. docmak control region primers; BagDF2 and BagDR2 (at a final concentration of 0.2 μmol/L for each primer) and 1 μl DNA (5 ng/μl); PCR cycling conditions comprising of an initial denaturation of 94°C for 5 min, then 30 cycles of 94°C 30 s (denaturation)/50°C for 30 s (annealing)/72°C for 30 s and a final extension of 72°C for 5 min. Visualization for amplification was achieved via electrophoresis using a 1.5% agarose gel. PCR product was cleaned with Sephadex G‐50 (GE Healthcare, UK) columns prior to sending approximately 5 ng of each sample for Sanger sequencing at the Australian Genome Research Facility (AGRF), in Brisbane–Australia. Sequencing was performed in both forward and reverse directions using the designed B. docmak specific primers.

2.3. Mitochondrial DNA sequence editing and alignment

Individual D‐loop sequences were aligned and consensus sequences generated (Bast, 2013) in GENEIOUS 8.02 (Biomatters Ltd). Following generation and alignment of all consensus sequences, a 400 bp size region was trimmed and exported to MEGA 5.2 (Tamura et al., 2011). The best substitution model for analyzing sequence divergence and population structure among the different populations was selected as T92+G (Nei & Kumar, 2000; Tamura et al., 2011) using MEGA 5.2 according to Schwarz (1978).

2.4. Genetic diversity: Descriptive statistics

Analyzes to determine the number of alleles, observed and expected heterozygosities (H o and H e respectively), inbreeding coefficient (F is) and conformation to Hardy–Weinberg Equilibrium (HWE) at 12 microsatellites loci were performed in GenAlex (Peakall & Smouse, 2012) and Arlequin 3.5 (Excoffier, Lischer, & Schneider, 2010). All significance levels were corrected for multiple tests using a two‐step false discovery rate (FDR) correction (Benjamini & Hochberg, 1995; Benjamini, Krieger, & Yekutieli, 2006) set at a maximum of 0.001. The F is was used as a measure of inbreeding and/or population subdivision. Additionally, the average level of relatedness was calculated within each population using ML‐Relate (Kalinowski, Wagner, & Taper, 2006). Input files were converted for use between programs using the free software, PGDspider 2.0.5 (Lischer & Excoffier, 2012). All microsatellite loci were polymorphic in all populations sampled, except for locus BD18 that was monomorphic in the Victoria Nile River and BD20 in the Lake Victoria populations. Micro‐checker 2.2.3 was used to detect genotyping errors, the presence of null alleles and allelic dropouts (Morin et al., 2009; Van Oosterhout et al., 2004). Diversity indices calculated for the mitochondrial data included; haplotype number (n), haplotype diversity (Hd), and nucleotide diversity (π). These parameters were used as a measure of genetic divergence at the mitochondrial D‐loop region within and among the sampled populations. All computations were implemented in DnaSP (Librado & Rozas, 2009) and Arlequin 3.5 (Excoffier et al., 2010).

2.5. Demographic history

Microsatellite allele frequencies were used to assess the recent demographic history of B. docmak. All three microsatellite mutation models (SMM, IAM and TPM 7:3 ratio) were used to test for signatures of population reductions for each of the five populations using Bottleneck 1.2.02 software (Cornuet & Luikart, 1996; Piry, Luikart, & Cornuet, 1999; Selkoe & Toonen, 2006).

Historical demography was investigated at the mitochondrial D‐loop by estimating Fu's F statistic for each of the five locations (Fu, 1997). Neutrality tests to estimate Fu's F statistic were carried out in Arlequin (Excoffier et al., 2010). Furthermore, mismatch analysis distribution was performed for the demographic analysis in which pairwise difference distributions and the frequency of segregating sites were analyzed in DnaSP (Librado & Rozas, 2009; Rozas, Sánchez‐Delbarrio, Messeguer, & Rozas, 2003).

2.6. Population structure

Genetic population structure was investigated at the D‐loop region of the mtDNA and at 12 polymorphic microsatellite loci. Using both datasets, analysis of molecular variance (AMOVA) and pairwise comparisons between locations were completed in Arlequin 3.5 (Excoffier et al., 2010). For microsatellite data, the AMOVA was based on allelic frequencies, and for mtDNA sequence data the AMOVA was based on a genetic distance matrix of pairwise differences between pairs of populations. Significance was estimated at 10,000 permutations.

Furthermore, using mitochondrial sequence data organized in DnaSP (Librado & Rozas, 2009) and exported to Network 4.611 (Flexus Technology, as reported by Bandelt et al., 1995), the population genetic structure and geographical distribution of haplotypes were visualized. Calculation and drawing of a minimum spanning network based on haplotype distribution in sampled individuals from all the five populations were completed in Network4.611 Flexus Technology.

Bayesian clustering analysis conducted in the program, STRUCTURE 2.2 (Earl & von Holdt, 2012), was used to assign individuals from the five locations into distinct genetic clusters. The analysis was based on microsatellite data at 12 polymorphic loci, and runs were conducted on putative populations (K) set from 1 to 10 iterations with 10,000 burn‐ins followed by 100,000 Markov‐Chain Monte Carlo (MCMC) steps for each run. Potential clusters were determined based on an MCMC approach, both with and without a priori definition of structure, and also assuming independent frequencies of alleles. Using the web‐based Structure Harvester software (Earl & von Holdt, 2012), the best K value was then selected. Additionally a multivariate method, the Discriminant Analysis of Principal components (DAPC), was performed in the R package adegenet v1.4.2 (Jombart, 2008), to explore a finer scale structure of the populations based on a two‐step procedure. Firstly, the genetic data are transformed using a Principal Component Analysis (PCA), and then clusters are identified by Discriminant Analysis (DA) without assuming panmixia (Jombart, 2008; Jombart, Devillard, & Balloux, 2010).

3. RESULTS

3.1. Genetic diversity

Mitochondrial DNA D‐loop variation among 93 B. docmak individuals from the five locations revealed high haplotype diversity, Hd, with a narrow range across populations (Hd range of 0.698 for Kazinga Channel to 0.857 for Lake Albert). The nucleotide diversity was highest in individuals from Lake Albert and the Victoria Nile river, both with π = 0.010, and least in Lakes Edward and Victoria, π = 0.004 and 0.006, respectively (Table 1). Overall there were 25 distinct haplotypes, with 31 polymorphic sites and a total of 33 mutations (Appendices 1 and 2). Haplotype sequences were deposited into GenBank with accession numbers MF118537 to MF118561.

Table 1.

Microsatellite and mitochondrial DNA diversity indices for Bagrus docmak from five freshwater systems in East Africa

Location Microsatellite data Mitochondrial data
N N a (range) H o H e N eLD (95% CI) N π Hd Fu's
Lake Victoriaa 26 3.25 (1–6) 0.199 (0.00–0.615) 0.213 (0.000– 0.706) 18.2 (6.7–127.4) 13 0.006 0.846 −3.769**
Victoria Nilea 47 3.33 (1–5) 0.225 (0.00–0.391) 0.238 (0.000–0.48) 58.2 (22.9–6545) 18 0.010 0.750 −1.461
Lake Albert 16 4.67 (2–7) 0.552 (0.333–0.688) 0.60 (0.426–0.781) ∞ (111.6–∞) 16 0.010 0.857 −1.606
Lake Edward 48 4.42 (2–6) 0.385 (0.126–0.542) 0.381 (0.119–0.556) 31.3 (18.8–60.3) 21 0.004 0.732 −5.049***
Kazinga Channel 38 4.58 (2–6) 0.382 (0.147–0.579) 0.38 (0.190–0.586) 978.5 (71.1–∞) 29 0.009 0.698 −6.033**
Open in a new tab

Values for microsatellite statistics are means over all loci (range) for each location: N, sample size; N a, mean number of alleles; H o, mean observed heterozygosity; H e, mean expected heterozygosity; N eLD, effective population size as estimated by linkage disequilibrium method (at 95% confidence interval); π, nucleotide diversity; and Hd, haplotype diversity.

Populations marked with superscript a exhibited monomorphism at one of the twelve loci investigated. Asterisks on Fu's statistic denote the level of significance.

All populations were in Hardy–Weinberg equilibrium, and there was no detection of large allelic dropouts. Null alleles were not detected in the Lake Victoria population; however, they were suggested at locus BD02 for individuals sampled from the Victoria Nile River, BD01 in the Lake Albert and Lake Edward populations, and BD20 in the Kazinga Channel population. There was no locus that consistently exhibited null alleles, and as such all microsatellite loci were polymorphic across populations with number of alleles up to seven alleles per locus and overall mean allelic diversity, mean N a ± SE = 4.05 ± 0.192 (Table 1). The allelic diversity was highest in Lake Albert (mean N a = 4.67 ± 0.497) and lowest in the Lake Victoria population (mean N a = 3.25 ± 0.494). Similarly observed and expected heterozygosities were highest in the Lake Albert population (mean H o of 0.55 ± 0.034 and H e 0.66 ± 0.031) and lowest in the Lake Victoria population (mean H o = 0.199 ± 0.046 and H e = 0.213 ± 0.053) (Table 1). Bottleneck analysis under the SMM and TPM models revealed significant heterozygosity deficiencies (with p values <.005) for B. docmak populations from Lake Victoria and Edward. These two populations additionally displayed an L‐shaped allelic distribution characteristic of populations undergoing expansion following contractions (data not shown). The effective population sizes, N eLD, for Lake Victoria, Lake Edward and the Nile River were finitely restricted (Table 1). On the contrary, the results showed that the sampled populations were mating randomly with the F is indices generally low and showing no significant deviation from zero (p > .05), with the exception of Lake Victoria having the highest F is of 0.1101 (p = .054), but still statistically insignificant (Table 2). Overall there was low level of relatedness in the sampled individuals from all populations (Table 2).

Table 2.

Genetic population bottleneck tests including inbreeding coefficient F IS and relatedness

Population F IS (p value) Bottleneck test: IAM Bottleneck test: SMM Bottleneck test TPM Percentage un relatedness
Lake Victoria 0.1101 (.054) .0068 .0005 .0015 79.69
Victoria Nile River 0.0729 (.093) .0068 .0005 .0010 72.34
Lake Albert 0.0570 (.195) .3394 .9097 .6773 90.00
Lake Edward −0.0567 (.916) .2036 .0017 .0425 75.93
Kazinga Channel 0.0171 (.365) .0640 .0012 .0024 80.80
Open in a new tab

The bottleneck probabilities reported for IAM, SMM, and TPM models above were Wilcoxon probability 2‐tail tests for heterozygosity deficiency and excess as implemented in the program Bottleneck (Cornuet & Luikart 1996; Piry et al. 1999).

3.2. Demographic history

Mismatch distribution analyzes showed varied demographic histories for B. docmak from the five locations. Fu's F statistics were negative in all populations and highly significant for B. docmak individuals from Lakes Victoria, Edward, and the Kazinga channel (see Table 1).

Overall, all populations sampled exhibited heterozygosity deficiencies except for the Lake Albert population that did not show significant deviations from a stable population (p > .37, SMM and p > .05, under the IAM model). The Lake Albert population exhibited characteristics of a stable population with three loci showing heterozygosity deficiency and nine loci with heterozygosity excess. Contrary to Lake Albert, results indicated that the Lake Victoria population exhibited a normal L‐shaped curve characteristic of a young and expanding population. This is further confirmed by a significantly high heterozygosity deficiency at 10 loci (p < .001 under the SMM model). Additionally, relative to all populations, Lake Victoria displayed the highest F IS index of 0.11 (Table 2), although it was not significant (p > .05).

Similarly, using the linkage disequilibrium method for estimating the effective population size (N eLD) in NeEstimator, Lake Albert showed an infinite N eLD with infinite number of breeders, followed by the Kazinga channel which also exhibited a relatively high Ne (Ne = 998, range 71.1–∞). Populations from Lake Victoria and Lake Edward had restricted effective population sizes, N eLD of 18.2 (6.7–127.4) and 31 (18.8–60), respectively (Table 1). The N eLD estimates are consistent with results from the bottleneck test, as well as the mitochondrial results that showed high nucleotide diversities for populations of Lake Albert and relatively low nucleotide diversity for populations from Lake Victoria and Lake Edward (Table 1).

3.3. Population structure

MtDNA D‐loop analysis for B. docmak populations revealed highly significant structuring between populations across the Albertine Rift valley and the Lake Victoria basin populations (ɸST = 0.62; p < .001). Pairwise ɸST between populations across the two regions ranged from 0.628 to 0.820 (p < .001) which were up to sevenfold higher in comparison to the within‐region population ɸST pairs (range of 0.013–0.097). Moderate‐to‐weak structuring also existed between populations within basins, especially for water systems that were geographically proximate, or directly connected with no major biogeographical barriers. For instance, pairwise ɸST values between “Kazinga Channel–Lake Albert” and “Lake Edward–Lake Albert” showed moderately low ɸST of 0.046 (p < .05) and 0.0968 (p < .001), respectively (Table 3). In both cases, there was relatively weak genetic structuring among these populations situated within the Albertine Rift valley. There was no significant structuring between Lake Edward and the Kazinga channel populations (p > .05), which is not surprising given their direct geographical connectivity. Similarly, there was weak and insignificant structuring (p > .05) between the Victoria Nile River samples and the Lake Victoria population.

Table 3.

Comparison of population pairwise ɸST based on the mitochondrial DNA data with ɸST values below diagonal and corresponding p values (10,000 permutations) above diagonal

Population Lake Victoria Victoria Nile River Lake Albert Lake Edward Kazinga Channel
Lake Victoria – .369 .0000 .000 .000
Victoria Nile River .013 – .0000 .000 .000
Lake Albert .716 .628 – .002 .033
Lake Edward .820 .740 .097 – .125
Kazinga Channel .727 .659 .046 .0162 –
Open in a new tab

Overall fixation index, ɸST was 0.62 at p < .001.

Results of population structure based on microsatellite analysis mirrored the mitochondrial DNA ɸST patterns. Here, population pairwise F ST values were in the range of 0.014–0.549, with significant structuring between populations across the Albertine (Lakes Edward and Albert and the Kazinga Channel) and Lake Victoria basin (Lake Victoria and Victoria Nile river populations (Table 4). Additionally there was weak, but significant F ST between Lake Victoria and the Nile river populations, F ST = 0.047 (p < .001). Bayesian STRUCTURE analysis and DAPC multivariate analyzes also showed a similar trend with varying degrees of resolution (Figure 2a–c).

Table 4.

Pairwise F ST among Bagrus docmak populations from East Africa using microsatellite data. Below diagonal, F ST values, above diagonal significance level corrected for FDR at .001

Population Lake Victoria Victoria Nile Lake Albert Lake Edward Kazinga Channel
Lake Victoria – .001 .000 .000 .000
Victoria Nile .047 – .000 .000 .000
Lake Albert .355 .379 – .000 .000
Lake Edward .515 .526 .150 – .029
Kazinga Channel .535 .549 .157 .014 –
Open in a new tab

Figure 2.

Figure 2

Open in a new tab

(a) STURCTURE bar plot of Bagrus docmak populations depicting two genetic clusters (K = 2) as per the genome ancestry assignment revealed. X axis represents individuals from the five locations (1‐Lake Victoria, 2‐Victoria Nile River, 3‐Lake Albert, 4‐Lake Edward, and 5‐Kazinga channel) assigned to two major stocks/populations; Victoria basin populations (red) and Albertine Rift populations (Green). (b) Scatterplot showing Discriminant Analysis of Principal Components (DACP) for 175 individuals of B. docmak in adegenet, an R package. The colors represent populations with respective number of individuals sampled; Yellow–Lake Albert with 16 individuals, Red–Kazinga Channel with 38 individuals, Gray–Nile River with 47 individuals, Orange–Lake Edward with 48 individuals, and Blue–Lake Victoria with 26 individuals. Thus, each color dot represents an individual with discrete clusters surrounded by 95% confidence interval inertia ellipses. (c) DAPC density plot based on the most variable component

Bayesian clustering revealed two major distinct genetic clusters based on the highest probability likelihood achieved of K = 2 when evaluating all populations together. One genetic cluster predominantly comprised Lake Victoria basin populations (i.e., from the Nile River and Lake Victoria) and the second genetic cluster contained populations from the Albertine Rift Valley (i.e., Lake Edward and the Kazinga Channel). However, individuals from Lake Albert comprised both genealogies from the Albertine rift and Lake Victoria basin (Figure 2a) when partitioned at this level of K = 2. When evaluating with DAPC, results revealed three distinct clusters (Figure 2b,c), grouping individuals from Lake Albert as a discrete population between the other two major clusters. Lake Edward and the Kazinga channel grouped into another cluster and equally the Lake Victoria and Nile River individuals into a third distinctive group. These hierarchical clustering patterns are consistent with the level of population divergence observed in the pairwise F ST comparison data (Table 4).

The haplotype network based on mtDNA data for B. docmak was characterized by two centrally shared haplotypes, H‐2 and H‐9, (one from each of the two regions separated by up to four mutational events; the Albertine rift and the Lake Victoria basin) and 23 other smaller haplotypes that were branching out in the periphery. The most common haplotype was shared by 33 individuals restricted to the Albertine rift (Lake Edward, Lake Albert and the Kazinga channel) and representing up to 35% of the all sampled individuals. The second largest haplotype had 16 individuals restricted to the Nile River and Lake Victoria. From these two major haplotypes span other smaller haplotypes (Figure 3). These results suggest the presence of two fairly distinct genetic groups spanning the five geographical locations sampled.

Figure 3.

Figure 3

Open in a new tab

Haplotype network for Bagrus docmak from five geographical locations as drawn in Network 4.6.1. Each circle denotes a single haplotype whose size is proportional to the frequency of the haplotype. The colors represent the geographical source of the haplotype. Each branch indicates a single mutational event except where indicated by lines that correspond to the total number of mutations

4. DISCUSSION

4.1. Genetic diversity, population structure, and connectivity of Bagrus docmak

The complex geological history of East Africa has acted as a biogeographical evolutionary driver of the diverse freshwater fish species fauna seen in the region (Danley et al., 2012; Sturmbauer et al., 2001; Verheyen et al., 2003). Similarly, genetic analyzes of B. docmak populations from lacustrine and riverine habitats of the EAR show evidence for vicariance leading to genetic divergence below the species level. Both mtDNA and nuclear markers highlight the presence of significant genetic population structure among B. docmak populations within and outside the EAR (F ST of 0.46 for microsatellite and ɸST of 0.62 for mitochondrial DNA data, p value <.001), with two major genetic stocks identified: one within the Albertine rift and the other within the Lake Victoria basin. Mitochondrial DNA analyzes show that the separation of stocks has an ancient origin with a high degree of haplotype sorting evident, with just two major haplotypes and restricted mutations of up to four base pair changes between these two major haplotypes. The near complete haplotype sorting and reduction in diversity suggests a severe vicariant and bottlenecking event among catfish populations (Figure 3). The split lineage and highly truncated haplotype sharing between Lake Edward and Lake Victoria individuals, emphasizes, the divergence of these two lakes situated in the Albertine rift valley and Lake Victoria basin drainages, respectively. The divergence of populations of this potamodromous freshwater catfish in the EAR lakes and Lake Victoria is consistent with high degree of endemism and radiations among other African cichlids within the Great Lakes Region and the suckermouth catfish species Chiloglanis anoterus of the African Highveld (Johnson, Kelts, & Odada, 2000; Johnson et al., 1996; Morris et al., 2016; Russell & Johnson, 2001). Although there is hardly any information on genetic variation among other bagrid catfishes in African freshwater systems for direct comparison, the divergence of populations in the B. docmak was found to be higher than what has been reported in another Asian freshwater bagrid catfish, Leiocassis longirostris (Yang, Xiao, Yu, & Xu, 2012).

This study also highlighted evidence for admixture among Lake Albert B. docmak (Figure 2a). This admixture may be indicative of limited connectivity between Lakes Victoria and Albert through the Victoria Nile and is consistent with historical exchanges of fauna to have occurred previously following geomorphological events, especially in the Nile system and its associated basins (Stewart, 2009). Murchison Falls likely acts as a one way biogeographical barrier inhibiting fish stocks moving upstream from Lake Albert into Lake Victoria; however, it may not act as a barrier to fish moving downstream from Lake Victoria to Lake Albert. The biogeographical separation of Lake Albert from Lake Victoria by the Murchison Falls has been well documented, and it is this barrier that prevented the Nile perch from crossing upstream from Lake Albert into Lakes Kyoga and Victoria (Hopson, 1972).

Despite similar geological history of formation by tectonic movements and their connectivity through the Semliki River, moderate, but significant structuring was detected between populations of Lake Edward and Lake Albert based on both mitochondrial and microsatellite data. The divergence of B. docmak populations between these two lakes is possibly a result of the biogeographical barrier of the Semliki rapids which may restrict levels of gene flow between these two lakes (Thieme et al., 2005). This observed genetic structuring pattern is consistent with earlier species composition studies, where unique fish fauna have been identified in Lake Albert, but not in Lake Edward (Devaere, Jansen, Adriaens, & Weekers, 2007).

Correspondently, the weak and insignificant F ST values obtained between lake–river systems (i.e., Lake Edward–Kazinga Channel River and Lake Victoria–Victoria Nile River) is consistent with the direct connection of these lake–river systems which have no known biogeographic barriers. In addition, B. docmak being potamodromous (Chapman et al., 2012; Manyala, Bolo, Onyango, & Rambiri, 2005), implies that gene flow between lakes and river systems will be enhanced where there are no barriers, but inhibition of gene flow will be accelerated in the presence of geological features that interrupt migration and consequently restrict gene flow. Connectivity would foster the exchange of genes of populations between the lacustrine and riverine habitats.

4.2. Historical and contemporary genetic signatures

Understanding biogeography using genetics is important to determine patterns influencing distribution of geographically distant populations. Evidence of sequence and haplotype divergence revealed that B. docmak populations (Lake Victoria, Lake Edward and the Kazinga Channel) underwent severe contractions as a result of biogeographical influences within the East African region. Generally the mitochondrial haplotypes branches were very short showing that the divergences were fairly recent with just up to four mutations between the two major lineages. It also indicates a short evolutionary time since the common ancestor. Additional evidence of low diversity in the mitochondrial data reveals that the populations from Lakes Victoria and Edward have been restricted to a very small size over a few thousands of years. High haplotype diversity coupled with low nucleotide diversity as was observed in the Lake Victoria and Edward B. docmak populations (Table 1), is a pattern consistent with one which has been documented in another catfish species, L. longirostris (Yang et al., 2012). This pattern has been associated with recent population expansions following population bottlenecks (Grant & Bowen, 1998; Yang et al., 2012). Evidence of a historical bottleneck and a possible recent colonization was also confirmed by the negative and significant Fu's statistic obtained in the Lake Victoria, Lake Edward, and Kazinga channel populations (Fu, 1997). The results are consistent with reports of mass extinctions in these lakes and recolonization events particularly in Lakes Edward, George, and Victoria (Beadle, 1974; Thieme et al., 2005). It should be noted that long droughts characterized the East African region during the late Pleistocene coupled with the tectonic uplifts that were responsible for drying up and river reversal between the lacustrine environments (Day et al., 2013). Additional evidence to the Pleistocene events of river reversal is the complete desiccation of Lake Victoria following a long drought period (Johnson et al., 1996). B. docmak being potamodromous was most likely susceptible given its migration patterns between the riverine and lacustrine habits.

Corroborative evidence was obtained using the microsatellite data in which restricted N eLD estimates were recorded in addition to significant heterozygosity deficiencies in all the populations except for Lake Albert. The low N eLD (Table 1), relatively high inbreeding coefficient, and significant heterozygosity deficiencies in the Lake Victoria and Edward populations, further indicate that these populations are constrained and have not had enough time to recover from the severe historic bottleneck. As pointed out in earlier studies the population in Lake Victoria is additionally constrained by anthropogenic pressures such as heavy fishing and exotic species introductions (like Nile perch) that have been clearly documented in the region (Hauser et al., 1998; Kudhongania et al., 1992; Ogutu‐Ohwayo, 1990, 1993). Evidence highlights that B. docmak was formally a dominant and higher‐order carnivorous fish in the Lake Victoria basin, but it currently faces direct competition for prey and is also preyed upon by the introduced Nile perch (Frans Witte, 1997).

Furthermore our study reveals a recent expansion amidst high, but insignificant F IS, thus rejecting the hypothesis of possible inbreeding. It is, therefore, predicted that the large surface area of Lake Victoria (68,000 km2) provides an advantage of a large habitat in which the species will survive for a while if proper management strategies are put in place. Conversely, Lake Edward which is a small (2,235 km2) EAR lake, has been considered hydrologically and chemically sensitive to climatic changes as it lies in the intersection of the Indian and Atlantic air masses (Russell & Johnson, 2001). The truncated gene flow between Lakes Edward, Victoria, and Albert due to geological and biogeographic barriers largely exposes Lake Edward populations to risk, especially in the event where they are exposed to stochastic events (such as disease outbreaks) and anthropogenic pressures (including heavy fishing and habitat degradation).

The exception of Lake Albert and the Victoria Nile River in showing negative, but nonsignificant neutrality tests, reveals the possibility of a long‐term demographic stability. The microsatellite data confirms the stability of the Lake Albert system following a balanced heterozygosity consistent with a stable population as assessed by the bottleneck test. Furthermore, the Lake Albert population was characterized by an infinite N eLD estimate coupled with the highest level of heterozygosity and number of private alleles. The evidence of stability shown in the Lake Albert population suggests the presence of undisturbed habitats within this lake. Hence, it is not surprising that Lake Albert has also been referred to as an abyss with deep waters compared to the shallow Lake Victoria (Mwanja et al., 2014).

The evidence for genetic stability suggested in the Lake Albert population in the current study does not in any way warrant populations of B. docmak from this particular lake to be neglected for conservation; however, the findings do provide a baseline on the genetic status of the species following historical processes (Johnson et al., 1996, 2000; Russell & Johnson, 2001). The current anthropogenic pressures such as aquaculture establishments (Dickson et al., 2012) on the lake, as well as proposed oil extraction within the Albertine region (Kathman & Shannon, 2011; Vokes, 2012), could potentially accelerate habitat destruction and loss of genetic biodiversity. Therefore, a genetic baseline is needed to monitor and design appropriate management measures for the lake and the region at large.

Information provided by the current study will facilitate the comprehensive management of B. docmak and related taxa for sustainable harvest in the wild and/or culture under captive conditions. The strategy should consider river and lake regulations together with their associated developments, such as, damming, hydropower generation, fishing, transport, among others. Replenishment of fish stocks through restocking and aquaculture need to take into account the current and historic genetic diversity and population structure of the identified stocks. These stocks potentially translate into majorly two evolutionary significant units (evidence from mitochondrial data) and two management units (based on STRUCTURE analysis). These findings are important in developing appropriate conservation and management strategies which depend majorly on our ability to correctly assign genetically distinct populations (Latch, Dharmarajan, Glaubitz, & Rhodes, 2006).

5. CONCLUSION

The low genetic diversity and strong population structure patterns revealed in B. docmak are consistent with patterns observed in other freshwater fish species that have been linked to the complex biogeography of East Africa (Danley et al., 2012). The results in the current study support the hypothesis of Danley et al. (2012) and Pinton et al. (2013), who postulate that a linkage of paleohydrological changes in a geological context has been a major cause of diversification of the freshwater teleost fauna in East Africa. Particularly, the East African Rift system and associated historical events appear as strong drivers of freshwater diversification and evolution. In the case of B. docmak, both population fragmentation and reductions in population size due to the complex geological and climate variability in the EAR have resulted in significant genetic structure among populations.

Strategically, the management of aquatic fauna in the East African region should initially take into account the two major management units identified, that is the Albertine rift valley region and the Lake Victoria basin. However, further research is required for the Lake Albert population which was singled out as a discrete group at a finer scale with DAPC analysis to make a total of apparently three management units comprising of Lake Edward and Kazinga Channel cluster, Lake Victoria–Nile River cluster and Lake Albert.

CONFLICT OF INTEREST

None declared.

ACKNOWLEDGMENTS

Sincere thanks also go to Ondhoro Constantine, Matthew Mwanja, Philip Lwezawula, Godfrey Kityo, Sophia Hamba (all from the Aquaculture Research and development Centre, Kajjansi), and Philip Borel from Greenfields fish factory for their assistance in acquiring samples for this study. We are grateful to Ivany Argueta, Monal Lal, and Elijah Basiita for their assistance in map development. Monal Lal is further acknowledged for reading the earlier version of the manuscript. Finally, we appreciate the financial support from NARO‐Uganda (through the ATAAS project), AusAID through the CRC Budget and ADS Scholarship to RKB and also a GRS grant to RKB from James Cook University. This work was carried out in accordance with ethical animal handling guidelines for the Department of Primary Industries in Queensland, under animal ethic approval number A1824.

APPENDIX 1.

List of haplotypes for Bagrus docmak

31 Polymorphic sites Haplotype distribution and frequency Totals
VIC VIC_NILE ALB EDW KAZ
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31
Hap 1 G A A C C T A G T T C A T T G C C T T T T T G A T T G T T T G 1 1
Hap 2 . G . . . . G . . . . . . . . . . . . . . . A . . . A . . . A 1 5 13 14 33
Hap 3 . G . . . . G . . . . . . . . . . C . . . . A . . . A . . . A 1 2 2
Hap 4 A G . . . . G A . . T . . . A . . . C . . . A . C . A . . C A 1 2 1 4
Hap 5 . G . . . . G T . . . . . . . . . . . . . . A . . . A . . . A 1 1 2
Hap 6 A G . . . . G . . . . . . . . . . . . . . . A . . . A . . . A 1 2 3
Hap 7 . G . . . . G . . . . . . . . . . . . . . . A G . . A . . . A 3 3
Hap 8 . G . . . . G . . . . . . C . . . . . . . . A G . . A . . . A 1 1
Hap 9 A G . . . . G A . . T . . . A . . . . . . . A . C . A . . C A 5 10 1 16
Hap 10 . G . . . . G . . . . G . . . . . . . . . . A . . . A . . . A 1 1
Hap 11 . G . . . . G . . . . G . . . . . . . . . . A . . C A . . . A 1 1
Hap 12 . G . . . . G . . . . . . . . . . . . . . . . . . . A . . . A 3 1 4
Hap 13 A G . . . . G A . . T . . . A . . . . . . A A . C . A . . C A 1 1
Hap 14 A G . . . . G A . . T . . . A . . . . . . . . . C . A . . C A 1 1
Hap 15 A G . . . . G A . . T . . . . . . . . . . . A . C . A . . C A 6 2 8
Hap 16 A G . . . . G A . . T . . . A . . . . . . . A . C . A C C C A 1 1
Hap 17 . . . . . . . . . . . . . . . . . . . . . . A . . . A . . . A 2 2
Hap 18 . G . . . C G . . . . . . . . . . . . . . . A . . . A . . . A 1 1
Hap 19 . G . T T . G . . . . . A A . . . . . A A A A G . . A . . . A 1 1
Hap 20 . G C . . . G . . . . . . . . . . . . . . . A . . . A . . . A 1 1
Hap 21 . G . . . . G . . C . . . . . . . . . . . . A . . . A . . . A 1 1
Hap 22 . G . . . . G . C . . . . . . . . . . . . . A . . . A . . . A 1 1
Hap 23 . G . . . . G . . . . . . . . . . . C . . . A . . . A . . . A 1 1
Hap 24 . G . . . . G . . . . . . . . . T . . . . . A . . . A . . . A 1 1
Hap 25 . G . . . . G . . . . . . . . T . . . . . . A . . . A . . . A 1 1
Open in a new tab

APPENDIX 2.

Bagrus docmak haplotype and corresponding sample source details

Haplotype Name Sequence Name Lake Victoria Victoria Nile River Lake Albert Lake Edward Kazinga Channel Total number of haplotypes (n)
HAP1 ALB_MURC195 1 1
HAP23 ALB_NTK27 1 1
HAP2 ALB_WSK3 0 1 5 13 14 33
HAP3 ALB_WSK4 1 2 3
HAP4 ALB_WSK5 1 2 1 4
HAP17 ALB_WSK9 2 2
HAP21 EDWM4 1 1
HAP18 EDWM5 1 1
HAP22 EDWM7 1 1
HAP25 EDWV19 1 1
HAP5 EDWV6 1 1 2
HAP24 EDWV8 1 1
HAP6 KAZF1 1 2 3
HAP9 KAZF12 5 10 1 16
HAP10 KAZF15 1 1
HAP7 KAZF2 3 3
HAP11 KAZF21 1 1
HAP12 KAZF25 3 1 4
HAP8 KAZF3 1 1
HAP19 KAZF27 1 1
HAP20 KAZF29 1 1
HAP13 NILE_RNK29 1 1
HAP14 NILE_RNK39 1 1
HAP15 NILE_RNK47 6 2 8
HAP16 VIC_RNK7 1 1
Total 93
Open in a new tab

APPENDIX 3.

List of microsatellite primers for Bagrus docmak

Locus Primer sequence T M (°C) Motif Size range (bp)
Bd04a F: TGTGGACCAAGAGACAGGTG 59 (AGAT)18 200–208
R: AATGAACAAGGCAGGTGATG
Bd18a F: ATGGGGAGGAAAAGTGGAG 61 (AC)15 100–102
R: CCTGAGTGCATTGCTCATGG
Bd01a F:TTGCCAATCCTGATGACACTC 60 (TTCT)15 203–219
R:TAAAGCTGGGCAACTGATCC
Bd02a F:TGTGCTCTGACCCCTACCTC 60 (AGAT)17 110–130
R:GGGTATCGCATCCCAGATAG
Bd12a F: CCGACCATCTCAAATACAAGTC 60 (AAT)18 237–258
R: CTCTTCCCCAAGGCTATTCC
Bd09a F: ACTGTTCCCATGAAGTTGGG 60 (ATT)19 223–238
R: TGGTCAACTTTAGATGTGCAGC
Bd06a F: TTCTGAAGCCCAAAGTAGACG 59 (GATA)16 171–199
R: GCCCACACTATTGACACAGG
Bd20a F: TCCTGGAGACCAAGACCAAG 60 (CA)11 156–168
R: TGCAGGTTAAGAATGGAGGC
Bd05a F: GCTGGCAACATGCAGTAATC 59 (ATAC)15 136–172
R: CAGCATTTCATTGCTATGTGC
BD07 F: GAGCACACGAAACATTGCAG 60 (GATA)15 125–157
R: TTGTAGATTCCCTTTGGGATG
Bd16 F: GCAATCGCACTCTTGTTATCG 61 (ATT)13 83
R: TAGTAGCGCACCCAGGAAAC
BD08 F: TTACCTCACACTCTGGGGTTG 60 (ATCT)16 179–187
R: GGTAAAGGTTTACACTGTGGGG
BD03a F:CCTGCAGGAGTTTGTTTGTG 60 (TAGA)15 159–191
R: CGTGCCATAGGCATTTATCC
BD14a F: CTTTAATGACACTGCGCTGC 60 (TAT)17 218–233
R: CTCAAAGCGCTTGAAGTGG
Bd10a F: GTCCCACGGACTGAAAAGTG 60 (TTA)15 266–287
R:TCAACTTCTTAGCACAAAATCAGAC
Open in a new tab

T M, optimal primer melting temperature.

a Polymorphic loci used for analyses in the current study.

Source: Extracted from Basiita et al. (2016), in Microsatellite records by Goossens (2015).

Basiita RK, Zenger KR, Jerry DR. Populations genetically rifting within a complex geological system: The case of strong structure and low genetic diversity in the migratory freshwater catfish, Bagrus docmak, in East Africa. Ecol Evol. 2017;7:6172–6187. https://doi.org/10.1002/ece3.3153

REFERENCES

  1. Alhassan, E. , & Ansu‐Darko, M. (2011). Food and feeding habits of a potential aquaculture candidate, the black nile catfish, bagrus bajad in the Golinga reservoir. Australian Journal of Basic & Applied Sciences, 5, 354–359. [Google Scholar]
  2. Amos, B. (1991). Long‐term preservation of whale skin for DNA analysis. Report of the International Whaling Commission, Special Issue, 13, 99–103. [Google Scholar]
  3. Aruho, C. , Basiita, R. , Kahwa, D. , Bwanika, G. , & Rutaisire, J. (2013). Reproductive biology of Bagrus docmak in the Victoria Nile, Uganda. African Journal of Aquatic Science, 38, 263–271. [Google Scholar]
  4. Baker, B. T. , & Wohlenberg, J. (1971). Structure and evolution of the Kenya Rift Valley. Nature, 229, 538–542. [DOI] [PubMed] [Google Scholar]
  5. Bandelt, H. J. , Forster, P. , Sykes, B. C. , & Richards, M. B. (1995). Mitochondrial potraits of human populations. Genetics, 141, 743–753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Basiita, R. K. , Aruho, C. , Kahwa, D. , Nyatia, E. , Bugenyi, F. W. , & Rutaisire, J. (2011). Differentiated gonochorism in Nile perch Lates niloticus from Lake Victoria, Uganda. African Journal of Aquatic Science, 36, 89–96. [Google Scholar]
  7. Basiita, R. K. , Bruggemann, J. H. , Cai, N. , Cáliz‐Campal, C. , Chen, C. , Chen, J. , … Ding, Y. (2016). Erratum to: Microsatellite records for volume 7, issue 4. Conservation Genetics Resources, 8, 85–87. [Google Scholar]
  8. Bast, F. (2013). Sequence similarity search, multiple sequence alignment, model selection, distance matrix and phylogeny reconstruction. Nature Protocol Exchange, Published online 11 July 2013. http://dx.doi.org/10.1038/protex.2013.065. [Google Scholar]
  9. Beadle, L. C. (1974). The inland waters of tropical Africa. An introduction to tropical limnology. Longman Group Ltd, Publishers, 74 Grosvenor Street, London: W. 1. [Google Scholar]
  10. Benjamini, Y. , & Hochberg, Y. (1995). Controlling the false discovery rate: A practical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B (Methodological), 57, 289–300. [Google Scholar]
  11. Benjamini, Y. , Krieger, A. M. , & Yekutieli, D. (2006). Adaptive linear step‐up procedures that control the false discovery rate. Biometrika, 93, 491–507. [Google Scholar]
  12. Brownstein, M. J. , Carpten, J. D. , & Smith, J. R. (1996). Modulation of non‐templated nucleotide addition by Taq DNA polymerase: Primer modifications that facilitate genotyping. BioTechniques, 20, 1004–1006, 1008–10. [DOI] [PubMed] [Google Scholar]
  13. Chapman, L. , & Chapman, C. (2003). Fishes of the African rain forests: Emerging and potential threats to a littleknown fauna. Conservation, Ecology, and Management of African Freshwaters. Univ. Press of Florida, 176–209. [Google Scholar]
  14. Chapman, L. , Chapman, C. , Kaufman, L. , Witte, F. , & Balirwa, J. (2007). Biodiversity conservation in African inland waters: Lessons of the Lake Victoria region. Proceedings – International Association of Theoretical and Applied Limnology, 30, 16. [Google Scholar]
  15. Chapman, B. , Skov, C. , Hulthèn, K. , Brodersen, J. , Nilsson, P. A. , Hansson, L. A. , & Brönmark, C. (2012). Partial migration in fishes: Definitions, methodologies and taxonomic distribution. Journal of Fish Biology, 81, 479–499. [DOI] [PubMed] [Google Scholar]
  16. Chenoweth, S. F. , & Hughes, J. M. (1997). Genetic population structure of the catadromous Perciform: Macquaria novemaculeata (Percichthyidae). Journal of Fish Biology, 50, 721–733. [Google Scholar]
  17. Craig, J. F. (1992). Human‐induced changes in the composition of fish communities in the African Great Lakes. Reviews in Fish Biology and Fisheries, 2, 93–124. [Google Scholar]
  18. Cornuet, J. M. , & Luikart, G. (1996). Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics, 144, 2001–2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Danley, P. D. , Husemann, M. , Ding, B. , Dipietro, L. M. , Beverly, E. J. , & Peppe, D. J. (2012). The impact of the geologic history and paleoclimate on the diversification of East African cichlids. International Journal of Evolutionary Biology, 2012, pp 1‐20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Dawson, M. N. , Raskoff, K. A. , & Jacobs, D. K. (1998). Field preservation of marine invertebrate tissue for DNA analyses. Molecular Marine Biology and Biotechnology, 7, 145–152. [PubMed] [Google Scholar]
  21. Day, J. J. , Peart, C. R. , Brown, K. J. , Friel, J. P. , Bills, R. , & Moritz, T. (2013). Continental diversification of an African catfish radiation (Mochokidae: Synodontis). Systematic Biology, 62, 351–365. [DOI] [PubMed] [Google Scholar]
  22. Devaere, S. , Jansen, G. , Adriaens, D. , & Weekers, P. (2007). Phylogeny of the African representatives of the catfish family Clariidae (Teleostei, Siluriformes) based on a combined analysis: Independent evolution towards anguilliformity. Journal of Zoological Systematics and Evolutionary Research, 45, 214–229. [Google Scholar]
  23. Dickson, M. , Jagwe, J. , Longley, C. , & Dalsgard, J. (2012). Uganda aquaculture value chains: Strategic planning mission report. Panang WorldFish. http://hdl.handle.net/10568/32727
  24. Earl, D. , & von Holdt, B. (2012). STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetics Resources, 4, 359–361. [Google Scholar]
  25. Elmer, K. R. , Reggio, C. , Wirth, T. , Verheyen, E. , Salzburger, W. , Meyer, A. , & Wake, D. B. (2009). Pleistocene desiccation in East Africa bottlenecked but did not extirpate the adaptive radiation of Lake Victoria haplochromine cichlid fishes. Proceedings of the National Academy of Sciences of the United States of America, 106, 13404–13409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Excoffier, L. , Lischer, H. & Schneider, S. (2010). Arlequin suite ver. 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources, 10, 464–567. [DOI] [PubMed] [Google Scholar]
  27. Frans Witte, K. (1997). The catfish fauna of Lake Victoria after the Nile perch upsurge. Environmental Biology of Fishes, 49, 21–43. [Google Scholar]
  28. Fu, Y.‐X. (1997). Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147, 915–925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Giddelo, C. S. , Arndt, A. D. , & Volckaert, F. A. M. (2002). Impact of rifting and hydrography on the genetic structure of Clarias gariepinus in eastern Africa. Journal of Fish Biology, 60, 1252–1266. [Google Scholar]
  30. Golubtsov, A. , Darkove, A. , Dgebyadze, Y. , & Mina, M. (1995). An artificial key to fish species of Gambela region. Addis Ababa: Joint Ethio‐Rassian Biological Expedition. Artistic Printing Press. [Google Scholar]
  31. Goossens, B. (2015). Microsatellite records for volume 7, issue 4. Conservation Genetics Resources, 7, 917–944. [Google Scholar]
  32. Grant, W. , & Bowen, B. (1998). Shallow population histories in deep evolutionary lineages of marine fishes: Insights from sardines and anchovies and lessons for conservation. Journal of Heredity, 89, 415–426. [Google Scholar]
  33. Greenwood, P. H. (1966). Fishes of Uganda. Kampala: The Uganda Society. [Google Scholar]
  34. Hauser, L. , Carvalho, G. , Pitcher, T. J. , & Ogutu‐Ohwayo, R. (1998). Genetic affinities of an introduced predator: Nile perch in Lake Victoria, East Africa. Molecular Ecology, 7, 849–857. [Google Scholar]
  35. Helfman, G. S. (2007). Fish conservation: A guide to understanding and restoring global aquatic biodiversity and fishery resources. Island Press, Washington DC, United States. [Google Scholar]
  36. Hopson, A. J. (1972). A study of the Nile perch (Lates niloticus (L), Pisces Centropomide) in Lake Chad. Foreign and Commonwealth Office Overseas Development Administration, Overseas Research Publication 19. Nigeria: Federal Fisheries Service. [Google Scholar]
  37. Johnson, T. C. , Kelts, K. , & Odada, E. (2000). The holocene history of Lake Victoria. Ambio, 29, 2–11. [Google Scholar]
  38. Johnson, T. C. , Scholz, C. A. , Talbot, M. R. , Kelts, K. , Ricketts, R. D. , Ngobi, G. , … McGill, J. W. (1996). Late Pleistocene desiccation of Lake Victoria and rapid evolution of cichlid fishes. Science, 273, 1091–1093. [DOI] [PubMed] [Google Scholar]
  39. Jombart, T. (2008). adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics, 24, 1403–1405. [DOI] [PubMed] [Google Scholar]
  40. Jombart, T. , Devillard, S. , & Balloux, F. (2010). Discriminant analysis of principal components: A new method for the analysis of genetically structured populations. BMC Genetics, 11, 94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Kalinowski, S. T. , Wagner, A. P. , & Taper, M. L. (2006). ML‐Relate: A computer program for maximum likelihood estimation of relatedness and relationship. Molecular Ecology Notes, 6, 576–579. [Google Scholar]
  42. Kathman, J. , & Shannon, M. (2011). Oil extraction and the potential for domestic instability in Uganda. African Studies Quarterly, 12, 23. [Google Scholar]
  43. Kudhongania, A. , Twongo, T. , & Ogutu‐Ohwayo, G. (1992). Impact of the Nile perch on the fisheries of Lakes Victoria and Kyoga. Hydrobiologia, 232, 1–10. [Google Scholar]
  44. Latch, E. K. , Dharmarajan, G. , Glaubitz, J. C. , & Rhodes, O. E. Jr (2006). Relative performance of Bayesian clustering software for inferring population substructure and individual assignment at low levels of population differentiation. Conservation Genetics, 7, 295–302. [Google Scholar]
  45. Lévêque, C. (1997). Biodiversity dynamics and conservation: The fresh‐water fish of tropical Africa. Cambridge University Press, United Kingdom. [Google Scholar]
  46. Librado, P. , & Rozas, J. (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25, 1451–1452. [DOI] [PubMed] [Google Scholar]
  47. Lischer, H. , & Excoffier, L. (2012). PGDSpider: An automated data conversion tool for connecting population genetics and genomics programs. Bioinformatics, 28, 298–299. [DOI] [PubMed] [Google Scholar]
  48. Lowe‐Mcconnell, R. H. (1993). Fish faunas of the African Great Lakes: Origins, diversity, and vulnerability. Conservation Biology, 7(3), 634–643. [Google Scholar]
  49. Lowe‐Mcconnell, R. (2009). Fisheries and cichlid evolution in the African Great Lakes: Progress and problems. Freshwater Reviews, 2, 131–151. [Google Scholar]
  50. Manyala, J. , Bolo, J. , Onyango, S. , & Rambiri, P. (2005). Indigenous knowledge and baseline data survey on fish breeding areas and seasons in Lake Victoria, Kenya. Knowledge and Experiences gained from Managing the Lake Victoria Ecosystem, 529–551. [Google Scholar]
  51. Morin, P. A. , Leduc, R. G. , Archer, F. I. , Martien, K. K. , Huebinger, R. , Bickham, J. W. , & Taylor, B. L. (2009). Significant deviations from Hardy‐Weinberg equilibrium caused by low levels of microsatellite genotyping errors. Molecular Ecology Resources, 9, 498–504. [DOI] [PubMed] [Google Scholar]
  52. Morris, J. , Ford, A. G. , Ali, J. R. , Peart, C. R. , Bills, R. , & Day, J. J. (2016). High levels of genetic structure and striking phenotypic variability in a sexually dimorphic suckermouth catfish from the African Highveld. Biological Journal of the Linnean Society, 117, 528–546. [Google Scholar]
  53. Mwanja, M. , Aruho, C. , Namulawa, V. , Ddungu, R. , Ondhoro, C. , & Basiita, R. (2014). Morphometric variation among Bagrus docmak (Ssemutundu) of the Ugandan major water bodies. Journal of Fisheries and Aquaculture, 5, 167–172. [Google Scholar]
  54. Nei, M. , & Kumar, S. 2000. Molecular evolution and phylogenetics. Oxford University Press, Oxford, England, UK. [Google Scholar]
  55. Ogutu‐Ohwayo, R. (1990). The reduction in fish species diversity in Lakes Victoria and Kyoga (East Africa) following human exploitation and introduction of non‐native fishes. Journal of Fish Biology, 37, 207–208. [Google Scholar]
  56. Ogutu‐Ohwayo, R. (1993). The effects of predation by Nile Perch, Lates niloticus L., on the fish of Lake Nabugabo, with suggestions for conservation of endangered endemic cichlids. Conservation Biology, 7, 701–711. [Google Scholar]
  57. Olowo, J. , & Chapman, L. (1999). Trophic shifts in predatory catfishes following the introduction of Nile perch into Lake Victoria. African Journal of Ecology, 37, 457–470. [Google Scholar]
  58. Peakall, R. , & Smouse, P. E. (2012). GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics, 28, 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Pinton, A. , Agnèse, J.‐F. , Paugy, D. , & Otero, O. (2013). A large‐scale phylogeny of Synodontis (Mochokidae, Siluriformes) reveals the influence of geological events on continental diversity during the Cenozoic. Molecular Phylogenetics and Evolution, 66, 1027–1040. [DOI] [PubMed] [Google Scholar]
  60. Piry, S. , Luikart, G. , & Cornuet, J. (1999). BOTTLENECK: A computer program for detecting recent reductions in the effective population size suing allele frequency data. View Article PubMed/NCBI Google Scholar, 90(4), 502–503. https://doi.org/10.1093/jhered/90.4.502 [Google Scholar]
  61. Ricciardi, A. , & Rasmussen, J. B. (1999). Extinction rates of North American freshwater fauna. Conservation Biology, 13, 1220–1222. [Google Scholar]
  62. Roberts, E. M. , Stevens, N. , O'Connor, P. , Dirks, P. , Gottfried, M. D. , Clyde, W. , … Hemming, S. (2012). Initiation of the western branch of the East African Rift coeval with the eastern branch. Nature Geoscience, 5, 289–294. [Google Scholar]
  63. Rozas, J. , Sánchez‐Delbarrio, J. C. , Messeguer, X. , & Rozas, R. (2003). DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics, 19, 2496–2497. [DOI] [PubMed] [Google Scholar]
  64. Rozen, S. , & Skaletsky, H. (2000). Primer3 on the www for general users and for biologist programmers. Methods of Molecular Biology, 132, 365–386. [DOI] [PubMed] [Google Scholar]
  65. Russell, J. , & Johnson, T. (2001). The Mid‐to Late Holocene History of Lake Edward, Uganda and its Implications for Hydrologic Change in the African Tropics. AGU Fall Meeting Abstracts, 2001. 04.
  66. Sato, A. , Takezaki, N. , Tichy, H. , Figueroa, F. , Mayer, W. E. , & Klein, J. (2003). Origin and speciation of haplochromine fishes in East African crater lakes investigated by the analysis of their mtDNA, Mhc genes, and SINEs. Molecular Biology and Evolution, 20, 1448–1462. [DOI] [PubMed] [Google Scholar]
  67. Schwarz, G. (1978). Estimating the dimension of a model. The annals of statistics, 6(2), 461–464. [Google Scholar]
  68. Selkoe, K. A. , & Toonen, R. J. (2006). Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecology Letters, 9, 615–629. [DOI] [PubMed] [Google Scholar]
  69. Stewart, K. (2009). Fossil fish from the Nile River and its Southern Basins In Dumont H. (Ed.), The Nile (pp. 677–704). Springer Netherlands. [Google Scholar]
  70. Sturmbauer, C. , Baric, S. , Salzburger, W. , Rüber, L. , & Verheyen, E. (2001). Lake level fluctuations synchronize genetic divergences of cichlid fishes in African lakes. Molecular Biology and Evolution, 18, 144–154. [DOI] [PubMed] [Google Scholar]
  71. Tamura, K. , Peterson, D. , Peterson, N. , Stecher, G. , Nei, M. , & Kumar, S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28, 2731–2739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Thieme, M. L. , Abell, R. , Burgess, N. , Lehner, B. , Dinerstein, E. , & Olson, D. (2005). Freshwater ecoregions of Africa and Madagascar: A conservation assessment. Island Press, Washington/Covelo/London. [Google Scholar]
  73. Turner, G. F. , Seehausen, O. , Knight, M. E. , Allender, C. J. , & Robinson, R. L. (2001). How many species of cichlid fishes are there in African lakes? Molecular Ecology, 10, 793–806. [DOI] [PubMed] [Google Scholar]
  74. Van Oosterhout, C. , Hutchinson, W. F. , Wills, D. P. , & Shipley, P. (2004). MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes, 4, 535–538. [Google Scholar]
  75. Verheyen, E. , Salzburger, W. , Snoeks, J. , & Meyer, A. (2003). Origin of the superflock of cichlid fishes from Lake Victoria, East Africa. Science, 300, 325–329. [DOI] [PubMed] [Google Scholar]
  76. Vokes, R. (2012). The politics of oil in Uganda. African Affairs, 111, 303–314. [Google Scholar]
  77. Wilson, K. (1990). Preparation of genomic DNA from bacteria In: Ausubel F. M., Brent R., Kingston R. E., Moore D. D., Seidman J. G., Smith J. A. & Struhl K. (Eds.), Current protocols in molecular biology. New York, NY: Wiley Interscience. [DOI] [PubMed] [Google Scholar]
  78. Yang, G. , Xiao, M. , Yu, Y. , & Xu, S. (2012). Genetic variation at mtDNA and microsatellite loci in Chinese longsnout catfish (Leiocassis longirostris). Molecular Biology Reports, 39, 4605–4617. [DOI] [PubMed] [Google Scholar]

Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES