Summary
Introduction.
Pseudomonas aeruginosa is as an important opportunistic human pathogen, which is associated with several clinical infections that are usually difficult to treat because of resistance to multiple antimicrobials. The production of extendedspectrum ß-lactamases (ESBLs) is an important mechanism of ß-lactam resistance. The aims of this study were to determine the prevalence of ESBLs, antimicrobial susceptibility, and to detect the blaTEM, blaSHV, and blaCTX-M genes.
Methods.
In this study, carried out from March 2013 to December 2014, 266 P. aeruginosa isolates were collected from patients admitted to teaching hospitals of Qazvin and Tehran, Iran. All isolates were initially screened for ESBL production by disk diffusion method and were further confirmed using a combined disk method. Antimicrobial susceptibility of ESBL-producing isolates was determined by standard disk diffusion method. Polymerase Chain Reaction (PCR) and sequencing techniques were employed for detection of blaTEM, blaSHV, and blaCTX-M genes.
Results.
In total, 262 (98.5%) P. aeruginosa isolates were nonsusceptible to the used extended spectrum cephalosporins, and, among these, 75 (28.6%) isolates were ESBL producers. Fifty-nine (78.7%) of ESBL-producing isolates showed multidrug-resistance pattern. Of 75 ESBL-positive isolates, the blaTEM-1 (26.7%) was the most common gene, followed by blaCTX-M-15 (17.3%), blaSHV-1 (6.7%), and blaSHV-12 (4%), either alone or in combination.
Conclusions.
The results of this study showed the notable prevalence of ESBLs among the clinical isolates of P. aeruginosa in Iran, indicating the urgency for the implementation of appropriate follow-up measures for infection control and proper administration of antimicrobial agents in our medical settings.
Key words: Pseudomonas aeruginosa, ESBL, blaTEM, blaSHV, blaCTX-M
Introduction
Pseudomonas aeruginosa (P. aeruginosa) is an important opportunistic clinical pathogen, causing a variety of healthcare-associated infections, such as pneumonia, sepsis, wounds, and urinary tract infections [1, 2]. This organism is an important cause of septic mortality in burn patients [3]. P. aeruginosa is a major cause of chronic lung infections in children and young adults with cystic fibrosis and can be especially severe in neutropenic or cancer patients [4]. Infections caused by P. aeruginosa are often difficult to treat because of its intrinsic and acquired resistance to many commonly prescribed antimicrobial agents, eventually leading to the emergence of multidrug-resistant P. aeruginosa (MDRPA) strain [5]. P. aeruginosa is physiologically resistant to many antibacterial agents, especially to the extended- spectrum cephalosporins, due to the production of different classes of extended spectrum ß-lactamases (ESBLs), overproduction of chromosomal AmpC cephalosporinase, and non-enzymatic mechanisms, such as efflux pumps and outer membrane impermeability [6], among others. Nosocomial infections due to MDRPA strains are increasingly recognized throughout the world and are associated with increased morbidity, mortality, and cost of therapy [7, 8].
ESBLs are one of the main leading causes of resistance to ß-lactam antibiotics among Gram-negative bacteria [6]. These enzymes are plasmid-encoded β-lactamases that mediate resistance to penicillins, first-, second- and third- generation cephalosporins, such as cefotaxime, ceftriaxone, and ceftazidime [6, 9]. TEM, SHV, and CTX-M are the major genetic groups of ESBLs amongst clinically important Gram-negative bacteria [9, 10].
These enzymes are most commonly found in Klebsiella pneumoniae (K. pneumoniae) and Escherichia coli (E. coli) and are also observed in other clinical isolates of Enterobacteriaceae and Pseudomonas [11, 12]. The first TEM-type β-lactamase, produced by a clinical E. coli strain, was reported in 1965. The TEM-type ESBLs are derivatives of TEM-1 and TEM-2 [9]. The SHV-type ESBLs may be found in clinical isolates more frequently than any other types of ESBLs and have been reported from several countries in Europe, such as Austria, France, Italy, and Greece, as well as in the United States and Australia [6, 9, 10]. The CTX-M-type ESBLs developed from TEM and SHV and can be divided into five subgroups according to their amino acid sequence similarities, including CTX-M-I, CTX-M-II, CTX-M-III, CTX-M-IV, and CTX-M-V [13, 14]. Detection of ESBLs is important for the surveillance and epidemiological studies of their transmission in medical settings [15]. One major concern regarding the spread of ESBL-producing P. aeruginosa within hospital settings is the treatment failure to infections caused by this organism due to the limitations in therapeutic choices [9, 16]. There are few reports describing the prevalence of TEM- or SHVtype ESBLs in P. aeruginosa in Iran. The aims of this study were to determine the prevalence of ESBLs and to detect the blaTEM, blaSHV and blaCTX-M-types ESBL genes among clinical isolates of P. aeruginosa collected from hospitals of Tehran and Qazvin, two central provinces of Iran.
Methods
Bacterial isolates
The clinical isolates of P. aeruginosa (one isolate per patient) were collected from hospitalized patients of Tehran and Qazvin provinces from March 2013 to December 2014. The bacterial isolates were collected from different clinical specimens, including urine, wounds, sputum, broncoalveolar lavage (BAL), trachea, and blood. These isolates were obtained from patients admitted to intensive care units (ICUs), internal medicine, general surgery, neurology, neurosurgery, and infectious disease wards. Specimens of these patients were sent to the microbiology laboratory of the hospitals under study. The study was approved by the ethics committee of Qazvin University of Medical Sciences (code IR.QUMS. REC.1394.147). Written informed consent was obtained from all subjects enrolled in this study. All isolates were identified as P. aeruginosa using standard microbiological and biochemical tests [17]. The isolates were stored at -70°C in trypticase soy broth (TSB) containing 20% glycerol and subcultured twice prior to testing.
ESBL screening
All isolates were initially screened for ESBLs production using the standard disc diffusion method, using ceftazidime (30μg), cefotaxime (30μg), ceftriaxone (30μg), cefpodoxim (30μg), and aztreonam (30μg). Isolates which were non-susceptible to any of third generation cephalosporins were selected for ESBLs detection phenotypically. The antibiotic disks were purchased from Mast (Mast Diagnostics Group Ltd). P. aeruginosa ATCC 27853 was used as a control strain in antimicrobial suscpetibility testings.
Confirmation of ESBL production
Phenotypic confirmatory tests [18], which were designed for detecting ESBLs in K. pneumoniae and E. coli, were also performed by comparing the inhibition zone of disks containing cefotaxime or ceftazidime with and without clavulanic acid. E. coli ATCC 25922, E. coli ATCC 35218 and K. pneumoniae ATCC 700603 were used as the quality control strains in antimicrobial susceptibility testing.
Molecular detection of ESBL-encoding genes
ESBL-producing isolates were subjected to Polymerase Chain Reaction (PCR) targeting blaTEM, blaSHV, blaCTXM- 1, blaCTX-M-2, blaCTX-M-8, blaCTX-M-9, and blaCTX-M-25 genes using the specific primers listed in Table I. Plasmid DNA was extracted using plasmid mini extraction kit (Bioneer Company, Korea). The PCR amplifications were performed in a thermocycler (Applied Biosystems, USA) as follows: 96° C for 5 min and 35 cycles of 1 min at 96° C, 1 min at a specific temperature for each primer and 1 min at 72° C and a final extension step of 10 min at 72° C. Amplification reactions were prepared in a total volume of 25 μl (24 μl of PCR master mix plus 1 μl of template DNA) including 5 ng of genomic DNA, 2.0 U of Taq DNA polymerase, 10 mM dNTP mix at a final concentration of 0.2 mM, 50 mM MgCl2 at a final concentration of 1.5 mM, 1 μM of each primer, and 1X PCR buffer (final concentration). PCR products were electrophoresed on a 1% agarose gel at 100 volts and then were stained with ethidium bromide solution and finally visualized in gel documentation system (UVtec, UK). The purified PCR products were sequenced by the Macrogen Company (Seoul, Korea). The sequence alignment and bioinformatics analyses were performed using the Basic Local Alignment Search Tool (BLAST) online program of the National Center for Biotechnology Information (freely available at http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Tab. I.
Primers used in this study for detecting ESBL-encoding genes.
| Targets | Primer Sequences (5'-3') | Annealing Temperature (°C) | References |
|---|---|---|---|
| TEM | ATGAGTATTCAACATTTCCG GACAGTTACCAATGCTTAATCA |
50 | 19 |
| TEM (Sequencing) | TAACCATGAGTGATAACACT
CCGATCGTTGTCAGAAGTAA |
50 | 19 |
| SHV | CTTTACTCGCCTTTATCG TCCCGCAGATAAATCACCA |
50 | 19 |
| SHV (Sequencing) | ACTGCCTTTTTGCGCCAGAT
CAGTTCCGTTTCCCAGCGGT |
56 | 19 |
| CTX-M-1 group | ATGGTTAAAAAATCACTGCGTC
TTGGTGACGATTTTAGCCGC |
55 | 20 |
| CTX-M-2 group | ATGATGACTCAGAGCATTCG
TGGGTTACGATTTTCGCCGC |
55 | 20 |
| CTX-M-8 group | ACTTCAGCCACACGGATTCA
CGAGTACGTCACGACGACTT |
55 | 20 |
| CTX-M-9 group | ATGGTGACAAAGAGAGTGCA
CCCTTCGGCGATGATTCTC |
55 | 20 |
| CTX-M-25 | CACACGAATTGAATGTTCAG
TCACTCCACATGGTGAGT |
50 | 21 |
Statistical analysis was performed for descriptive statistics, including frequencies, cross-tabulation of microbiological, clinical, and demographic characteristics, using the commercial software Statistical analysis software package (version 16, IBM SPSS Corporation, Armonk, NY, USA).
Results
During the study period from March 2013 to December 2014, a total of 266 isolates of P. aeruginosa were collected from different clinical specimens including blood (94 isolates; 35.3%), urine (80 isolates; 30.1%), wounds (29 isolates; 10.9%), trachea (26 isolates; 9.8%), sputum (19 isolates; 7.1%), and BAL (18 isolates; 6.8%). Isolates were obtained from patients admitted to intensive care units (99-37.2%), internal medicine (64-24.1%), infectious diseases (61-22.9%), general surgery (26-9.8%), neurosurgery (12-4.5%), and neurology (4-1.5%) wards.
One hundred and twenty-five (47%) were male and 141 (53%) were female. Out of the 266 P. aeroginosa isolates, 262 (98.5%) isolates were non-susceptible to at least one of the antibiotics used in the screening test and, among these, 75 (28.6%) isolates were identified as potential ESBL producers using combined disk method. Fifty-nine (78.7%) of ESBL-producing isolates were found to be multidrug-resistant (MDR), i.e. showed intermediate or fully resistance to at least three different classes of antimicrobial agents including β-lactams, aminoglycosides, and fluoroquinolones. Amikacin (58.7%) and piperacillin-tazobactam (53.3%) showed the highest rates of susceptibility among antimicrobials tested in this study, respectively (Table II). Further, 41 (54.7%) and 40 (53.5%) ESBL-producing isolates were fully or intermediate resistant to meropenem and imipenem, respectively. ESBL-producing isolates were mainly recovered from urine (30.2%), followed by wound (28.3%) samples. The patients affected were mainly those admitted in ICU (54.7%) and the internal wards (45.1%), respectively (Table III). Of the 75 P. aeruginosa isolates with ESBL phenotype, blaTEM-1 (20-26.7%) was the most common gene, followed by blaCTX-M-15 (13- 17.3%), blaSHV-1 (5-6.7%), and blaSHV-12 (3-4%), either alone or in combination (Table IV). In this study, isolates were, instead, negative for blaCTX-M-2, blaCTX-M-8, and blaCTX-M-9- group genes, as well as for blaCTX-M-25.
Tab. II.
Antimicrobial susceptibility of ESBL-producing P. aeruginosa isolated from hospitals of Qazvin and Tehran (n = 75).
| Antibiotics | S (%) | I (%) | R (%) |
|---|---|---|---|
| Amikacin | 44 (58.7) | 10 (13.3) | 21 (28) |
| Piperacillin-tazobactam | 40 (53.3) | 9 (12) | 26 (34.7) |
| Imipenem | 35 (46.7) | 9 (12) | 31 (41.3) |
| Meropenem | 34 (45.3) | 7 (9.3) | 34 (45.3) |
| Cefepime | 30 (40) | 1 (1.3) | 44 (58.7) |
| Piperacillin | 26 (34.7) | 8 (10.7) | 41 (54.7) |
| Ciprofloxacin | 24 (32) | 1 (1.3) | 50 (66.7) |
| Gentamicin | 22 (29.3) | - | 53 (70.7) |
| Ceftazidime | 22 (29.3) | 4 (5.3) | 49 (65.3) |
| Tobramycin | 22 (29.3) | 3 (4) | 50 (66.7) |
| Ofloxacine | 21 (28) | 2 (2.7) | 52 (69.3) |
| Levofloxacin | 18 (24) | 2 (2.7) | 55 (73.3) |
| Ticarcillin | 17 (22.7) | 1 (1.3) | 57 (76) |
| Aztreonam | 14 (18.7) | 10 (13.3) | 51 (68) |
| Carbenicilin | 14 (18.7) | 3 (4) | 58 (77.3) |
| Ceftriaxone | 10 (13.3) | 7 (9.3) | 58 (77.3) |
| Cefotaxime | 5 (6.7) | 8 (10.7) | 62 (82.7) |
S: Sensitive, I: Intermediate, R: Resistant.
Tab. III.
Frequency of ESBL-producing isolates broken down by hospitals ward and source of clinical specimen.
| Hospital wards | n (%) |
|---|---|
| ICU | 33 (44) |
| Internal medicine | 19 (25.3) |
| Infectious disease | 12 (16) |
| Surgery | 8 (10.7) |
| Neurosurgery | 2 (2.7) |
| Neurology | 1 (1.3) |
| Clinical specimens | (n/%) |
| Blood | 24 (32) |
| Urine | 17 (22.7) |
| Trachea | 13 (17.3) |
| Wound | 9 (12) |
| BAL | 6 (8) |
| Sputum | 6 (8) |
ICU: intensive care unit, BAL: bronchoalveolar lavage
Tab. IV.
Distribution of blaSHV,blaTEM, and blaCTX-M genes in ESBL-producing P. aeruginosa isolates.
| Resistance genes | n (%) |
|---|---|
| blaSHV-1 | 4 (5.3) |
| blaSHV-12 | 3 (4) |
| blaTEM-1 | 12 (16) |
| blaCTX-M-15 | 4 (5.3) |
| blaSHV-1 and blaCTX-M-15 | 1 (1.3) |
| blaTEM-1 and blaCTX-M15 | 8 (10.7) |
| No blaTEM-1, blaSHV-1 and blaCTX-M-15 | 43 (57.3) |
Discussion
P. aeruginosa has recently emerged as a major cause of healthcare-associated infections, especially in immunocompromised people and burn patients [22, 23]. The treatment of P. aeruginosa infections is increasingly complicated due to both intrinsic and acquired resistance to the most commonly prescribed antibiotics in hospital settings [2, 24]. The emergence of ESBL has become a matter of serious concern for the treatment of patients in Iran. ESBL detection is not routinely tested in most laboratories in Iran. There are only few reports on prevalence of ESBL among P. aeruginosa isolates in our country.
In the present study, 262 (98.5%) P. aeruginosa isolates were non-susceptible to at least one of the antibiotics used in the ESBL screening test and, among these, 75 (28.6%) isolates were ESBL positive. The prevalence rate of ESBL in our study is lower than the rate reported by Mirsalehian et al. (39.4%) [25] and Shakibaie et al. (34%) [26] from two burn centers in Iran, Begum et al. from Bangladesh (37.8%) [27], and Senthamaria et al. from India (42.3%) [28], but higher than the rate found by Zafar et al. from Egypt (7.4%) [29], Umadevi et al. from India (19.4%) [30] and Woodford et al. from United Kingdom (3.7%) [31]. In our study, 78.7% of ESBLproducing isolates were found to be MDR and showed relatively higher resistance rates to most antibiotics tested. These results are in accordance with those of other studies, such as those conducted by Fallah et al. and Hakemi Vala et al. in Iran [32, 33]. Our findings demonstrated that amikacin (58.7%) and piperacillin-tazobactam (53.3%) showed the highest rates of susceptibility among the antimicrobials tested, whereas cefotaxime and ceftriaxone revealed low suscepibility rates of 6.7% and 13.3%, respectively. The inappropriate management of infections through unnecessary and widespread administration of antibacterial agents is likely to be the main predisposing factor leading to the emergence of resistant bacteria in our medical centers. Moreover, the high resistance rate of ESBLs found among the isolates in this study emphasizes the need for a local and national antimicrobial resistance surveillance system for monitoring the administration of antimicrobials in our hospital settings.
It should be noted that, in this study, 71.5% of extended spectrum cephalosporin non-susceptible isolates were ESBL negative, which can be associated with other resistance mechanisms such as overproduction of chromosomal cephalosporinase (AmpC), up-regulation of efflux systems or decreased outer-membrane permeability. Additionally, our data showed that 54.7% and 53.5% of ESBL-producing isolates were non-susceptible to meropenem and imipenem, respectively. Since in hospital setting the appropriate treatment of infections caused by MDR Gram-negative bacteria is generally achieved by the administration of carbapenems, this finding indicated that the available therapeutic choices are currently limited. This has a relevant clinical impact, especially in the future in case these strains should become more prevalent. This study, in line with previous studies [34, 35], showed that ESBL-producing isolates were mostly collected from the patients admitted to ICUs. It seems that prolonged period of ICU stay, exposure to broad spectrum antibiotics, chronic underlying conditions, and the use of invasive techniques and devices predispose patients to infection caused by these resistant isolates.
In the present study, 26.7%, 17.3%, 6.7%, and 4% of ESBL-producing P. aeruginosa isolates carried blaTEM-1, blaCTX-M-15, blaSHV-1, and blaSHV-12 genes alone or in combination, respectively. In the literature, there have been only rare reports of blaSHV-12 and blaCTX-M-15-types ESBLs among P. aeruginosa worldwide. We believe that this is the first report of blaCTX-M-15 and blaSHV-12-related ESBL genes among P. aeruginosa isolates collected from Qazvin and Tehran hospitals. Shakibaie et al. reported that 6.6%, 4.1%, and 2.5% of ESBL-producing P. aeruginosa isolates carried blaSHV, blaPER, and blaTEM family genes, respectively [26]. In another study from Iran, Shahcheraghi et al. reported that 24%, 22%, 17%, and 9% of MDR isolates of P. aeruginosa harbored blaVEB, blaSHV, blaPER, and blaTEM genes, respectively [36]. In Japan, Uemura et al. showed the presence of blaSHV-12 among P. aeruginosa isolates collected from burn patients [37]. Polotto et al. reported that the blaCTX-M-2 (19.6%) gene was the most prevalent ESBL gene in Brazil [38]. Together, these data indicate successful spread of the ESBL-encoding genes around the world.
Conclusions
Findings of the our study show a high prevalence of ESBL- producing P. aeruginosa isolates carrying blaCTX-M-15 and blaSHV-12 genes in Iran. The presence of ESBL-producing bacteria within the healthcare setting in Iran should be considered a public health concern both therapeutically and epidemiologically. As such, the identification, treatment, and infection control and management of patients infected with these organisms is of prime necessity.
ACKNOWLEDGMENTS
This study was financially supported by Research Deputy of Qazvin University of Medical Sciences, Qazvin, Iran.
The authors declare no conflict of interest
References
- 1.Jefferies JMC, Cooper T, Yam T, Clarke SC. Pseudomonas aeruginosa outbreaks in the neonatal intensive care unit – a systematic review of risk factors and environmental sources. J Med Microbiol. 2012;61:1052–1061. doi: 10.1099/jmm.0.044818-0. [DOI] [PubMed] [Google Scholar]
- 2.Lister PD, Wolter DJ, Hanson ND. Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin Microbiol Rev. 2009;22:582–610. doi: 10.1128/CMR.00040-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Church D, Elsayed S, Reid O, Winston B, Lindsay R. Burn wound infections. Clin Microbiol Rev. 2006;19:403–434. doi: 10.1128/CMR.19.2.403-434.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Sorde R, Pahissa A, Rello J. Management of refractory Pseudomonas aeruginosa infection in cystic fibrosis. Infect Drug Resist. 2011;4:31–41. doi: 10.2147/IDR.S16263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Strateva T, Yordanov D. Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med Microbiol. 2009;58:1133–1148. doi: 10.1099/jmm.0.009142-0. [DOI] [PubMed] [Google Scholar]
- 6.Rawat D, Nair D. Extended-spectrum beta-lactamases in Gram Negative Bacteria. J Glob Infect Dis. 2010;2:263–274. doi: 10.4103/0974-777X.68531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hirsch EB, Tam VH. Impact of multidrug-resistant Pseudomonas aeruginosa infection on patient outcomes. Expert Rev Pharmacoecon Outcomes Res. 2010;10:441–451. doi: 10.1586/erp.10.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Koenig SM, Truwit JD. Ventilator-associated pneumonia: diagnosis, treatment, and prevention. Clin Microbiol Rev. 2006;19:637–657. doi: 10.1128/CMR.00051-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Paterson DL, Bonomo RA. Extended-spectrum beta-lactamases: a clinical update. Clin Microbiol Rev. 2005;18:657–686. doi: 10.1128/CMR.18.4.657-686.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Bradford PA. Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev. 2001;14:933–951. doi: 10.1128/CMR.14.4.933-951.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Adeyankinnu FA, Motayo BO, Akinduti A, Akinbo J, Ogiogwa JI, Aboderin BW, Agunlejika RA. A multicenter study of betalactamase resistant Escherichia coli and Klebsiella pneumoniae reveals high level chromosome mediated extended spectrum β-lactamase resistance in Ogun state, Nigeria. Interdiscip Perspect Infect Dis. 2014;2014:7–7. doi: 10.1155/2014/819896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kaur M, Aggarwal A. Occurrence of the CTX-M, SHV and the TEM genes among the extended spectrum beta-lactamase producing isolates of Enterobacteriaceae in a tertiary care hospital of north India. J Clin Diagn Res. 2013;7:642–645. doi: 10.7860/JCDR/2013/5081.2872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Roschanski N, Fischer J, Guerra B, Roesler U. Development of a multiplex real-time PCR for the rapid detection of the predominant beta-lactamase genes CTX-M, SHV, TEM and CITtype AmpCs in Enterobacteriaceae. PLoS One. 2014;9:e100956–e100956. doi: 10.1371/journal.pone.0100956. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Pitout JD, Hossain A, Hanson ND. Phenotypic and molecular detection of CTX-M-beta-lactamases produced by Escherichia coli and Klebsiella spp. J Clin Microbiol. 2004;42:5715–5721. doi: 10.1128/JCM.42.12.5715-5721.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Garrec H, Drieux-Rouzet L, Golmard JL, Jarlier V, Robert J. Comparison of nine phenotypic methods for detection of extended- spectrum beta-lactamase production by Enterobacteriaceae. J Clin Microbiol. 2011;49:1048–1057. doi: 10.1128/JCM.02130-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Dhillon RH-P, Clark J. ESBLs: A clear and present danger? Crit Care Res Pract. 2012;2012:625170–625170. doi: 10.1155/2012/625170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Mahon CR, Lehman DC, Manuselis G. Textbook of diagnostic microbiology. 4th ed. Maryland Heights, Mo: Saunders/Elsevier; 2011. [Google Scholar]
- 18.Jiang X, Zhang Z, Li M, Zhou D, Ruan F, Lu Y. Detection of extended-spectrum beta-lactamases in clinical isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2006;50:2990–2995. doi: 10.1128/AAC.01511-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Naiemi NA, Duim B, Savelkoul PH, Spanjaard L, Jonge E, Bart A, Vandenbroucke-Grauls CM, Jong MD. Widespread transfer of resistance genes between bacterial species in an intensive care unit: implications for hospital epidemiology. J Clin Microbiol. 2005;43:4862–4864. doi: 10.1128/JCM.43.9.4862-4864.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Ben Achour N, Mercuri PS, Power P, Belhadj C, Ben Moussa M, Galleni M, Belhadj O. First detection of CTX-M-28 in a Tunisian hospital from a cefotaxime-resistant Klebsiella pneumoniae strain. Pathol Biol (Paris) 2009;57:343–348. doi: 10.1016/j.patbio.2008.07.016. [DOI] [PubMed] [Google Scholar]
- 21.Schwaber MJ, Navon-Venezia S, Chmelnitsky I, Leavitt A, Schwartz D, Carmeli Y. Utility of the VITEK 2 Advanced Expert System for identification of extended-spectrum beta-lactamase production in Enterobacter spp. J Clin Microbiol. 2006;44:241–243. doi: 10.1128/JCM.44.1.241-243.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Anvarinejad M, Japoni A, Rafaatpour N, Mardaneh J, Abbasi P, Amin Shahidi M, Dehyadegari MA, Alipour E. Burn patients infected with metallo-beta-lactamase-producing Pseudomonas aeruginosa: multidrug-resistant strains. Arch Trauma Res. 2014;3:e18182–e18182. doi: 10.5812/atr.18182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Sydnor ER, Perl TM. Hospital epidemiology and infection control in acute-care settings. Clin Microbiol Rev. 2011;24:141–173. doi: 10.1128/CMR.00027-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Dalhoff A. Global Fluoroquinolone resistance epidemiology and implictions for clinical use. Interdiscip Perspect Infect Dis. 2012;2012:37–37. doi: 10.1155/2012/976273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Mirsalehian A, Feizabadi M, Nakhjavani FA, Jabalameli F, Goli H, Kalantari N. Detection of VEB-1, OXA-10 and PER-1 genotypes in extended-spectrum beta-lactamase-producing Pseudomonas aeruginosa strains isolated from burn patients. Burns. 2010;36:70–74. doi: 10.1016/j.burns.2009.01.015. [DOI] [PubMed] [Google Scholar]
- 26.Shakibaie M SF, Hashemi A, Adeli S. Detection of TEM, SHV and PER type extended-spectrum beta-lactamase genes among clinical strains of Pseudomonas aeroginosa isolated from burnt patients Shafa- hospital, Kerman, Iran. Iran J Basic Med Sci. 2008;11:104–111. [Google Scholar]
- 27.Begum S, Salam MA, Alam KF, Begum N, Hassan P, Haq JA. Detection of extended spectrum beta-lactamase in Pseudomonas spp. isolated from two tertiary care hospitals in Bangladesh. BMC Research Notes. 2013;6:7–7. doi: 10.1186/1756-0500-6-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Resistance pattern of Pseudomonas aeruginosa in a tertiary care hospital of Kanchipuram, Tamilnadu, India. J Clin Diagn Res. 2014;8:30–32. doi: 10.7860/JCDR/2014/7953.4388. S S, Reddy A SK, S S, C A, V S, Ms K, Sk A, V V. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Zafer MM, Al-Agamy MH, El-Mahallawy HA, Amin MA, Ashour MS. Antimicrobial resistance pattern and their beta- lactamase encoding genes among Pseudomonas aeruginosa strains isolated from cancer patients. Biomed Res Int. 2014;2014:101635–101635. doi: 10.1155/2014/101635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Umadevi S, Joseph NM, Kumari K, Easow JM, Kumar S, Stephen S, Srirangaraj S, Raj S. Detection of extended spectrum beta lactamases, ampc beta lactamases and metallobetalactamases in clinical isolates of ceftazidime resistant Pseudomonas aeruginosa. Braz J Microbiol. 2011;42:1284–1288. doi: 10.1590/S1517-83822011000400006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Woodford N, Zhang J, Kaufmann ME, Yarde S, Tomas Mdel M, Faris C, Vardhan MS, Dawson S, Cotterill SL, Livermore DM. Detection of Pseudomonas aeruginosa isolates producing VEB-type extended-spectrum beta-lactamases in the United Kingdom. J Antimicrob Chemother. 2008;62:1265–1268. doi: 10.1093/jac/dkn400. [DOI] [PubMed] [Google Scholar]
- 32.Fallah F, Borhan RS, Hashemi A. Detection of bla(IMP) and bla(VIM) metallo-beta-lactamases genes among Pseudomonas aeruginosa strains. Int J Burns Trauma. 2013;3:122–124. [PMC free article] [PubMed] [Google Scholar]
- 33.Hakemi Vala M, Hallajzadeh M, Hashemi A, Goudarzi H, Tarhani M, Sattarzadeh Tabrizi M, Bazmi F. Detection of Ambler class A, B and D ß-lactamases among Pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates from burn patients. Ann Burns Fire Disasters. 2014;27:8–13. [PMC free article] [PubMed] [Google Scholar]
- 34.Santanirand P, Malathum K, Chadlane T, Laolerd W. Distribution of carbapenem resistant Acinetobacter baumannii and Pseudomonas aeruginosa and ESBL-producing organisms colonization among intensive care patients. BMC Proceedings. 2011;5:293–293. [Google Scholar]
- 35.Ramazanzadeh R, Chitsaz M, Bahmani N. Prevalence and antimicrobial susceptibility of extended-spectrum beta-lactamaseproducing bacteria in intensive care units of Sanandaj general hospitals (Kurdistan, Iran) Chemotherapy. 2009;55:287–292. doi: 10.1159/000224656. [DOI] [PubMed] [Google Scholar]
- 36.Shahcheraghi F, Nikbin VS, Feizabadi MM. Prevalence of ESBLs genes among multidrug-resistant isolates of Pseudomonas aeruginosa isolated from patients in Tehran. Microb Drug Resist. 2009;15:37–39. doi: 10.1089/mdr.2009.0880. [DOI] [PubMed] [Google Scholar]
- 37.Uemura S, Yokota S, Mizuno H, Sakawaki E, Sawamoto K, Maekawa K, Tanno K, Mori K, Asai Y, Fujii N. Acquisition of a transposon encoding extended-spectrum beta-lactamase SHV-12 by Pseudomonas aeruginosa isolates during the clinical course of a burn patient. Antimicrob Agents Chemother. 2010;54:3956–3959. doi: 10.1128/AAC.00110-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Polotto M, Casella T, Lucca Oliveira MG, Rúbio FG, Nogueira ML, Almeida MT, Nogueira MC. Detection of P. aeruginosa harboring bla CTX-M-2, bla GES-1 and blaGES-5, bla IMP-1 and blaSPM-1 causing infections in Brazilian tertiary-care hospital. BMC Infect Dis. 2012;12:176–176. doi: 10.1186/1471-2334-12-176. [DOI] [PMC free article] [PubMed] [Google Scholar]