Multiplex polymerase chain reaction for identification of Escherichia coli, Escherichia albertii and Escherichia fergusonii

Abstract

Escherichia coli, Escherichia albertii, and Escherichia fergusonii are closely related bacteria that can cause illness in humans, such as bacteremia, urinary tract infections and diarrhea. Current identification strategies for these three species vary in complexity and typically rely on the use of multiple phenotypic and genetic tests. To facilitate their rapid identification, we developed a multiplex PCR assay targeting conserved, species-specific genes. We used the Daydreamer™ (Pattern Genomics, USA) software platform to concurrently analyze whole genome sequence assemblies (WGS) from 150 Enterobacteriaceae genomes (107 E. coli, 5 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other species) and design primers for the following species-specific regions: a 212 bp region of the cyclic di-GMP regulator gene (cdgR, AW869_22935 from genome K-12 MG1655, CP014225) for E. coli/Shigella; a 393 bp region of the DNA-binding transcriptional activator of cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025) for E. albertii; and a 575 bp region of the palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase (EFER_0790 from genome ATCC 35469, CU928158) for E. fergusonii. We incorporated the species-specific primers into a conventional multiplex PCR assay and assessed its performance with a collection of 97 Enterobacteriaceae strains. The assay was 100% sensitive and specific for detecting the expected species and offers a quick and accurate strategy for identifying E. coli, E. albertii, and E. fergusonii in either a single reaction or by in silico PCR with sequence assemblies.

1. Introduction

Escherichia coli, Escherichia albertii and Escherichia fergusonii may be present in animals or humans as commensals or pathogens. To begin to understand the role these organisms may play in disease, it is important to quickly and accurately identify them. Foodborne illnesses associated with E. coli and Shigella, including Shiga toxin-producing E. coli, are of significant public health concern (Luna-Gierke et al., 2014). E. albertii is an emerging pathogen, and it was determined to be the causative agent in a human gastroenteritis outbreak at a restaurant in Japan (Ooka et al., 2013). E. albertii frequently carries the intimin gene causing it to be mistakenly identified as enteropathogenic E. coli (EPEC) or enterohemorrhagic E. coli (EHEC) (Ooka et al., 2012). E. albertii can carry Shiga toxin 2f gene (stx2f) which is associated with mild clinical symptoms (Friesema et al., 2014; Murakami et al., 2014; Ooka et al., 2012). E. fergusonii is a sporadic human pathogen responsible for urinary tract infections, wound infections, and diarrhea (Gaastra et al., 2014). Multidrug-resistant forms of E. fergusonii have been isolated from humans with acute cystitis (Gaastra et al., 2014; Lagace-Wiens et al., 2010; Savini et al., 2008).

Determination of species is an important first step in identification of organisms in a clinical laboratory. Shigella spp. are considered to be pathotypes of E. coli (Pupo et al., 2000; Lan et al., 2004). Traditional phenotypic testing for identification of Escherichia spp. is time-consuming and includes multiple biochemical tests (Edwards and Ewing, 1986). Polymerase Chain Reaction (PCR) or MLST based tests for specific genes for identification of Escherichia spp. have been described (Ooka et al., 2013, Maheux et al., 2014, Maheux et al., 2014). A PCR that detects the uidA gene (encoding the b–glucuronidase enzyme) is frequently used to identify E. coli (Bej et al., 1991, (Frahm and Obst, 2003), Pavlovic et al., 2010). Traditionally, E. albertii was detected with a multiplex PCR for the presence of clpX, lysP, and mdh genes but this does not detect all E. albertii (Hyma et al., 2005, Murakami et al., 2014, Lindsey et al., 2015). Recently, Ooka et al. developed a nested PCR to detect E. albertii (Ooka et al., 2015); however, this assay does not detect additional Escherichia species. There are also rpoB gene sequencing based methods or multi locus sequencing of whole genome sequence (WGS), but these methods are time consuming and take days to complete (Hyma et al., 2005, Murakami et al., 2014, Lindsey et al., 2015). The wealth of WGS data provides an opportunity to develop a much needed multiplex polymerase chain reaction (PCR) assay to quickly speciate the common Escherichia species in a single reaction.

2. Materials and methods

2.1. Primer design and in silico PCR test

Daydreamer™ (Pattern Genomics, USA) software platform was used to concurrently analyze 150 genome assemblies (107 E. coli, 5 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other Enterobacteriaceae) that were generated by Illumina sequencing or downloaded from NCBI (Supplemental Table 1). The workflow for analyzing these sequences is illustrated in Fig. 1. First, genomic regions that are conserved in, and unique to, each species were identified. Sequences that were not specific due to any blast hit to non-target organisms on NCBI were removed and PCR primers were designed for the remaining sequences. Next, the target sequences were annotated using BLAST. For all three species, genes highly conserved at the nucleotide level and primers that had 100% accuracy and 100% coverage to our training dataset as reported by the Daydreamer™ in silico PCR tool were selected for further analysis. Primers were tested by in silico PCR with 324 assemblies, 280 E. coli (139 serogroups), 6 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other Enterobacteriaceae. All 150 sequence assemblies that were used in primer design were also used to in testing of in silico PCR (Supplementary Table 1). The primers had 100% accuracy and 100% coverage to our expanded training dataset. The primers were purchased from the Biotechnology Core Facility Branch, CDC (GA, USA) and diluted to 5 μM concentration (Table 1).

Fig. 1.

Daydreamer™ workflow.

Table 1.

Target genes and primers used in this study for each Escherichia species and amplicon size.

Escherichia species	Target gene	Primer name	Primer sequence (5′ to 3′)	Amplicon size
E. coli	Cyclic di-GMP regulator gene (cdgR, AW869_22935 from MG1655, CP014225)	EC_F EC_R	CCAGGCAAAGAGTTTATGTTGA GCTATTTCCTGCCGATAAGAGA	212 bp
E. albertii	DNA-binding transcriptional activator of cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025)	EA_F EA_R	GTAAATAATGCTGGTCAGACGTTA AGTGTAGAGTATATTGGCAACTTC	393 bp
E. fergusonii	Palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase (EFER_0790 from genome ATCC 35469, CU928158)	EF_F EF_R	AGATTCACGTAAGCTGTTACCTT CGTCTGATGAAAGATTTGGGAAG	575 bp

2.2. Escherichia isolate identification and storage

Isolates were characterized to genus and species (Table 2) using traditional phenotypic methods (Edwards and Ewing, 1986) or rpoB analysis (Lindsey et al., 2015). Isolates were stored as stocks at −80 °C in Trypticase soy broth with 20% glycerol (Becton, Dickinson and Company, USA). Isolates were streaked for single colonies onto blood agar (Becton, Dickinson and Company, USA) and incubated overnight (12–16 h) at 37C. Single colonies were used for DNA extraction.

Table 2.

Sensitivity of conventional multiplex PCR.

Species tested	Number tested	E. coli positive	E. albertii positive	E. fergusonii
Escherichia albertii	23	0	23	0
Escherichia coli	27	27	0	0
Escherichia fergusonii	14	0	0	14
Shigella sonnei	2	2	0	0
Shigella boydii	2	2	0	0
Shigella flexneri	2	2	0	0
Shigella dysenteriae	1	1	0	0
Citrobacter freundii	2	0	0	0
Enterobacter cancerogenus	1	0	0	0
Enterobacter cloacae	1	0	0	0
Escherichia hermannii	2	0	0	0
Escherichia vulneris	2	0	0	0
Klebsiella pneumoniae	1	0	0	0
Leminorella richardii	1	0	0	0
Morganella morganii	1	0	0	0
Pragia fontium	1	0	0	0
Provisional Shigella	3	3	0	0
Providencia rettgeri	1	0	0	0
Salmonella arizonae	2	0	0	0
Salmonella enterica	2	0	0	0
Salmonella enteritidis	1	0	0	0
Salmonella paratyphi B	2	0	0	0
Salmonella typhi	1	0	0	0
Yersinia enterocolitica	2	0	0	0
Total	97	37	23	14

2.3. DNA extraction, PCR amplification and electrophoresis

DNA was isolated from a collection of 68 Escherichia, 10 Shigella, and 19 other Enterobacteriaceae isolates from pure cultures using one of two methods: the ArchivePure DNA Cell/Tissue Kit (5 Prime, USA), which was performed according to the manufacturer’s protocol, or the boiled lysis method. For the boiled lysis method, a 1 μl loop-full of bacterial growth was suspended in 300 μl of water and boiled at 100 °C for 10 min.

2.4. PCR amplification and electrophoresis

Isolated DNA samples were amplified using Veriti^® Thermal Cycler (Applied Biosystems, ThermoFisher, USA) and PCR kits supplied by HotStarTaq Master Mix Kit (Qiagen, USA). The final reaction mixture contained 2 μl of boiled lysate, 100 μM of each dNTP, 0.375 μM of each primer, 1.5 mM MgCl₂, and 1.25 units of HotStarTaq. The PCR amplification was performed as follows: one cycle at 95 °C for 10 min; 30 cycles of 92 °C for 1 min, 57 °C for 1 min, and 72 °C for 30 s; and one final cycle at 72 °C for 5 min. PCR products (4 μl each) or 2 μl of Low DNA Mass Ladder (Invitrogen, ThermoFisher, USA) were diluted in 2 μl of 5 × bromophenol blue dye and electrophoresed on a 2% agarose gel prepared with TAE (40 mM Tris-acetate, pH 8.3, 1 mM EDTA) buffer. Electrophoresis was performed at a constant voltage of 100 V for 45 min and the agarose gel was stained with GelRed™ Nucleic Acid Gel Stain (VWR, USA). Agarose gels were imaged under UV light using the Gel Doc™ XR + system (Bio-Rad, USA) and analyzed for band sizes. Fig. 2 is a representative agarose gel, positive controls are the following standard strains; E. coli (EDL933), E. albertii (97–3260 = type strain Albert 19982) and E. fergusonii (ATCC 35472) (Albert et al., 1991).

Fig. 2.

Agarose gel electrophoresis of amplicons from the Escherichia species conventional multiplex PCR. M: Low DNA Mass Ladder. 1–3, Standard strains, in order: EDL933, E. coli (212 bp), 97–3260, E. albertii (393 bp), ATCC 35472, E. fergusonii (575 bp). 4. No DNA, water control. 5–8: E. coli/Shigella (ATCC BAA-460, ATCC 25922, 06–3873, 2013C-3760). 9–10: E. albertii (97–3261, 97–3762), 11–12 E. fergusonii (ATCC 35470, ATCC 35471) 13–16: Negative controls include Escherichia hermannii (90–3390), Escherichia vulneris (ATCC 33821), Salmonella enterica (ATCC 6962), and Salmonella enteriditidis (ATCC 13076).

3. Results

3.1. Primer generation and in silico PCR results

Primers were generated with the Daydreamer™ (Pattern Genomics, USA) software platform (Fig. 1), by analyzing the WGS assemblies of 150 Enterobacteriaceae genomes. The target genes and expected amplicon sizes for each species are summarized in Table 1. Primers were tested by in silico PCR with 324 WGS assemblies (Supplementary Table 1) and found to be 100% accurate with 100% coverage for each species. In silico results are 280 E. coli and 6 Shigella spp. were positive with targets at 212 bp, 21 E. albertii were positive with targets at 393 bp, 12 E. fergusonii were positive with targets at 575 bp and 5 other Enterobacteriaceae were negative with no targets detected.

3.2. Results of conventional multiplex PCR

Primers (Table 1) were validated in the laboratory with a strain set of 97 previously characterized isolates that included 27 E. coli, 10 Shigella, 23 E. albertii, 14 E. fergusonii, and 23 other Enterobacteriaceae spp. (Table 2). All targeted Escherichia spp. yielded a single amplicon of the expected size; other Enterobacteriaceae spp. included in the validation did not yield a product.

4. Discussion

4.1. Isolates and sequences used in this study

Isolates used in this study were previously identified to genus and species using traditional phenotypic methods or as identified by submitters to the Escherichia and Shigella Reference Unit at the Centers for Disease Control and Prevention (CDC) or the National Center for Biotechnology Information (NCBI).

4.2. Genome targets for PCR

Genome targets were determined by NCBI BLAST search of representative amplicon sequences and are listed in Table 1. The Enteric Disease Laboratory Branch reference and PulseNet laboratories routinely sequence Escherichia isolates that have been confirmed by traditional methods and release the Illumina raw reads to the NCBI short read archive (SRA), under the publicly available Bioproject PRJNA218110. We used sequence available at Bioproject PRJNA218110, as well as other publicly available locations, to generate Escherichia specific primers which were 100% specific when tested in silico. We developed a rapid multiplex polymerase chain reaction to detect and differentiate E. coli, E. albertii and E. fergusonii in a single tube. Of the 405 total sequences or strains used in this study only twenty-two strains were used for all three purposes: primer design, in silico PCR testing and conventional PCR in the laboratory (Supplementary Table 1). Primers were 100% specific when tested in the laboratory on 97 known isolates of Enterobacteriaceae species.

The availability of extensive quantities of sequence data for the Escherichia spp. and software tools allowed us to successfully generate primers to differentiate these species. Traditional PCRs for E. albertii targeting only a few genes (clpX, lysP and mdh) were based on the analysis of a limited number of isolates and were unable to detect all E. albertii (Hyma, Lacher et al. 2005, Murakami, Etoh et al. 2014, Lindsey, Fedorka-Cray et al. 2015). The sequences used to design primers for E. albertii in this study included human and previously published chicken isolates (Lindsey, Fedorka-Cray et al. 2015). E. coli and Shigella sequences were also diverse and represented 48 different serogroups.

5. Conclusions

This Escherichia species PCR showed 100% concordance with the results of the traditional culture methods, and it is much faster, more sensitive, and less labor intensive than the existing methods for detection of E. coli, E. albertii, and E. fergusonii. We routinely use these primers in silico to quickly identify these three Escherichia species from sequence assemblies. With the increased availability of WGS surveillance data these primers can be used by others for the rapid detection of these three species in silico.