(A) Schematic representation of the genetic-epigenetic regulation of GLI1 promoter sequences through methylation of DNA and the histone code. (B) Epigenome analysis based on post-translational modifications in histone lysine residues, which modulate the interaction of transcription factors upon promoter regions, in euchromatin (H3K27ac and H3K4me3) or heterochromatin state (H3K9me3 y H3K27me3) and active transcription by RNA pol II. (C) Lung cancer A549 cells and their histone code on the GLI1 promoter region, in presence of pharmacological challenge with cisplatin 8 μM at 48 hours, an enrichment of the activation marking H3K4me3 is seen, as well as a significant positioning of an activated RNA Pol II after the pharmacological challenge, suggesting an epigenetic reprogramming, favoring the transcriptional activity mediated by the histone code. Assays developed with the use of the real-time PCR platform Lightcycler 480 (Roche, Mannheim, Alemania), SYBR Green Master Mix (KAPA Science, Foster City, CA, U.S.A.). Antibodies used: anti-H3k27ac (No.cat.ab4729, Lot.GR71158-2), anti-H3k27me3 (No.cat.ab6002, Lot.GR77445-3), anti-H3k4me3 (No.cat.ab8580, Lot.GR68224-1), anti-H3k9me3 (No.cat.ab8898, Lot.GR47224-2), anti-RNA Pol II CTD phosphorylated (No.cat.ab5131, Lot.GR59740-1) all from ABCAM. Primer design and their genetic localization on GLI-1 promoter region: GLI1 7 region (Genome position -2192 -2009 bp) Primer sequence F:AGGCCGTGTGACATGTGATT, R:GACAGAGCGAGACTCCGTCT. GLI1 6 region (Genome position -1830 -1673 bp) Primer sequence F: TCGGACTCCTGACTTGAGGT, R: GACAGAGCGAGACTCCGTCT. GLI1 5-4 region (Genome position -1541 -1375 bp) Primer sequence F: CCAGCCTGGGCAAATAGTGA, R: TCAGAGACCCAGCTCAGTCA. GLI1 3 region (Genome position -822 -665 pb) Primer sequence F: CCCTCCAGAACTTCGAGACG, R: GGCTCTGGAAGAAGGTGAGG. GLI1 2 region (Genome position -612 -457 bp) Primer sequence F: TTCCATCCAAAGGGTGAGGC, R: CCCCGACAACCAGATTGAGG. GLI1 1 region (genome position -301 -109 bp) Primer sequence F: AAAAAATTTAGTCGTTTCGTTTGA, R: TTATTAAAACGCTACCTCCGAA.