Abstract
We characterised 227 Staphylococcus aureus isolates from retail food and food handlers’ gloves samples obtained through food surveillance and risk assessment studies between 2011 and 2014. Of 227 isolates, five (2.2%) were methicillin-resistant and belonged to sequence types ST80 (n = 3) and ST6 (n = 2). All five isolates belonged to SCCmec type IV, were Panton-Valentine leukocidin (pvl)-negative and staphylococcal enterotoxin genes-positive. Resistance to azithromycin was found in ST80 isolates, in addition to resistance to beta-lactams. Our finding of two clinically relevant methicillin-resistant S. aureus (MRSA) strains (ST80 and ST6) in ready-to-eat food and food contact surfaces at retail in Singapore suggests food and food contact surfaces as potential environmental sources of MRSA in the community.
Keywords: Methicillin-resistant Staphylococcus aureus (MRSA), Retail food, Food contact surface, Antibiotic resistance, Enterotoxin genes, Panton-valentine leukocidin (pvl) gene
Dear Editor,
Methicillin-resistant Staphylococcus aureus (MRSA) has been recognised as an important nosocomial pathogen and has reportedly been associated with foodborne illnesses [1–3]. MRSA has also recently been listed as one of the high-priority antibiotic-resistant pathogens as ranked by the World Health Organisation. In Singapore, surveillance and control programmes of MRSA have been established in various hospitals [4, 5]. However, there is a substantial lack of information on the prevalence of MRSA in food, including at retail. Such information would be useful to better understand the risk of exposure to MRSA through food, particularly ready-to-eat food, in contrast with the more typical known transmission route via contact. Our findings provide preliminary insights on the extent of the spread of MRSA in ready-to-eat food in Singapore.
In this study, we characterised 227 coagulase-positive Staphylococcus aureus strains isolated from retail food and swabs taken from food handlers’ gloves. These isolates and samples were obtained from food surveillance and risk assessment studies conducted between 2011 and 2014. The isolates were confirmed to be S. aureus using coagulase rabbit plasma (Remel), and conventional PCR for the detection of femA gene with modified primers (F- GATCATTTATGGAAGATACGTCAG, R- GATAAAGAAGAAACCAGCAGAGATAG) and PCR conditions from previous studies [6, 7]. To understand the occurrence of methicillin resistance among these S. aureus isolates, we used mecA-PCR for the detection of MRSA, followed by PBP2 latex agglutination test (Oxoid) and disc diffusion with Cefoxitin 30 μg for confirmation. MRSA strains were further characterised by Multi-Locus Sequence Typing (MLST), staphylococcal Protein A (spa) typing, and staphylococcal cassette chromosome (SCCmec) typing. Strains were also analysed for the presence of virulence genes: staphylococcal enterotoxin (sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, seo and sep), Panton-Valentine leukocidin (pvl), exfoliative toxin (eta, etb and etd), and toxic shock syndrome toxin (tsst-1) genes [7, 8]. Antibiotic susceptibility testing was performed and interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guideline [9].
Of the 227 S. aureus isolates, five (2.2%) from two food stalls were methicillin-resistant (Table 1) and belonged to Sequence Types (ST) 80 (spa type t1198) (isolated from sliced onion, prawn fritters, fried egg) and ST6 (spa type t304) (from swabs of food handlers’ gloves) [7]. All five isolates belonged to SCCmec type IV, and were pvl-negative. Unlike SCCmec types I-III strains which are often associated with nosocomial infections, strains belonging to SCCmec type IV are capable of colonising healthy individuals and may be community-associated. Some SCCmec type IV strains may be associated with livestock, suggesting a possible transmission between human and food-producing animals [10–12]. In Singapore, community-associated (CA) MRSA strains previously reported were isolated from clinical samples and belonged mainly to ST30, ST59 and ST772 [13]. To our knowledge, no ST6 strain has been reported in Singapore, whereas a ST80 CA-MRSA strain was previously reported in a local hospital in 2003, from a patient with a chin abscess [8]. S. aureus ST80, belonging to Clonal Complex 80 (CC80), was first reported in Denmark in 1993 and has been recognised as a major clone of CA-MRSA, widely spread across Europe [14–16]. Most ST80 strains reported elsewhere belong to SCCmec type IV, are pvl-positive, and are usually associated with severe skin/soft tissue infections and necrotising pneumonia [17]. Nonetheless, pvl-negative ST80 strains have also been reported in clinical cases overseas [18, 19]. ST6 MRSA is a double-locus variant of CC5, which is one of the five CCs from which major epidemic MRSA isolates are believed to have emerged [20]. ST6 MRSA was previously reported in human cases and carriers in Australia, Oman and United Arab Emirates (UAE) [16, 21, 22]. In particular, ST6 SCCmec type IV (t304) pvl-negative MRSA, a strain susceptible to non-beta-lactams, was previously isolated from patients overseas, suggesting that the ST6 strain isolated in our study may be capable of causing human infection [23]. In addition, CC6-ST6-t304 strains have previously been isolated from human (MSSA and MRSA), feral cat (MRSA) and camel (MSSA) suggesting that the strain may be transmissible across different host species [19, 24–26].
Table 1.
Phenotypic and genotypic characteristics of methicillin resistant Staphylococcus aureus (MRSA) isolated from retail food and contact surfaces in Singapore. MLST multi locus sequence typing, spa staphylococcal protein A, pvl panton-valentine leukocidin, se staphylococcal enterotoxin, et exfoliative toxin, tsst-1 toxic shock syndrome toxin-1, AMC amoxycillin-clavulanic acid, AMP ampicillin, FOX cefoxitin, CRO Ceftriaxone, P penicillin, AK amikacin, AZM azithromycin, CIP ciprofloxacin, C chloramphenicol, CN gentamicin, NOR norfloxacin, TE tetracycline, SXT trimethoprim-sulphamethoxazole
Food stall | Year of isolation | Source | Molecular typing | pvl gene | Staphylocooccal enterotoxin genes | Exfoliative toxin genes | tsst -1 | Beta lactams | Non beta lactams | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
MLST | spa | SCCmec | sea | seb | sec | sed | see | seg | seh | sei | sej | sek | sel | sem | seo | sep | eta | etb | etd | AMC | AMP | FOX | CRO | P | AK | AZM | CIP | C | CN | NOR | TE | SXT | |||||
A | 2011 | Sliced Onion | ST80 | t1198 | IV | - | - | + | - | - | - | - | - | - | - | + | - | - | - | - | - | - | + | - | R | R | R | R | R | S | R | S | S | S | S | S | S |
A | 2011 | Prawn fritters | ST80 | t1198 | IV | - | - | + | - | - | - | - | - | - | - | + | - | - | - | - | - | - | + | - | R | R | R | R | R | S | R | S | S | S | S | S | S |
A | 2011 | Fried egg | ST80 | t1198 | IV | - | - | + | - | - | - | - | - | - | - | + | - | - | - | - | - | - | + | - | R | R | R | R | R | S | R | S | S | S | S | S | S |
B | 2013 | Gloves (inner surface) | ST6 | t304 | IV | - | + | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | R | R | R | R | R | S | S | S | S | S | S | S | S |
B | 2013 | Glove (outer surface) | ST6 | t304 | IV | - | + | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | R | R | R | R | R | S | S | S | S | S | S | S | S |
In this study, we detected enterotoxin genes seb, sek, and exfoliative toxin gene etd in ST80 strains; and enterotoxin gene sea in ST6 strains [7]. No other toxin genes were detected. Enterotoxins sea and seb are known to cause approximately 90% of staphylococcal food poisoning worldwide [27]. Enterotoxin sek is considered a staphylococcal enterotoxin-like protein, though its ability to cause food poisoning has yet to be demonstrated [28]. etd is an exfoliative toxin serotype known to be associated with mild forms of cutaneous infections such as abscesses and furuncles [29]. The presence of enterotoxin genes (sea and seb) in these MRSA isolates suggests the isolates’ potential to produce toxins, and cause staphylococcal food poisoning, if allowed to grow in sufficient numbers in food. Antimicrobial susceptibility results showed that all 5 MRSA isolates were phenotypically susceptible to amikacin, ciprofloxacin, chloramphenicol, gentamicin, norfloxacin, tetracycline, and trimethoprim/sulfamethoxazole. Susceptibility to at least 3 non-beta-lactams in MRSA is used as a proxy to define community-associated strains [30]. We found ST80 isolates resistant to azithromycin in addition to the beta-lactams tested (Table 1). An emerging trend of macrolide resistance has been reported in CA-MRSA from the human and livestock sectors [11, 31]. MRSA with resistance to additional antibiotic classes is a concern, and may reflect the increasing use of these antibiotics in the local clinical practice, which warrants further investigation.
In conclusion, we report two clinically relevant MRSA strains (ST80 and ST6) in ready-to-eat food and food contact surfaces at retail. Humans (food handlers), rather than animals, were likely the sources of contamination. Our limited findings suggest ready-to-eat food and food contact surfaces as potential environmental sources for colonisation and spread of MRSA in the community. To date, little is known about the transmission of MRSA infections through food and food contact surfaces, however their possible roles in the dissemination of specific MRSA lineages cannot be ruled out. The data warrant a more comprehensive and integrated (farm-to-hospital approach) surveillance of MRSA in Singapore and elsewhere.
Acknowledgements
Not applicable.
Funding
This study was funded by the National Environment Agency, Singapore.
Availability of data and materials
Please contact corresponding author for data requests.
Abbreviations
- AK
Amikacin
- AMC
Amoxycillin-clavulanic acid
- AMP
Ampicillin
- AZM
Azithromycin
- C
Chloramphenicol
- CA-MRSA
Community-associated methicillin-resistant Staphylococcus aureus
- CIP
Ciprofloxacin
- CN
Gentamicin
- CRO
Ceftriaxone
- Et
Exfoliative toxin
- FOX
Cefoxitin
- mecA
Gene encoding methicillin-resistant-S. aureus-specific-penicillin-binding protein
- MLST
Multi-Locus Sequence Typing
- MRSA
Methicillin-resistant Staphylococcus aureus
- NOR
Norfloxacin
- P
Penicillin
- PBP2
Penicillin binding protein 2
- Pvl
Panton-valentine leukocidin
- SCCmec
Staphylococcal cassette chromosome
- Se
Staphylococcal enterotoxin
- Spa
Staphylococcal Protein A
- ST
Sequence type
- SXT
Trimethoprim-Sulphamethoxazole
- TE
Tetracycline
- Tsst
Toxic shock syndrome toxin
Authors’ contributions
KTA, LYH, HCH and RAG were involved in the conception and design of the study. KTA, MLC and THK performed the identification and characterisation of isolates. KTA, LYH, THK, HCH, RAG and LCN were involved in the analysis and interpretation of the data. All authors read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Kyaw Thu Aung, Email: AUNG_Kyaw_Thu@nea.gov.sg.
Li Yang Hsu, Email: hsuliyang@gmail.com.
Tse Hsien Koh, Email: koh.tse.hsien@singhealth.com.sg.
Hapuarachchige Chanditha Hapuarachchi, Email: Chanditha_HAPUARACHCHI@nea.gov.sg.
Man Ling Chau, Email: CHAU_Man_Ling@nea.gov.sg.
Ramona Alikiiteaga Gutiérrez, Phone: +65-6571-0476, Email: Ramona_GUTIERREZ@nea.gov.sg.
Lee Ching Ng, Email: NG_Lee_Ching@nea.gov.sg.
References
- 1.Alexandra F, Britta K, Gladys K, Beatriz G-R, Katja A, Jens-Andre H, Annemarie K, Juliane B, Bernd A, Bernd-Alois T. Methicillin susceptible and resistant Staphylococcus aureus from farm to fork impact on food safety. Tehnologija mesa. 2011;1:60–65. [Google Scholar]
- 2.Jones TF, Kellum ME, Porter SS, Bell M, Schaffner W. An outbreak of community-acquired foodborne illness caused by methicillin-resistant Staphylococcus aureus. Emerg Infect Dis. 2002;8(1):82–84. doi: 10.3201/eid0801.010174. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kluytmans J, van Leeuwen W, Goessens W, Hollis R, Messer S, Herwaldt L, Bruining H, Heck M, Rost J, Van Leeuwen N. Food-initiated outbreak of methicillin-resistant Staphylococcus aureus analysed by pheno- and genotyping. J Clin Microbiol. 1995;33(5):1121–1128. doi: 10.1128/jcm.33.5.1121-1128.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hsu LY, Koh TH, Tan TY, Ito T, Ma XX, Lin RT, et al. Emergence of community-associated methicillin-resistant Staphylococcus aureus in Singapore: a further six cases. Singap Med J. 2006;47(1):20–26. [PubMed] [Google Scholar]
- 5.Tambyah PA, Kumarasinghe G. Methicillin-resistant Staphylococcus aureus control at the National University Hospital, Singapore: a historical perspective. Ann Acad Med Singap. 2008;37(10):855–860. [PubMed] [Google Scholar]
- 6.Veras JF, Carmo LSD, Tong LC, Shupp JW, Cummings C, Santos DAD, Cerqueira MMOP, Cantini A, Nicoli JR, Jett M. A study of the enterotoxigenicity of coagulase-negative and coagulase-positive staphylococcal isolates from food poisoning outbreaks in Minas Gerais, Brazil. Int J Infect Dis. 2008;12:410–415. doi: 10.1016/j.ijid.2007.09.018. [DOI] [PubMed] [Google Scholar]
- 7.Aung KT, Lo JACY, Chau ML, Kang JSL, Yap HM, Gutiérrez RA, Yuk H-G, Ng LC. Microbiological safety assessment and risk mitigation of Indian rojak (deep fried ready-to-eat food) in Singapore. Southeast Asian J Trop Med Public Health. 2016;47(6):1231–1245. [PubMed] [Google Scholar]
- 8.Hsu LY, Tristan A, Koh TH, Bes M, Etienne J, Kurup A, Tan TT, Tan BH. Community-associated methicillin-resistant Staphylococcus aureus. Singapore Emerg Infect Dis. 2005;11(2):341–342. doi: 10.3201/eid1102.040782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: seventeenth informational supplement. Clinical and Laboratory Standards Institute CLSI document. (2007). M100-MS17 [ISBN 1-56238-625-5].
- 10.Nemati M, Hermans K, Lipinska U, Denis O, Deplano A, Struelens M, Devriese LA, Pasmans F, Haesebrouck F. Antimicrobial resistance of old and recent Staphylococcus aureus isolates from poultry: first detection of livestock-associated methicillin resistant strain ST398. Antimicrob Agents Chemother. 2008;52(10):3817–3819. doi: 10.1128/AAC.00613-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Cavaco LM, Miragaia M, Rolo J, Conceicao T, Hasman H, Aarestrup FM, De Lencastre H. Comparison between livestock and community associated MRSA in Europe. Poster session presented at 3rd ASM conference on antimicrobial resistance in Zoonotic bacteria and Foodborne pathogens in animals, humans and the environment, Aix-en-Provence. France.
- 12.International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements (IWG-SCC) Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrob Agents Chemother. 2009;53(12):4961–4967. doi: 10.1128/AAC.00579-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Wijaya L, Hsu LY. Community-associated methicillin-resistant Staphylococcus aureus skin and soft tissue infections. Proc Singapore Healthc. 2010;19(3):212–219. doi: 10.1177/201010581001900307. [DOI] [Google Scholar]
- 14.Faria NA, Oliveira DC, Westh H, Monnet DL, Larsen AR, Skov R, De Lencastre H. Epidemiology of emerging methicillin-resistant Staphylococcus aureus (MRSA) in Denmark: a nationalwide study in a country with low prevalence of MRSA infection. J Clin Microbiol. 2005;43:1836–1842. doi: 10.1128/JCM.43.4.1836-1842.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Stam-Bolink EM, Mithoe D, Baas WH, Arends JP, Moller AV. Spread of a methicillin-resistant Staphylococcus aureus ST80 strain in the community of the northern-Netherlands. Eur J Clin Microbiol Infect Dis. 2007;26:723–727. doi: 10.1007/s10096-007-0352-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Deurenberg RH, Stobberingh EE. The evolution of Staphylococcus aureus. Infect Genet Evol. 2008;8:747–763. doi: 10.1016/j.meegid.2008.07.007. [DOI] [PubMed] [Google Scholar]
- 17.Budimir A, Deurenberg RH, Bosnjak Z, Stobberingh EE, Cetkovic H, Kalenic S. A variant of the southern German clone of methicillin-resistant Staphylococcus aureus is predominant in Croatia. Clin Microbiol Infect. 2010;16(8):1077–1083. doi: 10.1111/j.1469-0691.2009.03042.x. [DOI] [PubMed] [Google Scholar]
- 18.Djoudi F, Bonura C, Benallaoua S, Touati A, Touati D, Aleo A, Cala C, Fasciana T, Mammina C. Panton-valentine leukocidin positive sequence type 80 methicillin-resistant Staphylococcus aureus carrying a staphylococcal cassette chromosome mec type IVc is dominant in neonates and children in an Algiers hospital. New Microbiol. 2013;36:49–56. [PubMed] [Google Scholar]
- 19.Monecke S, Coombs G, Shore AC, Coleman DC, Akpaka P, Borg M, Chow H, Ip M, Jatzwauk L, et al. A field guide to pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS One. 2011;6(4):e17936. doi: 10.1371/journal.pone.0017936. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Enright MC, Robinson DA, Randle G, Feil EJ, Grundmann H, Spratt BG. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA) Proc Natll Acad Sci USA. 2002;99(11):7687–7692. doi: 10.1073/pnas.122108599. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Monecke S, Skakni L, Hasan R, Ruppelt A, Ghazal SS, Hakawi A, Slickers P, Ehricht R. Characterisation of MRSA strains isolated from patients in a hospital in Riyadh, Kingdom of Saudi Arabia. BMC Microbiol. 2012;12:146–154. doi: 10.1186/1471-2180-12-146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Weber S, Ehricht R, Slickers P, Abdel-Wareth L, Donnelly G, Pitout M, Stefan M. Genetic fingerprinting of MRSA from Abu Dhabi. Vienna. Eur J Clin Microbiol Infect Dis. 2010;2010
- 23.Udo EE, Al-Lawati BA-H, Al-Muharmi Z, Thukral SS. Genotyping of methicillin-resistant Staphylococcus aureus in the Sultan Qaboos University Hospital, Oman reveals the dominance of Panton-valentine leucocidin-negative ST6-IV/t304 clone. New Microbes New Infect. 2014;2(4):100–105. doi: 10.1002/nmi2.47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Sonnevend Á, Blair I, Alkaabi M, Jumaa P, Al Haj M, Ghazawi A, Akawi N, Jouhar FS, Hamadeh MB, et al. Change in methicillin resistant Staphylococcus aureus clones at a tertiary care hospital in the United Arab Emirates over a 5-year period. J Clin Pathol. 2012;65:178–182. doi: 10.1136/jclinpath-2011-200436. [DOI] [PubMed] [Google Scholar]
- 25.Harastani HH, Tokajian ST. Community-associated methicillin-resistant Staphylococcus aureus clonal complex 80 type IV (CC80-MRSA-IV) isolated from the Middle East: a heterogeneous expanding clonal lineage. PLoS One. 2014;9:1–11. doi: 10.1371/journal.pone.0103715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Bierowiec K, Ploneczka-Janeczko K, Rypula K. Is the colonisation of Staphylococcus aureus in pets associated with their close contact with owners? PLoS One. 2016;11(5):e0156052. doi: 10.1371/journal.pone.0156052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Pinchuk IV, Beswick EJ, Reyes VE. Staphylococcal enterotoxins. Toxins (Basel). 2010;2(8):2177–2197. doi: 10.3390/toxins2082177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Argudin MA, Mendoza MC, Rodicio MR. Food poisoning and Staphylococcus aureus enterotoxins. Toxins (Basel) 2010;2(7):1751–1773. doi: 10.3390/toxins2071751. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yamasaki O, Tristan A, Yamaguchi T, Sugai M, Lina G, Bes M, Vandenesch F, Etienne J. Distribution of the exfoliative toxin D gene in clinical Staphylococcus aureus isolates in France. Clin Microbiol Infect. 2006;12(6):585–588. doi: 10.1111/j.1469-0691.2006.01410.x. [DOI] [PubMed] [Google Scholar]
- 30.David MZ, Daum RS. Community-associated methicillin-resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev. 2010;23(3):616–687. doi: 10.1128/CMR.00081-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Como-Sabetti K, Harriman KH, Buck JM, Glennen A, Boxud DJ, Lynfield R. Community-associated methicillin-resistant Staphylococcus aureus: trends in case and isolate characteristics from six years of prospective surveillance. Public Health Rep. 2009;124(3):427–435. doi: 10.1177/003335490912400312. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Please contact corresponding author for data requests.