ANTHROPOLOGY. For the article “A highly variable segment of human subterminal 16p reveals a history of population growth for modern humans outside Africa” by Santos Alonso and John A. L. Armour, which appeared in number 3, January 30, 2001, of Proc. Natl. Acad. Sci. USA (98, 864–869; First Published December 19, 2000; 10.1073/pnas.011244998), the authors note the following corrections. Table 1 on page 865 was misaligned; therefore, a corrected table is printed below. In addition, the circle representing lineage e in Fig. 1b should be split into two sections to indicate equal representation of this haplotype in Pygmies and Kenyans.
Table 1.
Polymorphic positions
| Ancestor | ggga+cccgggccgggcccccgacggggtaagctaggggcgt |
|---|---|
| 3P | a......t........t........a..........a..... |
| 1U | .a..........a..a...................a...... |
| 1J | ..c...........aa...................a...... |
| 3B+4J | ..c............a...................a...... |
| 1P | ........ca.t.........a....a....at......... |
| 1P | .............a.a...t...a...........a...... |
| 1J | ...............a.................c.a...... |
| 1U | ...............a...................a..a... |
| 2P | ...............a...................a....c. |
| 1K | ...............a...................a.....c |
| 13B+11J+14U+8K+2P | ...............a...................a...... |
| 1U | ...............a...................a...t.. |
| 1B+2UK | ...............a..................ca...... |
| 1J | ...............a...........t.......a...... |
| 1B+1K | ...............a......c............a...... |
| 1B+2J+4K+4P | ...............a....t..............a...... |
| 1P | ...............a...t...a...........a.a.... |
| 2K | ...............a...t...a...........a...... |
| 1K | ...............a..t................a...... |
| 1P+1K | .......................................... |
| 1U | ..........t....a..................ca...... |
| 1B | .......t.................................. |
| 1P | .....t...........t........a.acg........... |
| 3P | ....−..t................a................. |
| 1P | ....−.gt................a................. |
| 2K | ...g......................a....a.......... |
Dots represent the same state as in the ancestor sequence. + and − in polymorphism number 5 represent presence or absence of a 5-bp motif, respectively. Abbreviations: B, Basques; J, Japanese; K, Kenyans; P, Pygmies; and U, U.K.