Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2017 Sep 6;7(5):298. doi: 10.1007/s13205-017-0931-2

Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene

Pijush Mallick 1,2,✉, Shruti Chattaraj 1, Samir Ranjan Sikdar 1,✉
PMCID: PMC5587416  PMID: 28884065

Abstract

The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus squarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P. florida and L. squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h, respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611–867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p, pfls 1m and pfls 1s, and pfls 1e and P. florida.

Keywords: ISSR, Polymorphism, rRNA-ITS gene, Mushroom somatic hybrid

Introduction

Production of somatic hybrids in edible mushrooms through protoplast fusion had been attempted in the past and basidiocarp was successfully developed (Ohmasa 1986; Liang and Chang 1989; Mallick and Sikdar 2014, 2015). Characterizations of hybrids were also done through mycelial morphology, fruit body yield, and molecular DNA markers which successfully proved the hybridity (Witte et al. 1989; Mallick and Sikdar 2014, 2015). Commonly used molecular markers that showed polymorphism and genetic diversity in mushroom hybrids, fungi and plants are amplified fragment length polymorphism (AFLP), simple sequence repeat (SSR), inter-simple sequence repeats (ISSR), isozyme, randomly amplified polymorphic DNA (RAPD), restriction fragment length polymorphism (RFLP), etc. (Nagaoka and Ogihara 1997; Mignouna et al. 2002; Shen et al. 2006; Chakraborty and Sikdar 2008; Shao et al. 2011; Yüzbaşıoğlu et al. 2011; Staniaszek et al. 2002; Aylward et al. 2014; Mallick and Sikdar 2014, 2015, 2016; Naik et al. 2017). There are no such reports on chromosome mapping by fluorescent dye (FISH or GISH) in fungal somatic hybrids, where the approach is available in plant system (Rokka et al. 1998).

However, in the past, the internal transcribed spacer (ITS) of ribosomal RNA was used for interspecies strain identification (Jorgenson and Cluster 1988; Cullings et al. 1996; Vogler and Bruns 1998; Fan et al. 2015), intraspecies strain relationships (Baura et al. 1992), and study of phylogeny analysis and hybrid origin (Wang et al. 2007). Sequencing of nuclear ribosomal DNA of ITS1-5.8S rRNA-ITS2 regions is also used for species identification in fungi (Chen et al. 2001; Park et al. 2004; Tuchwell et al. 2005; Zhao et al. 2012). It has been reported that the ITS region showed maximum sequence divergence than their flanking coding regions (Hillis and Dixon 1991), where they often used to distinguish between related fungal species (Mitchell and Bresinsky 1999; Calvo-Bado et al. 2000; Manian et al. 2001). The rRNA-ITS sequencing is used for the characterization of somatic hybrids in plant (Babiychuk et al. 1992; Lelivelt et al. 1993; Sakata and Monma 1993; Saito et al. 1994; Zanke et al. 1995) and in edible mushroom (Mallick and Sikdar 2015, 2016). Lentinula edodes mushroom strain identification was also reported based on sequence polymorphism of 5.8S rRNA gene (Kwan et al. 1991). Though the rRNA-ITS region is highly conserved, sequence variation was observed in different species level during taxonomic studies (Bruns et al. 1991; Hillis and Dixon 1991).

In our laboratory, we successfully developed 12 pfls somatic hybrids between mushroom strain Pleurotus florida and Lentinus squarrosulus, which were successfully characterized by mycelial morphology, fruit body yield, and RFLP pattern of rRNA-ITS region (Mallick and Sikdar 2015). However, in this communication we will report about the hybrid genetic diversity through PCR-based ISSR and sequencing of rRNA-ITS region of pfls hybrids and parents.

Materials and methods

Strains and culture conditions

The strain of P. florida was obtained from ‘National Research Centre for Mushroom’ Solan, Himachal Pradesh, India. The L. squarrosulus fruit body was collected from dead wood stock at Falta Experimental Farm, Bose Institute, 24 Parganas (South), West Bengal, India and its vegetative culture was prepared in the laboratory. Twelve pfls somatic hybrids were developed in our laboratory through PEG-mediated protoplast fusion between these two parental strains (Mallick and Sikdar 2015). All the cultures were maintained in PDA (potato–dextrose–agar, pH 6.2) medium at 24 °C. For DNA extraction, cultures were grown in liquid MYG (10 g/l malt, 4 g/l yeast, and 10 g/l glucose, pH 6.2) medium for 14 days (P. florida and pfls hybrids) and 10 days (L. squarrosulus) at 24 °C. Fully grown mycelial mats were washed with sterile water and freeze-dried for next step.

DNA extraction, PCR, and gel run

Freeze-dried mycelial tissue was used for genomic DNA extraction using modified CTAB method (Dellaporta et al. 1983) and purified DNA was used for ISSR and rRNA-ITS amplification. The ISSR reaction was carried out with slight modification of the protocol of Bornet and Branchard (2001) and previously described by Mallick and Sikdar (2014). The ITS1-5.8S-ITS2 region was amplified by primer ITS1 (forward 5′ TCCGTAGGTGAACCTGCGG 3′) and ITS4 (reverse 5′ TCCTCCGCTTATTGATATGC 3′) by White et al. (1990). The PCR amplification was done in an automated thermo-cycler (Applied Biosystems) by following the protocol of Mallick and Sikdar (2016).

Amplified ISSR and rRNA-ITS products were run on 1.8 and 1.5% agarose gel pre-stained with ethidium bromide solution using 1× TAE buffer, respectively. The gels were run at 80 V for 3 h for each. The banding profiles were visualized under UV transilluminator and data were recorded in a Molecular Analyst Gel Documentation System (Bio-rad, Hercules, CA). DNA Ruler Plus (100–3000 bp) ladder (MBI, Fermentas) was used as a standard molecular weight marker.

PIC value and statistical analysis

Polymorphic information content (PIC) is used to identify and refer the relative value of each marker with respect to the amount of polymorphism exhibited in a population. Here, PIC value is calculated according to Weir (1996) equation [PIC = {1–(ΣP2i)}], where ‘i’ is the total number of alleles detected for each ISSR marker, and ‘Pi’ is the frequency of ith plus allele in the pfls hybrid genotype. The ISSR products were scored as present (1) or absent (0) for each primer genotype combination. The bivariate ‘0–1’ data were analyzed into a binomial matrix using the SPSS software (IBM, version.19). Based on Jaccard’s proximity matrix (Jaccard 1901) and unweighted pair group method with mathematic average (UPGMA) algorithm, a dendrogram was generated, where hybrids and parents were grouped by genetic distances.

Sequence alignment and clustering

The rRNA-ITS PCR products were purified by sodium acetate precipitation followed by ethanol wash. The purified fragments were sequenced in our institutional core facility using Big Dye Terminator 3.1 method and nucleotide bases were read in an automated sequencer system (Applied Biosystems). Sequenced data were submitted to NCBI GenBank and aligned in CLUSTALW software (Thompson et al. 1994).

Results

Molecular genetic analysis by ISSR

The five ISSR primers showed clear and reproducible banding pattern in all the strains. The details of used ISSR primers are shown in Table 1. A total of 54 unambiguous and reproducible amplicons were scored for all the samples against all primers. The DNA banding profiles generated by primer ISSR-02 and ISSR-03 are shown in Fig. 1a, b. The five ISSR primers amplified the fragments with 98.14% polymorphism across the 14 strains studied and the size ranged from 250 to 3000 bp. Primer ISSR-3 [(CAA)5] and ISSR-11 [(CAC)3GC] produced maximum bands (13) ranged from 520 to 3000 bp and 300 to 2600 bp with PIC value 0.491 and 0.498, respectively. The PIC value of five ISSR primers was ranged from 0.433 (ISSR-12) to 0.498 (ISSR-11) with a mean of 0.478.

Table 1.

Details of ISSR primers used in this study

Primer Sequence (5′-3′) [repeat motif] No. of scored bands Size range (approx in bp) PIC value
ISSR-01 GACAGACAGACAGACA, [(GACA)4] 9 800–3000 0.493
ISSR-02 CAGCAGCAGCAGCAG, [(CAG)5] 12 250–2800 0.474
ISSR-03 CAACAACAACAACAA, [(CAA)5] 13 520–3000 0.491
ISSR-11 CACCACCACGC, [(CAC)3GC] 13 300–2600 0.498
ISSR-12 GAGGAGGAGGC, [(GAG)3GC] 7 500–1700 0.433
Open in a new tab

Fig. 1.

Fig. 1

Open in a new tab

ISSR profiles of pfls hybrids and parents. a Primer ISSR-02 b Primer ISSR-03. Lanes: M—marker, 100 bp DNA ruler plus., C—control, Lane 1—L. squarrosulus, Lane 2—pfls 1q, Lane 3—pfls 1e, Lane 4—pfls 1g, Lane 5—pfls 1p, Lane 6—pfls 1h, Lane 7—pfls 1n, Lane 8—pfls 1s, Lane 9—pfls 1m, Lane 10—pfls 1k, Lane 11—pfls 1o, Lane 12—pfls 1i, Lane 13—pfls 1j and Lane 14—P. florida. Left arrows depict bands from parent L. squarrosulus and right arrows from P. florida

Jaccard’s proximity matrix showed the genetic distances between the pfls hybrids and parents, and the dissimilarity coefficient ranged from 0.00 to 5.916 (Table 2). The most identical relationship was found between hybrid pfls1i–pfls1l (0.00) and distant relationship between parent L. squarrosulus–hybrid pfls1n (5.916). Among the hybrid strains, maximum genetic distances were found in between hybrid pfls 1e–pfls 1p and hybrid pfls 1h–pfls 1n (5.477). Another parent P. florida showed minimum genetic distance to hybrid pfls 1m (3.742). UPGMA-based dendrogram produced three major clusters in which hybrids and parents were grouped between each other (Fig. 2). Hybrid pfls 1l, pfls 1i, and pfls 1k were grouped in cluster-I, hybrid pfls 1q, pfls 1s, and pfls 1e were grouped in cluster-II, and hybrid pfls 1p, pfls 1n, and pfls 1j were grouped in cluster-III. No parental strains were directly grouped with any of the pfls hybrids. Parent P. florida showed closeness to hybrid pfls 1m and another parent L. squarrosulus showed closeness to hybrid pfls 1h in this dendrogram.

Table 2.

Proximity matrix generated from five ISSR profiles of pfls hybrids and parents

Proximity Matrix
L. squarrosulus Pfls1q Pfls1e Pfls1g Pfls1p Pfls1h pfls1n Pfls1s Pfls1m Pfls1k Pfls1l Pfls1i Pfls1j P. florida
L. squarrosulus 0.000
pfls1q 5.000 0.000
pfls1e 4.000 3.000 0.000
pfls1g 4.583 2.449 2.236 0.000
pfls1p 5.477 5.000 5.477 5.000 0.000
pfls1h 3.000 4.243 3.606 3.742 5.196 0.000
pfls1n 5.916 4.243 5.000 4.472 3.317 5.477 0.000
pfls1s 5.099 2.236 3.162 2.646 4.899 4.123 4.359 0.000
pfls1m 5.831 5.000 5.099 4.796 4.243 5.385 3.606 4.899 .000
pfls1k 5.385 3.464 3.873 3.162 4.796 4.472 4.243 3.317 4.796 0.000
pfls1l 5.292 3.317 3.742 3.000 4.899 4.359 4.359 3.162 4.899 1.000 .000
pfls1i 5.292 3.317 3.742 3.000 4.899 4.359 4.359 3.162 4.899 1.000 0.000 0.000
pfls1j 5.568 5.099 5.196 4.899 3.606 5.292 3.742 4.796 4.123 4.472 4.583 4.583 0.000
P. florida 4.690 4.583 4.243 4.123 4.000 4.583 4.123 4.690 3.742 4.123 4.243 4.243 4.123 0.000
Open in a new tab

Fig. 2.

Fig. 2

Open in a new tab

Dendrogram showing the relationship amongst the pfls somatic hybrid lines and their parents using genetic divergence obtained by ISSR primers and UPGMA method of clustering of Euclidean distance

The rRNA-ITS sequence polymorphism

The primers ITS1 and ITS4 amplified the ITS1-5.8S rRNA-ITS2 region with a short portion of the small and large ribosomal subunits. PCR product showed a single band in gel in different sizes and the sequenced data ranged from 611 bp in hybrid pfls 1o to 867 bp in hybrid pfls 1s, while the parents P. florida and L. Squarrosulus were 672 and 668 bp, respectively. The submitted NCBI GenBank accession numbers are: KF150316 (L. squarrosulus), KF150319 (pfls 1q), KF150329 (pfls 1e), KF150328 (pfls 1g), KF150320 (pfls 1p), KF150327 (pfls 1h), KF150322 (pfls 1n), KF150318 (pfls 1s), KF150323 (pfls 1m), KF150324 (pfls 1k), KF150321 (pfls 1o), KF150326 (pfls 1i), KF150325 (pfls 1j), and KF150306 (P. florida).

Maximum sequence polymorphism is found in the ITS1 and ITS2 regions of pfls hybrids, where two parental strains showed huge nucleotide variation between each other. Hybrid pfls 1h, pfls 1p, pfls 1o, and pfls 1e showed maximum sequence variation compared to other hybrids in the whole ITS1-5.8S-ITS2 region. Hybrids pfls 1e and pfls 1p, and pfle 1o showed maximum sequence similarity with parents P. florida and L. squarrosulus, respectively. However, in the most conserved 5.8S region, sequence dissimilarities in between each hybrid were also seen (Fig. 3). The nucleotide polymorphism is found from single base ‘A/T/G/C’ (pfls 1i, pfls 1k, pfls 1n, pfls 1p, pfls 1g, and pfls 1h) to four bases ‘GTTC’ (only in pfls 1k). The polymorphic base(s) matched with neither any hybrid nor any parent except few single. Hybrids pfls 1p and pfls 1e showed maximum similarity with parents L. squarrosulus and P. florida, respectively. Throughout the entire sequence of pfls hybrids, few bases are found at different position which did not match with any of the parental sequence. The inserted new bases may be considered as recombinant bases occurred during random recombination of two parental nuclei or it might happen due to intra-genomic alteration in these particular hybrids.

Fig. 3.

Fig. 3

Open in a new tab

Multiple sequence alignment of 5.8S rRNA gene of pfls hybrids and their parents. Black box shaded regions showing similarities. Gaps are denoted by dashes

Cluster analysis of pfls hybrids with their parents based on rRNA-ITS sequence

All the hybrids showed maximum sequence similarity with parent L. squarrosulus than P. florida. The rooted tree is developed using UPGMA clustering method based on the whole ITS1-5.8S rRNA-ITS2 sequence of all pfls hybrids and parents (Fig. 4). Three distinct groups were developed between L. squarrosulus and pfls 1p, pfls 1m, and pfls 1s, pfls 1e and P. florida. Rest of the pfls hybrids did not group directly with any of the parents or hybrids. They remain in the out-group or intra-cluster region.

Fig. 4.

Fig. 4

Open in a new tab

The rRNA-ITS sequence-based dendogram generated by UPGMA method of clustering of pfls hybrids and parents

Discussion

In the present study, genetic recombination between the two parental genera was successfully established by ISSR and rRNA-ITS sequence analysis. Recombination between the two parental genomes during fusion is random and there are no such techniques particularly in this event which can detect the exact mechanism. In hybrid genome, the independent genetic materials from both the nuclei are constructed by recombination, deletion or intra-genomic rearrangement. Our study revealed that the pfls hybrids are recombinant of the two parents, L. squarrosulus and P. florida.

The five ISSR profiles showed that the banding patterns of the pfls somatic hybrids neither represent the sum of parental bands nor resemble each other among the hybrid population. This type of phenomenon strongly proved that all the pfls hybrid strains were not heterokaryons of the parental nuclei rather after protoplast fusion between the two different mushroom genera, synkaryon was formed which was followed by chromosome elimination or deletion and somatic recombination. Similar observations were reported by previous works (Primrose 1987; Chakraborty and Sikdar 2008; Mallick and Sikdar 2014). Excluding the common band, there were little recombinant type of bands present in the gel which did not match with any of the parents and this strongly proved the hybridity due to recombination. However, the genetic distances between each pfls hybrid with parents also showed the nature of polymorphism generated by ISSR markers with maximum PIC values. The results proved that the ISSR is one of the reproducible molecular markers for hybrid characterization and analysis of genetic distance.

The ITS1-5.8S-ITS2 region is one of the most popular loci used in molecular phylogenetic analysis (Alvarez and Wendel 2003). Previous studies on fungal rRNA-ITS region in both molecular systematics and ecological aspects resulted in the deposition of about two hundred thousand Sanger-derived sequences in the international nucleotide sequence database (Karsch-Mizrachi et al. 2012). However, RFLP and sequence analysis of rRNA-ITS region had been carried out earlier in mushroom somatic hybrids (Mallick and Sikdar 2016). In the natural hybrid of Flammulina fungi, gene recombination or gene conversion in the rRNA-ITS region was reported by Hughes and Petersen (2001). In the present work, the nature of polymorphism in the rRNA-ITS region of pfls somatic hybrids was identified and it might have happened due to the occurrence of non-functional genes present in the progeny population. However, other possibilities are the divergence of rRNA-ITS region which may contain pseudogene in the hybrid genome or the existence of inter-genetic recombination between different repeat types with complex DNA organization (Ko and Jung 2002).

Polymorphism in the ITS1-5.8S-ITS2 region was expressed in both the pfls hybrid and parents. The most conserved region 5.8S rRNA also showed sequence dissimilarity. Parent L. squarrosulus showed maximum sequence similarity with the pfls hybrids than P. florida parent. In spite of sequence polymorphism, sequence similarity in ITS region was also observed in between hybrids and between hybrids and parents. This result largely collaborates with earlier observations that fungal communities show structural similarity in the ITS1 and ITS2 regions (Jumpponen 2004; Arfi et al. 2011; Mello et al. 2011). Huge polymorphism in ITS2 region compared to ITS1 may be explained by the fact that after hybridization the hybrids retained or inherited the sequence of one of the two parents without or with little recombination in the ITS1 site. Whereas in the ITS2 region of the pfls somatic hybrids, the nucleotide sequence was combined to different degrees from the two parental strains. The advantage of the ITS locus in this study of hybrid characterization is its occurrence in the genome as tandem repeat arrays, most likely on several chromosomes, and is sensitive to concerted evolution over time, which bears the signature of both the parents that will emerge either through mitotic crossover or through meiotic recombination (Bertier et al. 2013).

From the present study, it has been proved that the pfls somatic hybrids are not genetically identical, though they show morphological similarity between each other. The results indicate that the pfls hybrids were truly formed by random recombination of parental genome and they individually showed similarity either with P. florida or with L. squarrosulus. Somatic hybridization through protoplast fusion generates recombinant type of genome in hybrids which comes from both the parents. In higher eukaryotes, hybrids can be easily characterized through karyotyping, whereas in fungal system it is very tough due to the lack of sufficient chromosomal information. However, in this situation DNA markers are helpful to study about the genetic makeup, nature of genome recombination, etc., in fungal somatic hybrids. Among all other DNA markers, only ISSR and rRNA-ITS are used in this study. ISSR is widely used repeated sequences of few nucleotide bases, which can work over the whole genome during polymerase chain reaction, and thus produces maximum number of amplicon (see "Introduction"). The nuclear rRNA-ITS gene is known to be highly conserved and hence can be used to detect the polymorphism in the hybrid genome if present so that it can claim in strong support to hybridity. Use of rRNA-ITS genes as DNA marker in plant or animal system is common, but characterization of fungal somatic hybrid with this marker was first established in our laboratory, where we successfully showed its application in this field (Mallick and Sikdar 2016). So, we can conclude that these DNA markers are very useful tools for genetic analysis of somatic hybrids in fungal system.

Acknowledgements

We are thankful to the Director of Bose Institute, Kolkata for providing the fellowship and research facility to the first and second authors.

Compliance with ethical standards

Conflict of interest

The authors have no conflict of interest.

Contributor Information

Pijush Mallick, Phone: +52-9982995054, Email: biology.pijush@gmail.com.

Shruti Chattaraj, Email: shrutichattaraj@gmail.com.

Samir Ranjan Sikdar, Phone: +91-33-25693220, Email: samir@jcbose.ac.in.

References

  1. Alvarez I, Wendel JF. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 2003;29:417–434. doi: 10.1016/S1055-7903(03)00208-2. [DOI] [PubMed] [Google Scholar]
  2. Arfi Y, Buée M, Marchand C, Record E. Multiple markers pyrosequencing reveals highly diverse and host-specific fungal communities on the mangrove trees Avicennia marina and Rhizophora stylosa. FEMS Microbiol Ecol. 2011;79:433–444. doi: 10.1111/j.1574-6941.2011.01236.x. [DOI] [PubMed] [Google Scholar]
  3. Aylward J, Dreyer LL, Steenkamp ET, Wingfield MJ, Roets F. Development of polymorphic microsatellite markers for the genetic characterisation of Knoxdaviesia proteae (Ascomycota: Microascales) using ISSR-PCR and pyrosequencing. Mycol Prog. 2014;13:439–444. doi: 10.1007/s11557-013-0951-1. [DOI] [Google Scholar]
  4. Babiychuk E, Kushnir S, Gleba YY. Spontaneous extensive chromosome elimination in somatic hybrids between somatically congruent species Nicotiana tabacum L. and Atropa belladonna L. Theor Appl Genet. 1992;84:87–91. doi: 10.1007/BF00223985. [DOI] [PubMed] [Google Scholar]
  5. Baura G, Szaro TM, Bruns TD. Gastrosuillus laricinus is a recent derivative of Suillus grevillei: molecular evidence. Mycologia. 1992;84:592–597. doi: 10.2307/3760328. [DOI] [Google Scholar]
  6. Bertier L, Leus L, D’hondt L, de Cock AWAM, Höfte M. Host adaptation and speciation through hybridization and polyploidy in Phytophthora. PLoS One. 2013;8:e85385. doi: 10.1371/journal.pone.0085385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bornet B, Branchard M. Nonanchored inter simple sequence repeat (ISSR) markers: reproducible and specific tools for genome fingerprinting. Plant Mol Bio Rep. 2001;19:209–215. doi: 10.1007/BF02772892. [DOI] [Google Scholar]
  8. Bruns TD, White TJ, Taylor JW. Fungal molecular systematics. Ann Rev Ecol Evol Syst. 1991;22:525–564. doi: 10.1146/annurev.es.22.110191.002521. [DOI] [Google Scholar]
  9. Calvo-Bado L, Noble R, Challen M, Dobrovin-Pennington A, Elliott T. Sexuality and genetic identity in the Agaricus section Arvenses. Appl Environ Microbiol. 2000;66:728–734. doi: 10.1128/AEM.66.2.728-734.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chakraborty U, Sikdar SR. Production and characterization of somatic hybrids raised through protoplast fusion between edible mushroom strains Volvariella volvacea and Pleurotus florida. World J Microbiol Biotechnol. 2008;24:1481–1492. doi: 10.1007/s11274-007-9630-1. [DOI] [Google Scholar]
  11. Chen YQ, Wang N, Qu LQ, Li TH, Zhang WM. Determination of the anamorph of Cordyceps sinensis inferred from the analysis of the ribosomal DNA internal transcribed spacers and 5.8S rDNA. Biochem Syst Ecol. 2001;29:597–607. doi: 10.1016/S0305-1978(00)00100-9. [DOI] [PubMed] [Google Scholar]
  12. Cullings KW, Szaro TM, Bruns TD. Evolution of extreme specialization within a lineage of ectomycorrhizal epiparasites. Nature. 1996;379:63–66. doi: 10.1038/379063a0. [DOI] [Google Scholar]
  13. Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation, 2nd version. Plant Mol Bio Rep. 1983;1:19–21. doi: 10.1007/BF02712670. [DOI] [Google Scholar]
  14. Fan L, Liu X, Cao J. Tuber turmericum sp. nov., a Chinese truffle species based on morphological and molecular data. Mycol Prog. 2015;14:111. doi: 10.1007/s11557-015-1134-z. [DOI] [Google Scholar]
  15. Hillis DM, Dixon MT. Ribosomal DNA: molecular evolution and phylogenetic inference. Quart Rev Biol. 1991;66:411–453. doi: 10.1086/417338. [DOI] [PubMed] [Google Scholar]
  16. Hughes KW, Petersen RH. Apparent recombination or gene conversion in the ribosomal ITS region of a Flammulina (Fungi, Agaricales) hybrid. Mol Biol Evol. 2001;18:94–96. doi: 10.1093/oxfordjournals.molbev.a003724. [DOI] [PubMed] [Google Scholar]
  17. Jaccard P. Etude comperative de la distribution florale dans une portion des Alpes et des Jura. Bulletin de La Socit Vaudoise Des Sciences Naturelles. 1901;37:547–579. [Google Scholar]
  18. Jorgenson RD, Cluster PD. Modes and tempos in the evolution of nuclear rDNA new characters for evolutionary studies and new markers for genetic and population studies. Ann Mo Bot Gard. 1988;7:1238–1247. doi: 10.2307/2399282. [DOI] [Google Scholar]
  19. Jumpponen A. Soil fungal communities underneath willow canopies on a primary successional glacier forefront: rDNA sequence results can be affected by primer selection and chimeric data. Microbial Ecol. 2004;53:233–246. doi: 10.1007/s00248-004-0006-x. [DOI] [PubMed] [Google Scholar]
  20. Karsch-Mizrachi I, Nakamura Y, Cochrane G. The international nucleotide database collaboration. Nucleic Acids Res. 2012;40:33–37. doi: 10.1093/nar/gkr1006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ko KS, Jung HS. Three non-orthologous ITS1 types are present in a polypore fungus Trichaptum abietinum. Mol Phylogenet Evol. 2002;23:112–122. doi: 10.1016/S1055-7903(02)00009-X. [DOI] [PubMed] [Google Scholar]
  22. Kwan HS, Pang KM, Chiu SW, Cheng SC. Nucleotide sequence of the 5.8S ribosomal RNA gene of Lentinula edodes. Nucleic Acids Res. 1991;20:610. doi: 10.1093/nar/20.3.610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lelivelt CLC, Leunissen EHM, Frederiks HJ, Helsper JPFG, Krens FA. Transfer of resistance to the beet cyst nematode (Heterodera schachtii Schm.) from Sinapsis alba L. (white mustard) to the Brassica napus L. gene pool by means of sexual and somatic hybridization. Theor Appl Genet. 1993;85:688–696. doi: 10.1007/BF00225006. [DOI] [PubMed] [Google Scholar]
  24. Liang ZR, Chang ST. A study on intergeneric hybridization between Pleurotus sajor-caju and Schizophyllum commune by protoplast fusion. Mushroom Sci. 1989;12:125–137. [Google Scholar]
  25. Mallick P, Sikdar SR. Production and molecular characterization of somatic hybrids between Pleurotus florida and Lentinula edodes. World J Microbiol Biotechnol. 2014;30:2283–2293. doi: 10.1007/s11274-014-1652-x. [DOI] [PubMed] [Google Scholar]
  26. Mallick P, Sikdar SR. Fruit body production and characterization of hybrid edible mushroom strains developed by protoplast fusion between Pleurotus florida and Lentinus squarrosulus. Int J Pharma Bio Sci. 2015;6:301–314. [Google Scholar]
  27. Mallick P, Sikdar SR. Restriction fragment length polymorphism and sequence analysis of rRNA-IT-S region of somatic hybrids produced between Pleurotus florida and Lentinula edodes. Ann Microbiol. 2016;66(1):389–395. doi: 10.1007/s13213-015-1121-2. [DOI] [Google Scholar]
  28. Manian S, Sreenivasaprasad S, Bending GD, Mills PR. Genetic diversity and interrelationships among common European Suillus species based on ribosomal DNA sequences. FEMS Microbiol Lett. 2001;204:117–121. doi: 10.1111/j.1574-6968.2001.tb10873.x. [DOI] [PubMed] [Google Scholar]
  29. Mello A, Napoli C, Murat C, Morin E, Marceddu G, Bonfante P. ITS-1 versus ITS-2 pyrosequencing: a comparison of fungal populations in truffle grounds. Mycologia. 2011;103:1184–1193. doi: 10.3852/11-027. [DOI] [PubMed] [Google Scholar]
  30. Mignouna HD, Mank PA, Ellis THN, van den Bosch N, Asiedu R, Ng SYC, Peleman J. A genetic linkage map of Guinea yam (Dioscorea rotundata Poir) based on AFLP markers. Theor Appl Genet. 2002;105:716–725. doi: 10.1007/s00122-002-0911-7. [DOI] [PubMed] [Google Scholar]
  31. Mitchell TG, Bresinsky A. Phylogenetic relationships of Agaricus species based on ITS-2 and 28S ribosomal DNA sequences. Mycologia. 1999;91:811–819. doi: 10.2307/3761534. [DOI] [Google Scholar]
  32. Nagaoka T, Ogihara Y. Applicability of inter simple sequence repeat polymorphism in wheat for use as DNA markers in comparison to RFLP and RAPD markers. Theor Appl Genet. 1997;94:597–602. doi: 10.1007/s001220050456. [DOI] [Google Scholar]
  33. Naik A, Prajapat P, Krishnamurthy R, Pathak JM. Assessment of genetic diversity in Costus pictus accessions based on RAPD and ISSR markers. 3. Biotech. 2017;7:70. doi: 10.1007/s13205-017-0667-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ohmasa M. Intraspecific protoplast fusion of Pleurotus ostreatus using auxotrophic mutants. Jpn J Breed. 1986;36:429–433. doi: 10.1270/jsbbs1951.36.429. [DOI] [Google Scholar]
  35. Park HG, Ko HG, Kim SH, Park WM. Molecular identification of Asian isolates of medicinal mushroom Hericium erinaceum by phylogenetic analysis of nuclear ITS rDNA. J Microbiol Biotechnol. 2004;14:816–821. [Google Scholar]
  36. Primrose SB. Modern biotechnology. Oxford: Blackwell Scientific Publications; 1987. [Google Scholar]
  37. Rokka VM, Lapitan NLV, Knudson DL, Pehu E. Fluorescence in situ hybridization of potato somatohaploids and their somatic hybrid donors using two Solanum brevidens specific sequences. Agri Food Sci. 1998;7:1–4. [Google Scholar]
  38. Saito W, Ohgawara T, Shimizu J, Kobayashi S. Somatic hybridization in Citrus using embryogenic cybrid callus. Plant Sci. 1994;99:89–95. doi: 10.1016/0168-9452(94)90123-6. [DOI] [Google Scholar]
  39. Sakata Y, Monma S. Genetic instability of a progeny from a somatic hybrid between tomato (Lycopersicon esculentum) and L. peruvianum. Plant Sci. 1993;90:225–232. doi: 10.1016/0168-9452(93)90244-T. [DOI] [Google Scholar]
  40. Shao Y, Xu L, Chen F. Genetic diversity analysis of Monascus strains using SRAP and ISSR markers. Mycoscience. 2011;52:224–233. doi: 10.1007/S10267-010-0087-Y. [DOI] [Google Scholar]
  41. Shen J, Ding X, Liu D, Ding G, He J, Li X, Tang F, Chu B. Inter simple sequence repeats (ISSR) molecular fingerprinting markers for authenticating populations of Dendrobium officinale Kimura et Migo. Bio Pharma Bull. 2006;29:420–422. doi: 10.1248/bpb.29.420. [DOI] [PubMed] [Google Scholar]
  42. Staniaszek M, Marczewski W, Szudyga K, Maszkiewicz J, Czaplicki A, Qian G. Genetic relationship between Polish and Chinese strains of the mushroom Agaricus bisporus (Lange) Sing, determined by the RAPD method. J Appl Genet. 2002;43(1):43–47. [PubMed] [Google Scholar]
  43. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22(22):4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tuchwell DS, Nicholson MJ, Mc-Sweeney CS, The-odorou MK, Brookman JL. The rapid assignment of ruminal fungi to presumptive genera using ITS1 and ITS2 RNA secondary structures to produce group specific fingerprints. Microbiology. 2005;151:1557–1567. doi: 10.1099/mic.0.27689-0. [DOI] [PubMed] [Google Scholar]
  45. Vogler DR, Bruns TD. Phylogenetic relationships among the pine stem rust fungi (Cronartium and Peridermium spp.) Mycologia. 1998;90:244–257. doi: 10.2307/3761300. [DOI] [Google Scholar]
  46. Wang QD, Zhang T, Wang JB. Phylogenetic relationships and hybrid origin of Potamogeton species (Potamogetonaceae) distributed in China: insights from the nuclear ribosomal internal transcribed spacer sequence (ITS) Plant Syst Evol. 2007;267:65–78. doi: 10.1007/s00606-006-0499-5. [DOI] [Google Scholar]
  47. Weir BS. Genetic data analysis II: methods for discrete population genetic data. Sunderland: Sinauer Associates Inc; 1996. [Google Scholar]
  48. White TJ, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungi ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR protocols: A guide to methods and applications. San Diego: Academic Press; 1990. pp. 315–322. [Google Scholar]
  49. Witte V, Grossmann B, Emeis CC. Molecular probes for the detection of Kluyveromyces marxianus chromosomal DNA in electrophoretic karyotypes of intergeneric protoplast fusion products. Arch Microbiol. 1989;152:441–446. doi: 10.1007/BF00446926. [DOI] [PubMed] [Google Scholar]
  50. Yüzbaşıoğlu E, Halıcı MG, Karabacak M, Aksoy A. RAPD and ISSR markers indicate high genetic variation within Lobathallia radiosa in Turkey. Mycol Prog. 2011;10:219–228. doi: 10.1007/s11557-010-0691-4. [DOI] [Google Scholar]
  51. Zanke C, Borisjuk N, Ruoss B, Schilde-Rentschlet L, Ninnemann H, Hemleben V. A specific oligonucleotide of the 5S rDNA spacer and species-specific elements identify symmetric somatic hybrids between Solanum tuberosum and S. pinnatisectum. Theor Appl Genet. 1995;9:720–726. doi: 10.1007/BF00222139. [DOI] [PubMed] [Google Scholar]
  52. Zhao RL, Hyde KD, Desjardin DE, Raspé O, Soytong K, Guinberteau J, Karunarathna SC, Callac P. Agaricus flocculosipes sp. nov., a new potentially cultivatable species from the palaeotropics. Mycoscience. 2012;53:300–311. doi: 10.1007/S10267-011-0169-5. [DOI] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES