Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2017 Sep 14;7:11649. doi: 10.1038/s41598-017-12026-x

Development of chloroplast genome resources for peanut (Arachis hypogaea L.) and other species of Arachis

Dongmei Yin 1,, Yun Wang 1, Xingguo Zhang 1, Xingli Ma 1, Xiaoyan He 1, Jianhang Zhang 1
PMCID: PMC5599657  PMID: 28912544

Absract

Peanut (Arachis hypogaea L.) is an important oilseed and cash crop worldwide. Wild Arachis spp. are potental sources of novel genes for the genetic improvement of cultivated peanut. Understanding the genetic relationships with cultivated peanut is important for the efficient use of wild species in breeding programmes. However, for this genus, only a few genetic resources have been explored so far. In this study, new chloroplast genomic resources have been developed for the genus Arachis based on whole chloroplast genomes from seven species that were sequenced using next-generation sequencing technologies. The chloroplast genomes ranged in length from 156,275 to 156,395 bp, and their gene contents, gene orders, and GC contents were similar to those for other Fabaceae species. Comparative analyses among the seven chloroplast genomes revealed 643 variable sites that included 212 singletons and 431 parsimony-informative sites. We also identified 101 SSR loci and 85 indel mutation events. Thirty-seven SSR loci were found to be polymorphic by in silico comparative analyses. Eleven highly divergent DNA regions, suitable for phylogenetic and species identification, were detected in the seven chloroplast genomes. A molecular phylogeny based on the complete chloroplast genome sequences provided the best resolution of the seven Arachis species.

Introduction

Arachis hypogaea L., known commonly as the peanut or groundnut, is an herbaceous plant belonging to the botanical family Fabaceae. Peanut has a long and relatively complex history which involves natural evolution and human domestication1. A. hypogaea is an important oilseed and cash crop worldwide, and is mainly cultivated in tropical and subtropical areas as well as in warm parts of temperate regions. China is the largest peanut producer in the world with over 20% of the planting area and more than 40% of the production2. A. hypogaea is an allotetraploid (AABB-type genome; 2n = 4x = 40) with a genome size of about 2.7 Gb that is probably derived from a single recent hybridization event between the two diploid species Arachis ipaensis (BB genome) and Arachis duranensis (AA genome) followed by polyploidization3.

The genus Arachis is native to South America, and the 80 recognized species have been divided taxonomically into nine sections based on their morphology, geographical distribution, and cross compatibility relationships4. Wild Arachis spp. offer novel genetic resources for commercial peanut improvement. Thus, knowledge of the genetic relationships within the genus and accurate species identification is important for the efficient use of wild species in breeding programmes for broadening the genetic base of A. hypogaea 1. For example, the A. duranensis genome is a major source of candidate genes for fructification and oil biosynthesis1.

Consequently, in the genus Arachis, molecular resources have been developed in recent years for genetic characterization, phylogenetics, and domestication studies. A wide range of molecular markers including isozymes and proteins5,6, RFLPs7, RAPDs8,9, AFLPs10,11 and microsatellites2,1214 have been used in investgations of genetic diversity and population structure in cultivars/breeding lines and for linkage map construction and QTL analysis. The nrITS (nuclear ribosomal internal transcribed spacer) and 5.8 S rDNA sequences have been used for estimating phylogenetic relationships1517. However, at the genus level, only a few chloroplast genomic resources have been explored. In Genbank, there are presently fewer than 100 sequences from the chloroplast DNA of Arachis species.

Chloroplast DNA (cpDNA) is a powerful tool in plant systematics and for the identification of DNA polymorphisms at the inter- and intra-specific levels18. The recent availability of next-generation sequencing technologies has enabled the generation of large amounts of DNA sequence data at relatively low cost, which has in turn allowed the exploration of many plant genomes at the molecular level along with novel approaches for phylogenetic studies and breeding strategies. Due to the slower evolution of chloroplast genomes compared to nuclear genomes, chloroplast sequences provide valuable resources that are commonly used in studies of population genetics, phylogeny, phylogeography, and species identification1921.

Chloroplasts are key photosynthetic organelles in plants that provide energy to green plants. The chloroplast genome is a highly conserved circular DNA molecule ranging in size from 115 to 165 kb. The cpDNA genome usually carries two copies of a large inverted repeat (IR) separated by small (SSC) and large (LSC) single-copy regions. Approximately 130 genes are encoded by the circular chloroplast genome, which exhibits a highly conserved gene order and content, and typically encodes 79 proteins, 30 transfer RNAs, and four ribosomal RNAs22,23. The number of sequenced plant plastid genomes increased rapidly during the last decade due to the implementation of next-generation DNA sequencing technologies24. The number of chloroplast genomes from land plants released by the National Center for Biotechnology Information (NCBI) has risen to 1540 (accessed March 7, 2017). Complete chloroplast genome sequences are widely accepted as informative and valuable data sources for studies in evolutionary biology.

In this study, we sequenced the chloroplast genomes of seven Arachis species using a next-generation sequencing platform. Our aim was to retrieve valuable chloroplast genome information, such as SNPs, microsatellites, indels, and highly variable regions for this genus, by comparing the chloroplast genomes to one another. Our second objective was to assess phylogenetic relationships among the seven Arachis species. Our results will provide abundant molecular tools for further species identification, phylogenetic resolution, and population genetics, and will also assist in breeding in Arachis species.

Results

Chloroplast genome sequencing, assembly, and validation

Using the Illumina HiSeq. 4000 system, total DNA from seven species of Arachis was sequenced to produce 11,732,639–17,815,336 paired-end raw reads (150 bp average read length) per species. All sequences were assembled by first using a de novo assembly and then a reference-based assembly. To validate the accuracy of the assembled chloroplast genome, four junction regions and all gaps between all contigs were validated by Sanger-based sequencing in each of the seven chloroplast genomes. The finished, high quality chloroplast genome sequences thus obtained were used in the following analyses and were submitted to GenBank.

Chloroplast genome structural features and gene content

The assembled genomes of all seven Arachis species are collinear with previously published chloroplast genomes of Arachis 25, because no rearrangements were identified. The Arachis chloroplast genomes ranged from 156,275 to 156,395 base pairs in length, with A. hypogaea being the largest and A. batizocoi the smallest. All of the Arachis chloroplast genomes displayed the typical quadripartite structure of angiosperm cpDNA, which consists of a pair of IR regions (25,813–25,824 bp) separated by a LSC region (85,863–85,951 bp), and a SSC region (17,786–17,849 bp). The guanine-cytosine (GC) contents of the cpDNA for the seven species were very similar, around 36.4% (Table 2).

Table 2.

Details of the complete chloroplast genomes of seven Arachis species.

A. appressipila A. batizocoi A. diogoi A. helodes A. hypogaea A. rigonii A. villosa
Total 156,394 156,275 156,393 156,378 156,395 156,343 156,381
LSC 85,946 85,863 85,951 85,934 85,951 85,868 85,932
SSC 18,800 18,786 18,794 18,796 18,796 18,849 18,801
IR 25,824 25,813 25824 25,824 25,824 25,813 25,824
Total 110 110 110 110 110 110 110
Protein coding genes 76 76 76 76 76 76 76
rRNA 4 4 4 4 4 4 4
tRNA 30 30 30 30 30 30 30
GC% 36.4% 36.4% 36.4% 36.4% 36.4% 36.4% 36.4%

When the duplicated genes in the IR regions were counted only once, the seven Arachis chloroplast genomes all have 110 different genes arranged in the same order, including 76 protein-coding genes, 30 tRNAs, and 4 rRNAs. Seven genes that include one tRNA gene, four rRNA genes, and five protein-coding genes (rpl23, ycf2, ndhB, rps7, ycf15) are completely duplicated in the IR regions. Twelve of the protein-coding genes and six of the tRNA genes contain introns; 15 of these contain a single intron, whereas three genes have two introns (Fig. 1, Table 1). To detect a possible IR expansion, the IR-LSC/SSC borders with full annotations for the adjacent genes were compared across the seven chloroplast genomes analysed, but no differences were found.

Figure 1.

Figure 1

Map of the Arachis chloroplast genome. The genes inside and outside of the circle are transcribed in the clockwise and counterclockwise directions, respectively. Genes belonging to different functional groups are shown in different colors. Thick lines indicate the extent of the inverted repeats (IRa and IRb) that separate the genomes into small single-copy (SSC) and large single-copy (LSC) regions.

Table 1.

Genes identified in the chloroplast genome of Arachis species.

Category for genes Group of gene Name of gene
Photosynthesis related genes Photosystem I psaA, psaB, psaC, psaI, psaJ
Photosystem II psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbN, psbT, psbZ
cytochrome b/f compelx petA, *petB, *petD, petG, petL, petN
ATP synthase atpA, atpB, atpE, *atpF, atpH, atpI
cytochrome c synthesis ccsA
Assembly/stability of photosystem I *ycf3,ycf4
NADPH dehydrogenase *ndhA, *ndhB, ndhC, ndhD, ndhE, ndhF,ndhG, ndhH, ndhI, ndhJ, ndhK
Rubisco rbcL
Transcription and translation related genes transcription rpoA, rpoB, *rpoC1, rpoC2
ribosomal proteins rps2, rps3, rps4, rps7, rps8, rps11, *rps12, rps14,rps15, *rps16, rps18, rps19, rpl2, rpl14, *rpl16, rpl20, rpl22, rpl23, rpl32, rpl33,rpl36
RNA genes ribosomal RNA rrn5, rrn4.5, rrn16, rrn23
transfer RNA *trnA-UGC, trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA,trnG-GCC, *trnG-UCC, trnH-GUG, trnI-CAU, *trnI-GAU,*trnK-UUU, trnL-CAA, *trnL-UAA, trnL-UAG, trnfM-CAU,trnM-CAU, trnN-GUU, trnP-UGG, trnQ-UUG,trnR-ACG, trnR-UCU, trnS-GCU, trnS-GGA, trnS-UGA, trnT-GGU,trnT-UGU, trnV-GAC, *trnV-UAC, trnW-CCA, trnY-GUA
Other genes RNA processing matK
carbon metabolism cemA
fatty acid synthesis accD
proteolysis *clpP
Genes of unknown function conserved reading frames ycf1, ycf2

Intron-containing genes are marked by asterisks (*).

Chloroplast genome sequence divergence among Arachis species

The seven chloroplast genomes were fully aligned, giving an alignment matrix of 156,818 bp. The alignment revealed a high degree of sequence similarity across the Arachis chloroplast genome, which suggests that it is highly conserved in Arachis. We retrieved 643 variable sites (0.41%), including 212 singletons and 431 parsimony-informative sites (0.27%) across the entire chloroplast genome (Table 3).

Table 3.

Variable site analyses in the seven Arachis chloroplast genomes.

Variable sites Information sites Nucleotide Diversity
Number of sites Numbers % Numbers %
LSC 88,262 460 0.52% 298 0.34% 0.00185
SSC 18,898 135 0.71% 91 0.48% 0.0025
IR 25,829 24 0.09% 21 0.08% 0.00037
Complete cp genome 156,818 643 0.41% 431 0.27% 0.00144

To elucidate the level of sequence divergence, the nucleotide variability (π) values within 600 bp windows in the seven Arachis chloroplast genomes were calculated with DnaSP 5.0 software. The variability throughout the chloroplast genomes was quantified using the average nucleotide diversity (π) (Fig. 3). The average value of π is 0.00166. Among the LSC, SSC, and IR regions, the SSC exhibits the highest nucleotide diversity (0.0025), and the IR exhibit the least divergence (0.00037). There were eleven peaks which showed remarkably higher π values (>0.006). Two are in the coding regions of ndhF and ycf1, one is in the ndhA intron, and nine are in the intergenic regions (accD-psaI, psbE-petL, rps11-rpl36, rpl32-trnL, trnC-rpoB, trnG-trnS, trnL-trnT-rps4, trnP-psaJ). Seven of these regions lie in the LSC and four are in the SSC.

Figure 3.

Figure 3

Sliding window analysis of the complete chloroplast genomes of seven Arachis species (window length: 600 bp, step size: 200 bp). X-axis: position of the window midpoint, Y-axis: nucleotide diversity within each window.

The number of nucleotide substitutions and p-distances and were used to estimate the divergence between the seven Arachis species. The number of nucleotide substitutions in pairwise comparisons between the seven species ranged from 23 to 433, and the p-distances ranged from 0.00015 to 0.00278 (Table 4). The overall sequence divergence estimated by p-distance among the four genomes was only 0.00167. The cp genomes of A. batizocoi and A. rigonii had the lowest levels of sequence divergence.

Table 4.

Nucleotide substitutions and sequence divergence in seven complete chloroplast genomes in Arachis.

A. appressipila A. batizocoi A. diogoi A. helodes A. hypogaea A. rigonii A. villosa
A. appressipila 0.00272 0.00086 0.00095 0.00092 0.00271 0.00088
A. batizocoi 424 0.00270 0.00281 0.00275 0.00015 0.00273
A. diogoi 134 421 0.00057 0.00061 0.00266 0.00074
A. helodes 149 438 89 0.00058 0.00278 0.00081
A. hypogaea 144 428 96 91 0.00274 0.00077
A. rigonii 422 23 415 433 427 0.00270
A. villosa 138 425 116 126 121 420

The lower triangle shows the number of nucleotide substitutions between the genomes. The upper triangle indicates the calculated sequence divergence for the seven complete chloroplast genomes.

Indels and microsatellites

The indels were filtered to separate common indel events from all SSR-indel mutations in this study. We adopted a simple and straightforward strategy for identifying common indel mutations. We retrieved 85 common indels from the cp genomes of all seven Arachis species (Table S2). Only one was found in a genic region (ycf1). Ten (12%) were located in intronic regions, including atpF, clpP, ndhA (two indels), petB, petD, trnG, trnV and ycf3 (two indels). Forty-four spacer regions harboured indels; the psbD-trnT spacer had the highest number of indels (seven), followed by atpH-atpF (five), pebM-petN (four), trnV-ndhC (three), and rpl32-trnL (three). The sizes of the common indels ranged from 1 to 20 bp, with indels of 1, 4, and 6 bp being the most common (Fig. 4). The largest one, in ndhF-rpl32, was a deletion in the A. batizocoi cp genome, while the next largest, which was found in ndhE-ndhG, was an insertion in A. rigonii. Most common indels found in the chloroplast genomes provided phylogenetic signal at the species level.

Figure 4.

Figure 4

Indels identified in the cp genomes of seven Arachis species. (A) Numbers of individual indels shown by sequence length. (B) Relative frequency of indel occurrence in introns, exons, and spacer regions.

With MISA analysis, 101 universal SSR loci were detected in the chloroplast genomes of all seven Arachis species. Among the SSRs identified, we found 60 mononucleotide motifs that ranged in length from 10 to 15 nucleotides, 27 dinucleotide, 5 trinucleotide, and 9 tetranucleotide SSRs. The majority of the SSRs consist of A/T mononucleotide repeats. Chloroplast genome SSRs are composed of A and/or T and rarely contain tandem C and/or G repeats. Thirty-seven SSR loci showed polymorphism after in silico comparative analysis (Fig. 2, Table S3). Intergenic regions contained 30 SSRs, and there were seven located in intronic regions. We designed primer pairs for amplification of all the SSRs (Table 5, Table S4).

Figure 2.

Figure 2

Analyses of simple sequence repeat (SSR) in the Arachis chloroplast genomes. (A) Number different SSRs types detected by MISA. (B) Frequency of identified SSR motifs in the different repeat classes.

Table 5.

SSRs identified from in silico comparative analysis of the seven Arachis cp genomes.

No. Position Region Locatin SSR type Forward sequence Reverse sequence Length (bp)
1 trnK-rbcL LSC spacer (A)10 TACCATTGAGTTAGCAACCCCC CGATTTCTTCACGTTACAGAGGC 248
2 trnK-rbcL LSC spacer (A)12 CGATTTCTTCACGATCGGATTA AATATAATCAAATTCGATTTA 141
3 rbcL-atpB LSC spacer (A)12 TCATATGTATGGCGCAACCCAA TTCATGGGCGAGCATACAATTT 189
4 trnV intron LSC intron (T)12 TCAAAAACGCAAGGGCTATAGC TACTGGACGTCTCAACCCTTTG 190
5 trnF-trnL LSC spacer (A)15 ACTCGAATCCATTTGTGAAAGACT TCCCTCTATCCCCAAAAGACCT 131
6 trnL-trnT LSC spacer (T)10 TTGCGATTAGAATCGCATTAA AGATTCGACAAAATCTGGATA 151
7 trnL-trnT LSC spacer (T)11 ATTACTGTAACTGTAATAGAA ATGCTCTAACCTCTGAGCTA 246
8 ycf3 2nd intron LSC intron (A)11 TGATCTGTCATTACGTGCGACT TCTTTACGGCGCTTCCTCTATC 208
9 ycf3-psaA LSC spacer (T)12 TGAAGATCACAGGGCGTTCTTA TGGATGGACTGATGTAGACAACA 280
10 ycf3-psaA LSC spacer (AT)7 TAGTTCTATTTATATTATTC ATTTAAATGAAATATGCATTA 143
11 ycf3-psaA LSC spacer (T)10 ATTCAAAAAGGTCCGTTGAGCG CTCCTTCCGGACAACACATACA 230
12 psbD-trnT LSC spacer (A)14 GTGAAGCCATGATTTGATGTA ATTAGTCGATATTTACGATTA 193
13 psbD-trnT LSC spacer (A)10 GAATCTTGAGGAACGGGAGGAT AGTGGACCTAACCCATTGAATCA 158
14 psbD-trnT LSC spacer (T)13 TTGATTATCATTCATTAGAAT GTAAGGCGTAAGTCATCGGT 243
15 trnT-trnE LSC spacer (A)12 TCCTGCTCTTGAACCGATTCTT GTTGGTTTGCTAGAAAAGGCGT 188
16 trnT-trnE LSC spacer (G)11 TGGAATTATAGATTGGCGATT ATGTCCTGGACCACTAGACGA 223
17 trnD-psbM LSC spacer (A)13 CCCGTCAGTCCCGAATGAATAA CGATTCATCGTCGAGAATGGAA 256
18 petN-trnC LSC spacer (T)10 AAGATTTACTATATCCATGTG TTGACTCTGTACCAGCGATT 182
19 trnC-rpoB LSC spacer (AT)6 GAAAAAGGATTTGCAGTCCCCC GGTTCCGTTTTGTCCTTCCATT 140
20 trnC-rpoB LSC spacer (A)10 GGTGTGTAAACTCTCCCACCTT AAATCGACTCGGGATTTGTTCG 227
21 atpH-atpF LSC spacer (T)10 TACAAGCGGTATTCAAGCCCT CAATTAATAGAATCAGAATTCA 227
22 atpH-atpF LSC spacer (T)11 ATTCAGTTCTTCGGTCGAACGA ACCGTAAACCAATTGTTCGTGT 259
23 atpF-intron LSC intron (A)10 AAAGCAAAGCTAGGCATAGGCA ACGTAGGTCATCGATTTCGCAT 259
24 trnQ-accD LSC spacer (a)13 TGCAAGCAAAAGTGTATTCCGG ACTTGGTCCAGGATCTTTTAGCT 167
25 psaJ-rpl33 LSC spacer (T)10 CTATTGATCGAAATCAATCGT CCATTGAAGCCTGTACCAGAT 235
26 rpl20-rps12 LSC spacer (T)12 GAGTTGGTTTAGATCAATCT ATGTCAGCAGCAGAAGCTCA 231
27 rps12-clpP LSC spacer (A)14 GTGACATTTCGGATTGGCTGTC ATTGTTGATCTTGTCGCGGTTG 276
28 clpP intron 1 LSC intron (T)15 AGATCAGCATCAGTAAATGAT ATCGGAAGCCTATTTCAGTGTC 249
29 clpP-psbB LSC spacer (A)11 CACACCACCATTGCGTATTGTT GAACACGATACCAAGGCAAACC 271
30 rps11-rpl36 LSC spacer (TA)6 GAGATGTATGGATATATTCAT TTGAATGAATATAGAAATTCTA 297
31 rps11-rpl36 LSC spacer (T)11 AGTTTGAATTTCAATATCTA GATCCGAGATTAAGTTGAAGGA 251
32 rpl16 intron LSC intron (TA)7 TCTACAATGGAGCCTCGCAAAT ACAAATCAAGAGCACCGAGTCA 104
33 rpl16 intron LSC intron (TTTC)4 TGTTGATGCTTTATTACACTTCCCC TCATCGCTTCGCATTATCTGGA 272
34 rpl2 intron IR intron (T)10 TTGCAATCAGTTTCGCTACAGC CTTGTACAGTTTGGGAAGGGGT 161
35 ndhF-rpl32 SSC spacer (A)10 GAACTGGAAGCGGAATGAAAGG AGAAGTATTGTGCAAAGATTCAG 212
36 ndhF-rpl32 SSC spacer (A)10 ACAGATATCTATGTTTGGCA TGCCATGCAACTGATATAGT 200
37 ndhG-ndhI SSC spacer (T)10 ATAGAACAGATATCGAAATGA AATAGATATGAAACAGAATA 142

Phylogenetic analysis

We used four datasets (the complete chloroplast genome, the LSC region, the IR region, and the SSC region) to analyze the phylogenetic relationships among members of the genus Arachis. The cp genome of Indigofera tinctoria was used as the outgroup according to Schwarz, et al.26. All four datasets produced similar phylogenetic trees with moderate to high support, except for the IR dataset, which had poor support (Fig. 5). The reconstructed phylogeny divided the species into two clades with 100% bootstrap support based on Maximum Likelihood (ML) and Bayesian Inference (BI) analyses. A. batizocoi and A. rigonii form one clade that is sister to the remaining species with 100% bootstrap support. A. hypogaea was closer to A. helodes than to A. diogoi, A. villosa, and A. appressipila.

Figure 5.

Figure 5

Phylogenetic relationships of the seven Arachis species constructed from the complete chloroplast genome sequences using maximum likelihood (ML) and Bayesian inference (BI). ML topology shown with ML bootstrap support value/Bayesian posterior probability given at each node.

Discussion

Next generation sequencing (NGS) methods have enabled the rapid and cost-efficient sequencing of plant genomes. In past several years, several studies have reported the development of genetic resources for peanut, including SSRs14,27, transcript sequences28,29, and draft nuclear genome sequences1,3. However, the chloroplast genome is non-recombining and uniparentally inherited, making it a valuable source of information for improving the phylogenetics, species identification, and resolution18,30,31. In this study, we generated complete chloroplast genome sequences for seven Arachis species using NGS sequencing methods. By comparing the chloroplast genome sequences obtained in this work, we were able to retrieve all genetic resources, including SNPs, microsatellites, indels, and ‘hotspot’ regions.

The seven Arachis chloroplast genomes showed a high degree of conservation with respect to genome size and structure, gene number, and also GC content. The genetic divergence was found to be extremely low among the seven Arachis chloroplast genomes, as in other angiosperms3234. Within the seven species, only 643 SNPs were detected, which indicated that nucleotide substitution mutations in the chloroplast genome of Arachis species are more prevalent than in species of rice35,36 and Panax 32, and less frequent than in species of Quercus 37. Recently, single nucleotide polymorphisms (SNPs) have become the genetic markers of choice, because they are abundant in genomes and are amenable to high-throughput, automated genotyping assays; consequently, SNPs are increasingly popular in phylogeography, phylogenetics and species identification38,39.

In addition to nucleotide substitutions, indels are another important class of genetic variation. The most common indel sizes range from 1 to 200 bp, and mainly occur in non-coding regions40. According to our results, the common indels were often less homoplasious than were nucleotide substitutions (Table S2). It has been shown recently that adding microstructural characters significantly increases resolution and support compared to simple substitution-based matrices of chloroplast DNA sequences41,42.

SSRs are abundant in the chloroplast genomes of angiosperms, and we identified 101 SSRs in Arachis. The most common types are mononucleotide repeats, ranging in size from 10 to 15 nucleotides, mostly A/T. Because chloroplast genome sequences are highly conserved in Arachis, chloroplastic microsatellites are transferable across species. Polymorphic SSRs allowed us to develop 37 markers for Arachis species (Table 5). These new resources will be potentially useful for population genetic, phylogenetic, and species identification studies in the genus Arachis, possibly in combination with the other informative molecular makers from the mitochondrial and nuclear genomes27,28,43.

Mutation events in the cp genome are not random, but are clustered in “hotspots,” which result in highly variable regions dispersed throughout the chloroplast genomes18,44. We identified eleven variable regions in the Arachis chloroplast genome, which enabled the development of novel markers for genetic studies in Arachis. The divergent hotspot regions could provide adequate genetic information for phylogenetics and species identification, and can be used to develop novel DNA barcodes for Arachis.

The chloroplast genome contains highly informative markers in plant phylogenetics due to its relatively small size, largely uniparental inheritance, conservation of gene number and order. With NGS technology, the chloroplast genome can be obtained efficiently, and much valuable sequence data from the chloroplast genome can be developed for plant relationships4548. These larger datasets can offer opportunities for resolving the most taxa in the plant tree of life, even at the species level36.

The genus Arachis, including approximately 80 species, were divided into nine sections basing on morphological features, geographic distribution and cytogenetics4. Although more molecular makers were explored to evaluate Arachis species and sections, the phylogenetic relationships among these them are not fully understood. Here we present a molecular phylogenomics representing nine species. With the chloroplast genome data, they were divided into two groups. One group contains A. batizocoi and A. rigonii, and the other species, A. appressipila, A. appressipila, A. helodes, A. villosa, A. diogoi, and A. hypogaea were clustered together. These Arachis chloroplast genome provided genome-scale information to infer the phylogenetic relationships in Arachis.

In this study, we identified indel, SNP, microsatellite, and variable region markers for Arachis by comparative analyses of the seven chloroplast genomes. These new resources will be valuable for exploring the variation in Arachis populations, as well as for phylogenetics and species barcoding.

Materials and Methods

Plant material and DNA extraction

All plant material used in this study was grown in the greenhouse. Fresh leaves of seven Arachis species: Arachis appressipila Krapov. & W. C. Greg., Arachis batizocoi Krapov. & W.C. Greg., Arachis diogoi Hoehne, Arachis helodes Mart. ex Krapov. & Rigoni, Arachis hypogaea L., Arachis rigonii Krapov. & W.C. Greg., and Arachis villosa Benth. were sampled (Table S1). Fresh leaves from each accession were immediately dried with silica gel prior to DNA extraction. Total genomic DNA was extracted using a modified CTAB method49, and the DNA concentration was quantified using a NanoDrop spectrophotometer (Thermo Scientific, Carlsbad, CA, USA). Total DNA samples with concentrations >30 ng μL−1 were chosen for Illumina sequencing.

Chloroplast genome sequencing, assembly and annotation

DNA was sheared to construct a 400 bp (insert size) paired-end library in accordance with the Illumina HiSeq. 4000 standard protocol. The paired-end reads were qualitatively assessed and assembled using SPAdes 3.6.150. Gaps in the cpDNA sequences were filled by PCR amplification and Sanger sequencing. Sanger sequence reads were proofread and assembled with Sequencher 4.10 (http://www.genecodes.com). The four junctions between the inverted repeats (IRs) and the small single copy (SSC)/large single copy (LSC) regions were checked by amplification with specific primers followed by Sanger sequencing51. The cpDNA annotation was performed with Plann52 using the A. hypogaea reference sequence from Genbank (KX257487). The cpDNA genome map was drawn using Genome Vx software53.

Molecular marker development and validation

All sequenced Arachis cp genomes were aligned using MIFFT v754, assuming collinear genomes for the full alignment, and then adjusted manually using Se-Al 2.055. Variable and parsimony-informative base sites across the complete cp genomes and the LSC, SSC, and IR regions of the six cp genomes were calculated using MEGA 6.0 software56. The p-distances among the Arachis chloroplast genomes were calculated with MEGA software to evaluate the divergence among the Arachis species.

A sliding window analysis was conducted to calculate the nucleotide diversity (Pi) of the cp genome using DnaSP v5 software. The step size was set to 200 bp, with a 600-bp window length.

For retrieving indel mutations, the multiple sequence alignment was imported into DnaSP v5 software57. All indels were initially filtered to separate SSRs (simple sequence repeats) from other indel types.

The cp genome sequences were analyzed to identify potential microsatellites (SSRs) using MISA software (http://pgrc.ipk-gatersleben.de/misa/). The minimum numbers (thresholds) for the SSR motifs were 10, 5, 4, 3, 3, and 3 for mono-, di-, tri-, tetra-, penta-, and hexa-nucleotide repeats, respectively. All of the repeats found were manually verified, and redundant results were removed.

Phylogenetic analysis

To evaluate the consistency of phylogenetic trees produced from cpDNA regions with different molecular evolutionary rates, we extracted three subsets (LSC, SSC, and IRs) from the complete chloroplast data set, and combined these to produce three types of trees. The lengths of the alignment matrices of these datasets are shown in Table 4. In all the phylogenetic analyses, Indigofera tinctoria was used as an outgroup.

The Akaike Information Criterion (AIC) was used in the jModelTest software package v 2.1.358 to compare models of character evolution. Maximum likelihood analysis was performed using the RAxML v 8.0.5 software package59 with 1,000 non-parametric bootstrap replicates.

MrBayes 3.2.260 was used to perform a Bayesian inference analysis. The Markov chain Monte Carlo (MCMC) analysis was run for 2 × 5,000,000 generations. Trees were sampled at every 1,000 generations with the first 25% discarded as burn-in. The remaining trees were used to build a 50% majority-rule consensus tree. The analysis was run to completion, and the average standard deviation of split frequencies was <0.01.

Electronic supplementary material

Supplementary Dataset 4 (31.7KB, xlsx)

Acknowledgements

This work was financially supported by grants from the National Natural Science Foundation of China (No. 31471525) and key scientific and technological project in Henan Province (No. 161100111000). We appreciate the help from Dr. Chao Xu from Institution of Botany, Chinese Academy of Science during the laboratory work.

Author Contributions

Yin D.M. planned and designed the study; Yin D.M. and Zhang X.G. analysed the data and wrote the firstdraft of the manuscript; Zhang J.H. and He X.Y. evaluated and analysed phenotypic data; Wang Y. and Ma X.L. contributed to data analysis,writing and interpretation.

Competing Interests

The authors declare that they have no competing interests.

Footnotes

Electronic supplementary material

Supplementary information accompanies this paper at 10.1038/s41598-017-12026-x.

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Chen, X. et al. Draft genome of the peanut A-genome progenitor (Arachis duranensis) provides insights into geocarpy, oil biosynthesis, and allergens. Proceedings of the National Academy of Sciences, doi:10.1073/pnas.1600899113 (2016). [DOI] [PMC free article] [PubMed]
  • 2.Ren X, et al. Genetic Diversity and Population Structure of the Major Peanut (Arachis hypogaea L.) Cultivars Grown in China by SSR Markers. PLOS ONE. 2014;9:e88091. doi: 10.1371/journal.pone.0088091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bertioli DJ, et al. The genome sequences of Arachis duranensis and Arachis ipaensis, the diploid ancestors of cultivated peanut. Nat. Genet. 2016;48:438–446. doi: 10.1038/ng.3517. [DOI] [PubMed] [Google Scholar]
  • 4.Krapovickas A, Gregory WC. Taxonomıía del género Arachis (Léeguminosae) Bonplandia. 1994;8:1–186. [Google Scholar]
  • 5.Stalker HT, Phillips TD, Murphy JP, Jones TM. Variation of isozyme patterns among Arachis species. Theoretical and Applied Genetics. 1994;87:746–755. doi: 10.1007/BF00222901. [DOI] [PubMed] [Google Scholar]
  • 6.Lu J, Pickersgill B. Isozyme variation and species relationships in peanut and its wild relatives (Arachis L. — Leguminosae) Theoretical and Applied Genetics. 1993;85:550–560. doi: 10.1007/BF00220913. [DOI] [PubMed] [Google Scholar]
  • 7.Kochert G, et al. RFLP and Cytogenetic Evidence on the Origin and Evolution of Allotetraploid Domesticated Peanut, Arachis hypogaea (Leguminosae) Am. J. Bot. 1996;83:1282–1291. doi: 10.2307/2446112. [DOI] [Google Scholar]
  • 8.Raina SN, et al. RAPD and ISSR fingerprints as useful genetic markers for analysis of genetic diversity, varietal identification, and phylogenetic relationships in peanut (Arachis hypogaea) cultivars and wild species. Genome. 2001;44:763–772. doi: 10.1139/g01-064. [DOI] [PubMed] [Google Scholar]
  • 9.Hilu KW. & Stalker, H. T. Genetic relationships between peanut and wild species of Arachis sect. Arachis (Fabaceae): Evidence from RAPDs. Plant Syst. Evol. 1995;198:167–178. doi: 10.1007/BF00984735. [DOI] [Google Scholar]
  • 10.Milla SR, Isleib TG, Stalker HT. Taxonomic relationships among Arachis sect. Arachis species as revealed by AFLP markers. Genome. 2005;48:1–11. doi: 10.1139/g04-089. [DOI] [PubMed] [Google Scholar]
  • 11.Gagliardi RF, et al. Assessment of genetic stability among in vitro plants of Arachis retusa using RAPID and AFLP markers for germplasm preservation. J. Integr. Plant Biol. 2007;49:307–312. doi: 10.1111/j.1744-7909.2007.00402.x. [DOI] [Google Scholar]
  • 12.Tang R, et al. Genetic Diversity in Cultivated Groundnut Based on SSR Markers. Journal of Genetics and Genomics. 2007;34:449–459. doi: 10.1016/S1673-8527(07)60049-6. [DOI] [PubMed] [Google Scholar]
  • 13.Liang X, et al. Utility of EST-derived SSR in cultivated peanut (Arachis hypogaea L.) and Arachiswild species. BMC Plant Biol. 2009;9:1–9. doi: 10.1186/1471-2229-9-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sardar SS, et al. In silico mining of EST-SSRs in Arachis hypogaea L. and their utilization for genetic structure and diversity analysis in cultivars/breeding lines in Odisha, India. Mol. Breed. 2016;36:49. doi: 10.1007/s11032-016-0466-y. [DOI] [Google Scholar]
  • 15.Bechara MD, et al. Phylogenetic relationships in genus Arachis based on ITS and 5.8S rDNA sequences. BMC Plant Biol. 2010;10:1–12. doi: 10.1186/1471-2229-10-255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Grabiele M, Chalup L, Robledo G, Seijo G. Genetic and geographic origin of domesticated peanut as evidenced by 5S rDNA and chloroplast DNA sequences. Plant Syst. Evol. 2012;298:1151–1165. doi: 10.1007/s00606-012-0627-3. [DOI] [Google Scholar]
  • 17.Moretzsohn MC, et al. A study of the relationships of cultivated peanut (Arachis hypogaea) and its most closely related wild species using intron sequences and microsatellite markers. Ann. Bot. 2013;111:113–126. doi: 10.1093/aob/mcs237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Dong W, Liu J, Yu J, Wang L, Zhou S. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLOS ONE. 2012;7:e35071. doi: 10.1371/journal.pone.0035071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bock DG, Kane NC, Ebert DP, Rieseberg LH. Genome skimming reveals the origin of the Jerusalem Artichoke tuber crop species: neither from Jerusalem nor an artichoke. New Phytol. 2014;201:1021–1030. doi: 10.1111/nph.12560. [DOI] [PubMed] [Google Scholar]
  • 20.Huang, D. I., Hefer, C. A., Kolosova, N., Douglas, C. J. & Cronk, Q. C. B. Whole plastome sequencing reveals deep plastid divergence and cytonuclear discordance between closely related balsam poplars, Populus balsamifera and P. trichocarpa (Salicaceae). New Phytol., n/a-n/a, doi:10.1111/nph.12956 (2014). [DOI] [PubMed]
  • 21.Perdereau, A., Klaas, M., Barth, S. & Hodkinson, T. R. Plastid genome sequencing reveals biogeographical structure and extensive population genetic variation in wild populations of Phalaris arundinacea L. in north‐western Europe. GCB Bioenergy (2016).
  • 22.Daniell H, Lin C-S, Yu M, Chang W-J. Chloroplast genomes: diversity, evolution, and applications in genetic engineering. Genome Biology. 2016;17:1–29. doi: 10.1186/s13059-016-1004-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lima, M. S., Woods, L. C., Cartwright, M. W. & Smith, D. R. The (in)complete organelle genome: exploring the use and non-use of available technologies for characterizing mitochondrial and plastid chromosomes. Mol. Ecol. Resour., doi:10.1111/1755-0998.12585 (2016). [DOI] [PubMed]
  • 24.Shendure J, Ji H. Next-generation DNA sequencing. Nat. Biotechnol. 2008;26:1135–1145. doi: 10.1038/nbt1486. [DOI] [PubMed] [Google Scholar]
  • 25.Prabhudas, S. K., Prayaga, S., Madasamy, P. & Natarajan, P. Shallow Whole Genome Sequencing for the Assembly of Complete Chloroplast Genome Sequence of Arachis hypogaea L. Frontiers in Plant Science7, doi:10.3389/fpls.2016.01106 (2016). [DOI] [PMC free article] [PubMed]
  • 26.Schwarz EN, et al. Plastid genome sequences of legumes reveal parallel inversions and multiple losses of rps16 in papilionoids. J. Syst. Evol. 2015;53:458–468. doi: 10.1111/jse.12179. [DOI] [Google Scholar]
  • 27.Li Y, et al. Characterization of Simple Sequence Repeat (SSR) Markers and Genetic Relationships within Cultivated Peanut (Arachis hypogaea L.) Peanut Science. 2011;38:1–10. doi: 10.3146/PS10-10.1. [DOI] [Google Scholar]
  • 28.Chen X, et al. Transcriptome-wide sequencing provides insights into geocarpy in peanut (Arachis hypogaea L.) Plant Biotechnol J. 2016;14:1215–1224. doi: 10.1111/pbi.12487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Peng Z, Gallo M, Tillman BL, Rowland D, Wang J. Molecular marker development from transcript sequences and germplasm evaluation for cultivated peanut (Arachis hypogaea L.) Mol. Genet. Genomics. 2016;291:363–381. doi: 10.1007/s00438-015-1115-6. [DOI] [PubMed] [Google Scholar]
  • 30.Dong W, et al. ycf1, the most promising plastid DNA barcode of land plants. Sci. Rep. 2015;5:8348. doi: 10.1038/srep08348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yao X, et al. Chloroplast genome structure in Ilex (Aquifoliaceae) Sci. Rep. 2016;6:28559. doi: 10.1038/srep28559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Dong W, et al. A chloroplast genomic strategy for designing taxon specific DNA mini-barcodes: A case study on ginsengs. BMC Genetics. 2014;15:138. doi: 10.1186/s12863-014-0138-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Song Y, et al. Comparative analysis of complete chloroplast genome sequences of two tropical trees Machilus yunnanensis and Machilus balansae in the family Lauraceae. Front Plant Sci. 2015;6:662. doi: 10.3389/fpls.2015.00662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Xu C, et al. Comparative Analysis of Six Lagerstroemia Complete Chloroplast Genomes. Front Plant Sci. 2017;8:15. doi: 10.3389/fpls.2017.00015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Masood MS, et al. The complete nucleotide sequence of wild rice (Oryza nivara) chloroplast genome: first genome wide comparative sequence analysis of wild and cultivated rice. Gene. 2004;340:133–139. doi: 10.1016/j.gene.2004.06.008. [DOI] [PubMed] [Google Scholar]
  • 36.Wambugu PW, Brozynska M, Furtado A, Waters DL, Henry RJ. Relationships of wild and domesticated rices (Oryza AA genome species) based upon whole chloroplast genome sequences. Sci. Rep. 2015;5:13957. doi: 10.1038/srep13957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yang Y, et al. Comparative Analysis of the Complete Chloroplast Genomes of Five Quercus Species. Front Plant Sci. 2016;7:959. doi: 10.3389/fpls.2016.00959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lemmon EM, Lemmon AR. High-Throughput Genomic Data in Systematics and Phylogenetics. Annual Review of Ecology, Evolution, and Systematics. 2013;44:99–121. doi: 10.1146/annurev-ecolsys-110512-135822. [DOI] [Google Scholar]
  • 39.McCormack JE, Hird SM, Zellmer AJ, Carstens BC, Brumfield RT. Applications of next-generation sequencing to phylogeography and phylogenetics. Mol. Phylogenet. Evol. 2013;66:526–538. doi: 10.1016/j.ympev.2011.12.007. [DOI] [PubMed] [Google Scholar]
  • 40.Borsch T, Quandt D. Mutational dynamics and phylogenetic utility of noncoding chloroplast DNA. Plant Syst. Evol. 2009;282:169–199. doi: 10.1007/s00606-009-0210-8. [DOI] [Google Scholar]
  • 41.Lohne C, Borsch T. Molecular evolution and phylogenetic utility of the petD group II intron: A case study in basal angiosperms. Mol. Biol. Evol. 2005;22:317–332. doi: 10.1093/molbev/msi019. [DOI] [PubMed] [Google Scholar]
  • 42.Moghaddam SM, et al. Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L. Front Plant Sci. 2014;5:185. doi: 10.3389/fpls.2014.00185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Koppolu R, Upadhyaya HD, Dwivedi SL, Hoisington DA, Varshney RK. Genetic relationships among seven sections of genus Arachisstudied by using SSR markers. BMC Plant Biol. 2010;10:1–12. doi: 10.1186/1471-2229-10-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Shaw J, Lickey EB, Schilling EE, Small RL. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: The tortoise and the hare III. Am. J. Bot. 2007;94:275–288. doi: 10.3732/ajb.94.3.275. [DOI] [PubMed] [Google Scholar]
  • 45.Carbonell-Caballero J, Alonso R, Ibañez V, Terol J, Talon M, Dopazo J. A phylogenetic analysis of 34 chloroplast genomes elucidates the relationships between wild and domestic species within the genus Citrus. Mol Biol Evol. 2015;32:2015–2035. doi: 10.1093/molbev/msv082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Jansen RK, et al. Analysis of 81 genes from 64 plastid genomes resolves relationships in angiosperms and identifies genome-scale evolutionary patterns. Proc Nat Acad Sci USA. 2007;104:19369–19374. doi: 10.1073/pnas.0709121104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ma PF, Zhang YX, Zeng CX, Guo ZH, Li DZ. Chloroplast phylogenomic analyses resolve deep-level relationships of an intractable bamboo tribe Arundinarieae (Poaceae) Syst Biol. 2014;63:933–950. doi: 10.1093/sysbio/syu054. [DOI] [PubMed] [Google Scholar]
  • 48.Ross TG, Barrett CF, Soto Gomez M, Lam VKY, Henriquez CL, Les DH, Davis JI, Cuenca A, Petersen G, Seberg O. Plastid phylogenomics and molecular evolution of Alismatales. Cladistics. 2016;32:160–178. doi: 10.1111/cla.12133. [DOI] [PubMed] [Google Scholar]
  • 49.Li J, Wang S, Jing Y, Wang L, Zhou S. A modified CTAB protocol for plant DNA extraction. Chin. Bull. Bot. 2013;48:72–78. doi: 10.3724/SP.J.1259.2013.00072. [DOI] [Google Scholar]
  • 50.Bankevich A, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–477. doi: 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Dong W, Xu C, Cheng T, Lin K, Zhou S. Sequencing angiosperm plastid genomes made easy: A complete set of universal primers and a case study on the phylogeny of Saxifragales. Genome Biol. Evol. 2013;5:989–997. doi: 10.1093/gbe/evt063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Huang DI, Cronk QCB. Plann: A Command-Line Application for Annotating Plastome Sequences. Applications in Plant Sciences. 2015;3:1500026. doi: 10.3732/apps.1500026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Conant GC, Wolfe KH. GenomeVx: simple web-based creation of editable circular chromosome maps. Bioinformatics. 2008;24:861–862. doi: 10.1093/bioinformatics/btm598. [DOI] [PubMed] [Google Scholar]
  • 54.Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 2013;30:772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Rambaut, A. Se-Al: sequence alignment editor. version 2.0, 1996).
  • 56.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013;30:2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009;25:1451–1452. doi: 10.1093/bioinformatics/btp187. [DOI] [PubMed] [Google Scholar]
  • 58.Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nat. Methods. 2012;9:772–772. doi: 10.1038/nmeth.2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312–1313. doi: 10.1093/bioinformatics/btu033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Ronquist F, et al. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012;61:539–542. doi: 10.1093/sysbio/sys029. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Dataset 4 (31.7KB, xlsx)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES