Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Feb 21.
Published in final edited form as: Nat Chem Biol. 2017 Aug 21;13(10):1109–1114. doi: 10.1038/nchembio.2459

Metals induce transient folding and activation of the Twister ribozyme

Subrata Panja 1,*, Boyang Hua 2, Diego Zegarra 1, Taekjip Ha 1,2,3, Sarah A Woodson 1
PMCID: PMC5605428  NIHMSID: NIHMS894060  PMID: 28825710

Abstract

Twister is a small ribozyme present in almost all kingdoms of life that rapidly self-cleaves in variety of divalent metal ions. We used activity assays, bulk FRET and single-molecule FRET (smFRET) to understand how different metal ions promote folding and self-cleavage of the Oryza sativa Twister ribozyme. Although most ribozymes require additional Mg2+ for catalysis, Twister inverts this expectation, requiring 20–30 times less Mg2+ to self-cleave than to fold. Transition metals such as Co2+, Ni2+ and Zn2+ activate Twister more efficiently than Mg2+ ions. Although Twister is fully active in ≤ 0.5 mM MgCl2, smFRET experiments showed that the ribozyme visits the folded state infrequently under these conditions. Comparison of folding and self-cleavage rates indicates that most folding events lead to catalysis, which correlates with metal bond strength. Thus, the robust activity of Twister reports on transient metal ion binding under physiological conditions.

Keywords: Twister ribozyme, self cleaving RNA, metal ions, RNA folding, single-molecule FRET


Catalytic RNA is found in almost all kingdoms of life and thought to be a relic of an RNA-based world1. Recent discoveries of new classes of small self-cleaving ribozymes in a wide number of natural genomes2,3 raise questions about the range of physiological conditions that support RNA catalysis. Mg2+ ions are usually thought to stabilize the folded structures that are necessary for the biological functions of ribozymes and other noncoding RNAs. Nevertheless, the findings that certain riboswitches sense Ni2+ or Co2+ (ref. 4) and Mn2+ (ref. 5) demonstrate that transition metal ions can also support the biological functions of RNA6. Because the RNA tertiary structure provides a frame for catalysis and ligand recognition, stably folded RNAs are generally expected to be more active than unstable RNAs. Indeed, many ribozymes require more Mg2+ for catalytic activity than for folding.

Twister self-cleaving ribozymes were recently discovered through a bioinformatics search, and are widespread among microbial, plant and animal genomes2. The Twister ribozyme from Oryza sativa (Osa) contains three conserved paired regions, P1, P2 and P4, separated by flexible loops2,7 (Fig. 1a). In some Twister ribozymes, an additional P3 helix is inserted between helix P2 and P4. Phylogenetic analyses2 and X-ray crystallography7 have shown that the L2–L4 and L4–L1 loops form two pseudoknots that fold Twister into a compact tertiary structure (Fig. 1b). The “twisted” tertiary structure forms an active site pocket that catalyzes cleavage of the phosphodiester bond between U6 and A7 (Fig. 1a,b).

Fig 1. Self-cleavage of a minimal Oryza sativa Twister ribozyme at low Mg2+.

Fig 1

(a) Secondary structure of Osa 1-4 Twister ribozyme2. Pseudoknots 1 and 2 are blue and orange, respectively. The arrowhead represents the cleavage site. A P3 stem (faded red letters) was added to Osa 1-4 to stabilize base pairing between substrate (S) and ribozyme (R) strands of bi-molecular ribozymes for activity assays. (b) Structure of Osa 1-4 Twister ribozyme (pdb: 4OJI7) colored as in a. Mg2+ ions are shown as magenta spheres. (c) Representative 16% PAGE image showing the consumption of substrate (S) and appearance of product (5′P) with time. (d) Progress curves were fitted to single or double exponential rate equations: ƒcleaved = I5′P/(IS+I5′P) = Afast[1–exp(-kfastt)] + Aslow[1–exp(-kslowt]. The rate constants are listed in Supplementary Table 1 (n = 3; s.d. <10%). (e) Cleavage reactions of the bimolecular riboyzme in different MgCl2 concentrations were stopped after 1 min and analyzed by denaturing 16% PAGE. (f) The fraction cleaved after 1 min versus Mg2+ concentration (filled symbols) was fit to the Hill equation (solid line). n = 3; s.d. < 10%. Relative folding of the bimolecular ribozyme by RNase T1 protection of G21 with MgCl2 concentration (open symbols; Supplementary Fig. 3) was fit to the Hill equation (dashed line) with a midpoint of 2.5 mM MgCl2. (g) Self-cleavage of the unimolecular ribozyme after 1 min in different MgCl2 concentrations, as in d. (h) The fraction cleaved (filled symbols and solid line) and RNase T1 protection (open symbols and dashed line; see Supplementary Fig. 2) were fit to the Hill equation as in f; n = 3.

Although metal ions are not thought to be required for Twister catalysis, metal ions are needed to stabilize the overall fold2 and organize the active site8,9. Initial studies showed that the non-bridging phosphate oxygens and the 5′ oxyanion leaving group do not form inner-sphere contacts with divalent metal ions2, and the divalent metal ions do not contribute directly to catalysis. Instead, conserved nucleobases within the active site stabilize the transition state for cleavage of the scissile phosphodiester bond9. These include G33 and A1, which are proposed to act as a general base and general acid, respectively10,11. Nevertheless, metal ions are present in the active site and may contribute to catalysis, directly or indirectly12. In crystal structures of an environmental (env22) Twister ribozyme, electron density was assigned to a hydrated Mg2+ near the scissile phosphodiester8,2. Thus, by analogy with other small ribozymes, it was expected that full stabilization of the Twister active site would require high Mg2+ concentrations, in excess of what is needed to fold the RNA.

Here, we report that the small Twister ribozyme requires less Mg2+ to self-cleave than to fold, in contrast to our expectations. We also found that Twister becomes active in lower quantities of transition metals than of Mg2+ ions, raising the possibility that Twister responds to transition metals in the cell. Thus, unlike other ribozymes which require a stable tertiary structure for maximum activity, our results show that transient folding in micromolar Mg2+ or transition metal ions is sufficient for maximal self-cleavage by the Osa Twister ribozyme.

RESULTS

Self-cleaving activity of Twister ribozyme in MgCl2

To understand how self-cleaving activity depends on the presence of divalent metal ions, we measured the rate of self-cleavage in different MgCl2 concentrations. For self-cleavage experiments, we initially used a bimolecular form of Osa Twister ribozyme that has an extended P3 helix and forms a stable complex between the “ribozyme” and “substrate” RNAs (Fig. 1a)2,7. We used a ribozyme with a stable 5 bp P1 helix, because we found that this increased the reactivity of our ribozyme in comparison to a variant with a 3 bp P1 (Supplementary Results, Supplementary Fig. 1). This observation is supported by the finding that for proper folding of the central pseudoknot (Fig. 1a), the P1 stem must form correctly13, contrary to reports that P1 is not required for self-cleavage of the env22 Twister14.

To start the reaction, MgCl2 was added to the pre-assembled ribozyme–substrate complex at 20 ˚C, and the cleaved product was detected by denaturing PAGE (Fig. 1c). At very low MgCl2 concentrations (50 μM), a single exponential increase in cleaved product corresponded to an observed rate constant kobs = 0.24 min−1 at pH 7.5 (Fig. 1d). At 0.5 mM MgCl2 and above, the initial rate of self-cleavage increased to 8.4 min−1. This initial phase was followed by a slower kinetic phase (kobs = 0.6 min−1) that may reflect an additional conformational rearrangement of the active site pocket predicted by MD simulations and crystallographic structures8,15. These rates of self-cleavage were roughly comparable to those of an environmental Twister sequence at pH 7.5 and 50 μM MgCl2 (kobs ~0.1 min−1)2 and env22 Twister ribozyme at 10 mM MgCl2 (kobs = 2.4 min−1)8.

To determine the sensitivity of Twister activity to MgCl2 concentration, we measured the extent of self-cleavage of the bimolecular Twister RNA after 1 min at different MgCl2 concentrations (Fig. 1e). This 1-min interval corresponds to the end of the fast phase of self-cleavage, which is the phase that is most sensitive to MgCl2 concentration. The fraction of RNA cleaved at different MgCl2 concentrations is well-fit by a two-state cooperative folding equilibrium with a midpoint of 135 (±12) μM MgCl2 that saturates around 2 mM MgCl2 (Fig. 1f). Thus, Twister ribozyme is fully active in physiological Mg2+ levels, which are reported to be 1–5 mM in bacteria16,17 and 5 mM in plant phloem18.

We also determined the MgCl2 requirement for self-cleavage of the unimolecular form of the Osa Twister ribozyme, which has a short P3 stem (Fig. 1a). Although 40% of the RNA was cleaved during sample preparation (Fig. 1g), we were able to measure the Mg2+-dependence of self-cleavage for the remaining precursor RNA. The unimolecular form of the Twister ribozyme was even more reactive than the bimolecular form, with a midpoint of 65 (±6) μM MgCl2 (Fig. 1h).

Folding of Twister monitored by RNase footprinting

To test whether the level of Twister self-cleavage correlates with the extent of folding, we compared the folding midpoints of the bimolecular and unimolecular Twister ribozymes at 20 °C using RNase footprinting. G21 and G35 are protected from cleavage by RNase T1 when the two pseudoknots become paired (Supplementary Figs. 2 and 3). Unexpectedly, both forms of the ribozyme required higher Mg2+ concentrations to fold than to self-cleave (Fig. 1f,h). The midpoint for protection of G21 in the bimolecular Twister with increasing MgCl2 concentration was 2.5 mM MgCl2 (Fig. 1f), 20 times higher than the midpoint for catalysis (0.135 mM MgCl2). For the unimolecular ribozyme, the midpoint for protection of G21 was ~1.8 mM (Fig. 1h), 27 times higher than the midpoint for catalysis (0.065 mM MgCl2).

Fig 3. Pseudoknot mutations impair folding.

Fig 3

(a) smFRET traces of WT, G21A, G36A and G35A-G36A Twister ribozymes at 50 mM MgCl2. Twister mutants visited the high FRET folded state infrequently. (b) FRET histograms as in Figure 2d.

RNA folding by ensemble FRET

To measure folding thermodynamics and kinetics more precisely, we labeled the minimal unimolecular form of Osa Twister ribozyme with Cy3 and Cy5 fluorophores, such that folding of the two pseudoknots increases the efficiency of fluorescence resonance energy transfer (FRET) from Cy3 to Cy5 (Fig. 2a). Cy3 was inserted before U15 at the top of helix P4 (Online Methods). The 3′ end of the ribozyme was extended with DNA, and annealed to a complementary Cy5-labeled DNA oligomer (Fig. 2a). The scissile uridine (U-1) was replaced with 2′ deoxyuridine to prevent self-cleavage. The relative extent of folding was calculated from the increase in the ensemble FRET efficiency with MgCl2 concentration, and fit to a cooperative two-state equilibrium model (Fig. 2b). The midpoint for folding was 10 mM MgCl2 at 30 ˚C (Fig. 2b) and 13 mM MgCl2 at 20 ˚C (Supplementary Fig. 4), five times higher than the midpoint obtained from RNase footprinting (1.8 mM MgCl2). The increase in FRET depended on proper folding of the ribozyme, because it was abolished by mutations that destabilize either pseudoknot (Fig. 2b).

Fig 2. Folding of Twister ribozyme in MgCl2.

Fig 2

(a) The FRET assay for folding. Cy5 is attached to a DNA strand hybridized to a 3′ extension of the ribozyme; Cy3 is attached to the phosphodiester backbone between G23 and U24. In the unfolded state, Cy3 and Cy5 dyes are far apart, resulting in low FRET (left). In the presence of Mg2+, pseudoknot formation brings Cy3 and Cy5 together, resulting in high FRET (right). Self-cleavage is prevented by a deoxyribose at the cleavage site. (b) Relative fraction of folded RNA (See Supplementary Table 2 for parameters and error analysis) as a function of MgCl2 concentration, from ensemble FRET at 30 ˚C (filled symbols; left axis) or smFRET at 20 ˚C (open symbols; right axis). (c) smFRET traces at different MgCl2 concentrations show fluctuations between the low-FRET unfolded state and high-FRET folded state. Blue, Cy3 intensity; red, Cy5 intensity; black, FRET efficiency. With increasing MgCl2, each molecule spends a longer time in the high FRET state. (d) FRET histograms of Twister ribozyme at various MgCl2 concentrations showing that total occupancy of the high-FRET state increases with MgCl2. The histograms were fit to a double Gaussian (black line).

We confirmed that the labeled unimolecular form of the ribozyme self-cleaves, although the reaction is slower and much less efficient than self-cleavage of the unlabeled unimolecular ribozyme (Supplementary Fig. 5). This is likely owing to destabilization of delicate interactions within the L4 loop, because the fluorophore attachment affects cleavage more than global folding. Consistent with this view, we found that the folding midpoints of dye-labeled cleavable (rU-1) and uncleavable (dU-1) bimolecular ribozymes were similar to each other (2.1 and 2.8 mM respectively; Supplementary Fig. 6) and similar to the folding midpoint of the unlabeled RNA (2.5 mM; Supplementary Fig. 3 and Table 2). This suggests that the longer P3 helix of the bimolecular ribozyme compensates for the destabilizing effect of the fluorophores on L4. We concluded that our FRET assay can be used to measure tertiary folding (but not activity) of the Twister ribozyme, after accounting for a 5-fold shift in the Mg2+-dependence of the folding transition.

RNA dynamics by single-molecule FRET

The observation that the Mg2+ midpoints for folding were higher than those for activity conflicts with the usual assumption that RNA must stably fold into its correct tertiary conformation to attain its maximum catalytic activity. To understand the folding dynamics of Twister ribozyme and to determine whether it transiently adopts its tertiary structure in micromolar Mg2+, we used total internal reflection fluorescence (TIRF) microscopy to follow the folding of single RNAs through smFRET19. For smFRET studies, we used the same dye-labeled Twister ribozyme that we used for ensemble FRET, except that the RNA was immobilized on a quartz slide via a biotinylated DNA oligomer. The FRET efficiency (EFRET) was calculated from the Cy3 and Cy5 intensities after background subtraction and leakage correction20.

As the MgCl2 concentration in the smFRET experiment was increased, Twister ribozymes spent more time in the folded state, on average, as expected (Fig. 2c). In 0.5 mM MgCl2, the ribozyme was mostly in a low FRET (EFRET ~ 0.2) state that corresponds to the unfolded conformation (Fig. 2c, top). Occasionally, the ribozyme sampled the high FRET (EFRET ~ 0.8) state corresponding to the folded conformation, remaining there for 1–2 seconds before returning to the unfolded state. With increasing MgCl2 concentration, Twister sampled the high FRET state more frequently and for longer periods, approaching an equilibrium of equal probability in low and high FRET states at 15 mM MgCl2. Surprisingly, even at 100 mM MgCl2, which is many times higher than physiological concentrations, the ribozyme continued to sample the low FRET state (Fig. 2c, bottom), indicating that the minimal structure of the Osa Twister ribozyme is highly dynamic.

Histograms of EFRET values were constructed from trajectories for > 200 molecules for each condition, revealing well-separated peaks in the distribution at high and low FRET efficiencies (Fig. 2d). We calculated the absolute fraction of folded ribozyme by dividing the area of the high FRET population by the total area of the histograms. The Mg2+ midpoint of folding from smFRET experiments was 15 mM, very similar to that obtained from ensemble FRET measurements (Fig. 2b).

Since tertiary interactions within the L4 loop are important for the stability of the folded ribozyme, we also carried out smFRET experiments with a cleavable (rU-1) unimolecular ribozyme and the non-cleavable bimolecular (dU-1) ribozyme (Supplementary Fig. 7). These RNAs exhibited comparable dynamics and distributions between folded and unfolded states, indicating that the scissile ribose and the extended P3 helix have little effect on global folding of the Twister ribozyme. All of the ribozyme forms tested occupied the folded state only transiently in 0.5 mM MgCl2, although the ribozyme is fully active under comparable conditions (0.1 mM MgCl2, after accounting for a fivefold shift in the folding midpoint).

It has been shown previously that crowded environments stabilize folded RNA structures21,22,23. When we performed smFRET experiments in the presence of molecular crowders such as PEG, the folded, high-FRET population increased from 44% in dilute solution containing 20 mM MgCl2 to 65% and 70% in the presence of 10% PEG1000 and PEG8000, respectively (Supplementary Fig. 8). Yet, even in crowded solutions comparable to those in the cell, folded Osa Twister is marginally stable in 20 mM MgCl2.

Mutations inhibit folding and self-cleaving activity

We next asked whether both pseudoknots are needed to form the high FRET conformation and whether they are necessary for self-cleavage. Twister variants containing single mismatches in pseudoknot 1 (G21A) or pseudoknot 2 (G36A) folded less than 20% even at 100 mM MgCl2 (Fig. 2b). We also carried out smFRET folding experiments on the mutant Twister ribozymes. At 10 or 20 mM MgCl2, we observed no transitions to the high FRET state. At 50 mM MgCl2, when WT Twister is in the high FRET state most of the time, the single and double mutants only occasionally visited the high FRET state (Fig. 3a). The folded population of the Twister mutants at 50 mM MgCl2 (Fig. 3b) was comparable to that of the WT ribozyme at 2 mM MgCl2 (Fig. 2d). Although the WT Twister ribozyme self-cleaved efficiently at 2 mM MgCl2, we observed only 3% product for the G21A and no product for the G35A-G36A mutants at 50 mM MgCl2 (Supplementary Fig. 9). We obtained similar results when transcribing the WT and Twister mutants in vitro (Supplementary Fig. 9d). Thus, even when the mutants transiently adopt the high FRET conformation in high Mg2+, this structure is insufficient for catalysis.

Mg2+ ion dependence of the folding kinetics

To better understand how the dynamic tertiary structure of Twister supports rapid self-cleavage, we quantified the lifetimes of the unfolded and folded states at equilibrium by applying Hidden Markov Model analysis to selected trajectories (Fig. 4a). The probabilities of transitions from one state to the other yield rate constants for folding and unfolding, kF and kU. Both of these rate constants depended on Mg2+ concentration (Fig. 4b), with the folding rate increasing nine times between 0.5 mM and 100 mM MgCl2. The slope nF = ∂log(kfold)/∂log[Mg2+] can be interpreted as an average uptake of 0.44 Mg2+ ions per RNA molecule upon conversion of the unfolded RNA to the folding transition state24. A similar analysis of unfolding rate constants suggests a loss of nU = 0.86 Mg2+ ions during conversion of the folded state to the transition state (Supplementary Fig. 10). The calculated Hill co-efficient n = nU + nF = 1.3 exactly matched the Hill co-efficient n = 1.3 obtained from the ensemble FRET measurements (Fig. 2b), consistent with an approximate two-state folding behavior. The parameter β = n/n provides a measure of the position of the transition state25 and has been applied in protein folding26,27. For the Twister ribozyme, βF = 0.37 and βU = 0.72, suggesting that the transition state ensemble (TSE) for tertiary folding lies somewhat closer to the unfolded state than to the folded state25 (Supplementary Fig. 10). The folding kinetics of the Twister ribozyme is remarkably similar to the docking and undocking rates of the two-way junction hairpin ribozyme at different MgCl2 concentrations in 0.5 M NaCl24, despite their very different tertiary structures. In both RNAs, Mg2+ ions only partially stabilize the TSE, which presumably is reached soon after the RNA helices begin to interact. A partially expanded TSE was observed for refolding of the much larger (398 nt) Tetrahymena ribozyme in Mg2+ and spermidine (βF ≈ 0.15)28. By contrast, for the hairpin ribozyme in low salt, and for many small proteins, the TSE lies closer to the native state29.

Fig 4. Kinetics of RNA folding.

Fig 4

(a) A representative experimental FRET trace (black) with idealized FRET trace (red) generated by the HaMMy algorithm. (b) Relaxation rate constants for folding (black) and unfolding (red) versus Mg2+ ion concentration at room temperature. The rate constants were fit to a binding model with Mg2+ midpoints of saturation 21 (±9) mM and <1 (±0.1) mM for kF and kU, respectively. (c) Schematic of the single-molecule folding kinetics experiment. Imaging buffer plus 10 mM MgCl2 and 5 nM Cy3 dye was added to the slide chamber containing immobilized Cy3-Twister•Cy5-SA5 complexes while recording continuously. The increase in background from free Cy3 marked the diffusion of Mg2+-containing buffer. (d) Probability density maps of synchronized Twister FRET dynamics. The red dotted line indicates the moment Mg2+ ions interacted with the Twister complex. Before the addition of Mg2+, all the molecules were in the 0.2 FRET state. After interacting with Mg2+, molecules start fluctuating between the 0.2 and 0.8 FRET states before reaching equilibrium after 5 s.

Kinetics of Twister RNA folding

The Hidden Markov analysis of the steady-state FRET traces is useful for understanding the equilibrium dynamics of the folded RNA, but lacks information about the initial folding events. Therefore, we also measured the initial folding kinetics by injecting MgCl2 into slide chambers during single-molecule experiments. We immobilized Twister RNA to the quartz slide in imaging buffer lacking Mg2+, then flowed in imaging buffer containing 10 mM MgCl2 (Fig. 4c) while continuously recording the Cy3 and Cy5 intensity. Free Cy3 fluorophores were included in the injected buffer to track the arrival of MgCl2. A two-dimensional FRET histogram aligned to the moment of Mg2+ addition showed that the molecules start to move from the low-FRET state to the high-FRET state soon after they interact with Mg2+ ions (Fig. 4d). After 10 s, the molecules steadily fluctuated between high-FRET and low-FRET states as observed in our equilibrium smFRET experiments. The average increase in the population of the high FRET state after the addition of MgCl2 corresponded to kobs = 0.2 s−1 (Supplementary Fig. 11), in good agreement with kobs = kF + kU = 0.15 s−1 at 10 mM MgCl2 calculated from the Hidden Markov analysis. This result indicates that the first folding event is similar to subsequent folding events.

Effects of divalent salts on folding and catalysis

We compared the catalytic activity and folding of the Twister ribozyme in the presence of different divalent chloride salts. Surprisingly, the midpoints for the extent of self-cleavage in the presence of MnCl2 and ZnCl2 were 56 μM and 51 μM, respectively, lower than the midpoint for self-cleavage in the presence of MgCl2 (135 μM) (Fig. 5a). The greater effectiveness of Mn2+ and Zn2+ was likely due to better folding of the Twister ribozyme in the presence of transition metal ions, as the midpoints for ensemble folding were 1.7 mM Mn2+ and 1.4 mM Zn2+, respectively, much lower than the midpoint for folding in Mg2+ (10 mM) (Fig. 5b). By contrast, cationic radius seemed unimportant, because the fraction of folded RNA increased similarly with the concentration of larger Ca2+ and Ba2+ ions as with Mg2+ ions (Fig. 5b and Supplementary Table 2).

Fig 5. Twister is efficiently activated by transition metal ions.

Fig 5

(a) Twister ribozyme activity after 1 min in MgCl2, MnCl2, and ZnCl2 as in Figure 1d. The midpoints of catalysis for MgCl2, MnCl2, and ZnCl2 were 135 (± 12) μM, 59 (± 5) μM and 51 (± 6) μM, respectively. Values are the mean and s.d. of 2–4 independent trials. (b) Folding in the presence of the divalent ions shown in the key by ensemble FRET at 30 ˚C. The fraction folded was fit to a two-state model as shown in Figure 2b. The folding midpoints were 10 (± 1) mM MgCl2, 1.7 (± 0.4) mM MnCl2 and 1.4 (± 0.3) mM ZnCl2 (± s.d.; n = 2). (c) smFRET traces and (d) FRET histograms at 2 mM MgCl2, 2 mM MnCl2 and 2 mM ZnCl2. Colors are as in Figure 2c. The high-FRET population follows the trend Mg2+ < Mn2+ < Zn2+, suggesting that Twister folds more efficiently in the presence of transition metal ions. (e) Co-ordination of a hydrated Mg2+ ion between U-1, A34 and G35. Transition metal ions are expected to directly coordinate G N7 and interact with the phosphophodiester indirectly through a water molecule. (f) Midpoints of self-cleavage in the presence of different divalent salts were determined as described in a and summarized as a horizontal bar graph. Error bars are s.d. of 2–3 independent trials.

We also compared the folding behavior of single Twister ribozymes at 2 mM MgCl2, MnCl2 or ZnCl2 using single-molecule FRET (Fig. 5c). The frequency of transitions to the folded state was similar in the presence of each cation, but the lifetime of the folded state was shorter in Mg2+ than in Mn2+ or Zn2+ ions, resulting in a higher population of folded RNA in Mn2+ or Zn2+ (Fig. 5d). These data clearly suggest that at 2 mM concentration, Mn2+ or Zn2+ ions stabilize the folded state better than Mg2+ ions.

Finally, we asked how efficiently different metal ions activate Twister self-cleavage, including the transition metal ions Mn2+, Fe2+, Co2+, Ni2+ and Zn2+. In all cases, lower amounts of transition metal ions than alkaline earth metal ions were needed to support Twister activity. Ni2+ was most effective among the metal ions tested, with 12 μM NiCl2 sufficient for half-maximal activity (Fig. 5e). In general, the concentration needed to reach half-maximal activity approximately correlated with the expected bond strength of the transition metal ions tested30. As discussed below, this unusual preference for transition metals suggests that the Twister ribozyme may respond to the presence of such ions in rice and other organisms.

DISCUSSION

Although Mg2+ ions stabilize the folded states of RNA, many ribozymes require high Mg2+ ion concentrations for their activity3. Metal ion binding within the RNA active site often requires an energetically unfavorable reorganization of the RNA conformation, partial dehydration of the metal ion, or both31,32. Mg2+ ions directly coordinate the scissile phosphodiester, orient bases for proton transfer while compensating for the accumulation of negative charge in the transition state for self-cleavage, or simply stabilize tertiary interactions within the active site, which are often weaker than those in the periphery of the folded RNA33. Remarkably, Twister was reported to show almost no selectivity for Mg2+ ions during self-cleavage2, consistent with an absence of ordered active site metal ions in several crystal structures7,34, although there is evidence that a Mg2+ ion coordinates the non-bridging phosphate oxygens at the cleavage site in the env22 Twister ribozyme8.

Our results support the idea that metal ions mainly act by stabilizing the functional structure of the Twister ribozyme, because metal ions that activate the ribozyme at low metal ion concentrations also stabilize the folded RNA more efficiently than Mg2+. For the metal ions for which we can directly compare folding and self-cleavage rates, the ribozyme activity increases proportionally less than the stability of the folded RNA, suggesting that transition metal ions interact with the folded ribozyme slightly differently than Mg2+ ions (Fig. 5). Achieving a compact, high FRET state is not sufficient for catalysis, as we are unable to detect cleaved products of the G47A-G48A mutant (Supplementary Fig. 9), although this RNA measurably populates the high FRET state (Fig. 3b). This is consistent with the idea that reorganization of the active site pocket is needed after both pseudoknots base pair35.

It is remarkable that only transient folding is sufficient for Osa Twister catalysis, indicating that reorganization of the catalytic core must occur rapidly after the initial folding step. This is somewhat different from the heterogeneous folding kinetics of env22 Twister.13 Extrapolating our measured folding rates (Fig. 4b) to 50 μM MgCl2, we obtain a time constant for folding τF = 170 s, only slightly shorter than the time constant for self-cleavage of the biomolecular form of the ribozyme (τcleave = 250 s). A similar logic applied to our self-cleavage and folding rates in 0.5 mM MgCl2, assuming a five- to tenfold destabilization of the folded RNA by our FRET labels (τcleave = 7 s ≤ τF ≈ 17 s), suggests that every folding event results in self-cleavage, on average.

Although Mg2+ ions usually promote RNA folding and catalysis in the cell, the recent discoveries of riboswitches that recognize Ni2+, Co2+ and Mn2+ demonstrate that transition metals can be selectively recognized by non-coding RNAs36. No natural ribozymes are known to preferentially use transition metals over Mg2+, but the minimal hammerhead ribozyme self-cleaves in the presence of divalent ions such as Mn2+, Co2+, Sr2+ and Ba2+ (ref. 37), and the in vitro selected lead ribozyme self-cleaves in transition metals when supplemented with Mg2+ (ref. 38). Unlike these examples, Osa Twister folds and reacts in 10–100 μM transition metal ions, concentrations comparable to the binding constants of the Ni, Co and Mn riboswitches4,5. Our analysis of Twister self-cleavage does not account for oxidation of the metal ion or interactions with the Cl anion, and may underestimate the efficiency of transition metal ion activation.

These results raise the interesting question of whether transition metals specifically stabilize the active conformation of Twister ribozyme. Surveys of known nucleic acid structures confirm that transition metal ions preferentially coordinate the N7 of purines39,40. In the metal-sensing riboswitches, the Mn2+ or Co2+ ions bridge N7 atoms of conserved purines while coordinating nearby phosphodiesters, usually through hydrogen bonds with metal-bound water molecules. These metal ion interactions pinch together helices in different parts of the riboswitch, and serve as part of the switch mechanism. In crystallographic structures of Osa and env22 Twister ribozymes, hydrated Mg2+ ions occupy a pocket adjacent to the scissile phosphodiester, the major groove of pseudoknot 2, and the linker between P4 and pseudoknot 17,8. In the Osa ribozyme, these grooves are lined with G N7 atoms that face inward toward phosphate groups on either side of the cleavage site (Fig. 5d), offering a plausible explanation for strong transition metal binding to the Osa Twister RNA.

The function of the Twister ribozyme in the host organism O. sativa is not known. Rice seedlings rapidly take up Mg2+ from the root tips, and Mg2+ deficiency causes leaf yellowing and other growth defects41. Rice also concentrates certain transition metals in its tissue, some of which are essential micronutrients42,43. Our results show that transient folding in micromolar metal ion is sufficient for robust activity. Its preference for transition metal ions and small size make Twister a potentially attractive starting point for engineered ribozymes that respond to rare or toxic metals in rice and other organisms.

METHODS

Methods and any associated references are available in the online version of the paper.

ONLINE METHODS

RNA preparation

The Twister ribozyme variants used in this study were based on 54 nt long Osa 1-4 sequence from O. sativa7. Activity assays were performed using a two-stranded form of the ribozyme with an extended P3 helix as previously described2. The substrate RNA containing the cleavage site, Ost-S: 5′ rCCGCCUAACUCCGCCUAUGUCAU 3′ was purchased from IDT, USA and purified by 20% PAGE. The ribozyme strand Ost-Ri: 5′ rGGAUGAUAUAGCCGGUCCCAAGCCCGGAAAAGGAGGAGGGGGCGG 3′ was transcribed in vitro using a double-stranded template DNA (Invitrogen) and gel purified before use.

For fluorescence folding experiments, a unimolecular variant of Osa Twister with a short P3 helix was prepared by splint ligation of two fragments with T4 RNA ligase I as described in Solomatin and Herschlag44. Synthetic RNA fragments were purchased from IDT in a reverse phase HPLC purified form. The 5′ fragment, 5′ rCCGCCdUrAACACUGCCAAUGCCGG-(Cy3)-UCCCA 3′, contains Cy3 inserted in the backbone of the RNA between G14 and U15 (Int Cy3; IDT). To prevent phosphodiester bond cleavage, U6 was replaced with dU. The 3′ fragment was extended with deoxyribonucleotides to hybridize with an Cy5-labeled anchor DNA: 5′ r(AGCCCGGAUAAAAGUGGAGGGGGCGG) d(AGGACGACACACTTTGGACAGGACACACAGGACACAGG) 3′. The ligated product (OstS5-Cy3) was separated from the reactants by 20% PAGE and then extensively exchanged with 1X HK buffer (30 mM K-HEPES, pH 7.5; 100 mM KCl). Anchor DNA oligomers were purchased from IDT: (SA5-Cy5: 5′ dCCTGTGTCCTGTGTGTCCTGTCCAAAGTGTGTCGTCC-(Cy5) 3′; SA5-BHQ2: 5′dCCTGTGTCCTGTGTGTCCTGTCCAAAGTGTGTCGTCC-(BHQ2) 3′ and Bio-SA5-Cy5: 5′ (Biotin)-dCCTGTGTCCTGTGTGTCCTGTCCAAAGTGTGTCGTCC-(Cy5) 3′.

Ribozyme activity assays

Self-cleavage assays for the bimolecular form of the ribozyme were performed as previously described2. 5 nM 5′-[32P] labeled substrate strand (Ost-S) and 100 nM ribozyme strand (Ost-Ri) in 1 X HK buffer (8 μL) were heated to 75 °C for 5 min and slowly cooled to room temperature (20 °C). To start the reaction, 2 μl divalent salts from 5X stocks in deionized water of different concentrations were added and incubated at room temperature for a specific time period mentioned in the figure legends of individual experiments. An equal volume of stop solution (90% formamide, 50 mM EDTA, 0.05% xylene cyanol and 0.05% bromophenol blue) was added to terminate the reaction. The products were separated from the substrate RNA by denaturing 16% PAGE and quantified using a Storm phosphorimager (GE Healthcare). All the divalent metal chloride salts were purchased from Sigma-Aldrich (USA). Stock solutions of the salts were made in deionized (18 MOhm) water and filtered through a 0.22 μm membrane before storing at 4 °C. Solutions of transition metal salts, especially FeCl2, CoCl2, NiCl2 and CdCl2, were prepared with degassed water and used immediately.

For the activity assay using the chemically synthesized (IDT) unimolecular form of the ribozyme, 1 μM unlabeled full length Osa-Twister RNA in 1X HK buffer (8 μL) were heated to 75 °C for 5 min and cooled to room temperature (20 °C). The reactions were started with 2 μl MgCl2 from 5X stocks and stopped after 1 min at room temperature as described before. The products were separated from the full length RNA by denaturing 16% PAGE, stained with SYTO RNASelect (ThermoFisher) and quantified using a Typhoon 9410 scanner (GE Healthcare).

For co-transcriptional self cleaving assays, T7 transcription reactions were carried out in vitro with WT or mutated DNA templates for the Osa 1-4 Twister ribozyme for 30 min at 37 °C. 40 μL transcription reactions contained 4 μL 10X T7 transcription buffer, 4 μL 10X low ATP NTPs (1.25 mM ATP, 5 mM CTP, 5 mM GTP and 5 mM UTP), 0.5 μg DNA template, 20 μCi α-[32P] ATP, 1 μL T7 polymerase. The transcribed RNAs were passed through TE30 Chroma spin columns (Clontech, USA), and the full length RNA (54 nt) and 3′ product (3′P: 48 nt) were separated using 16% PAGE.

RNase T1 footprinting

A mixture of 100 nM 5′-[32P]-labeled Osa-Twister dU6 RNA (single chain) and 1 μM unlabeled Osa-Twister dU6 RNA in 8 μL 1X HK buffer were incubated at 75 °C for 5 min, followed by 37 °C for 15 min and room temperature for 5 min. 2 μL MgCl2 solutions from 5X stocks were added to the mixture and incubated an additional 5 min at room temperature. RNase T1 was added at a final concentration of 0.02 U/μl and incubated 5 min at room temperature. Reactions were quenched with an equal volume of formamide loading dye and immediately loaded on a 16% sequencing gel.

Ensemble FRET

To measure the extent of folding by FRET, 20 nM OstS5-Cy3 was annealed with 40 nM SA5-Cy5 DNA in 400 μl of 1 X HK buffer by incubating the mixture at 75 °C for 5 min, 37 °C for 15 min and finally equilibrated at 30 °C for 5 min. The fluorescence emission of Cy3 and Cy5 were measured in a Fluorolog 3 (Horiba) spectrofluorometer by exciting the samples at 540 nm and measuring the emissions at 565 nm and 663 nm respectively. Ribozyme samples were titrated with salt stock solutions and incubated for 2 min at 30 °C between measurements. FRET efficiencies were calculated from EFRET = I663/(I565 + I663). Fractional folding, fF, at different divalent salt concentrations was fit to the Hill equation,

fF=(EiE0)/(EαE0)=[M2+]n/(Kn+[M2+]n)

in which E0 is the FRET efficiency in 1X HK, Eα is the maximum FRET efficiency in saturating salt, [M2+] is the divalent salt concentration, K is the folding midpoint and n is the Hill coefficient, which is a measure of the gradient of the equilibrium ∂lnK/∂ln[M2+].

Single-molecule FRET measurements

For single-molecule experiments, 20 nM OstS5-Cy3 and 40 nM Bio-SA5-Cy5 DNA in 10 μL 1X HK were annealed as described above and equilibrated at RT for 5 min. Samples were diluted 400 times in the imaging buffer (IB: 30 mM HEPES, pH 7.5; 100 mM KCl; 0.8% glucose and 4 mM Trolox) and immobilized on quartz slides coated with DDS and pre-treated with biotinylated BSA, Tween 20 and Neutravidin45. Imaging buffer containing the specified concentration of divalent salt, 0.1 mg/ml glucose oxidase (Sigma) and 0.02  mg/ml catalase (Sigma) were flowed in to the slide chambers before imaging. smFRET traces were recorded using a home-built TIRF microscope with an EMCCD camera (Andor), as described previously20,46. The time resolution of each movie was 0.1 s / frame if not stated otherwise, and ten frames of Cy5 excitation were used at the beginning and end of each recorded movie to verify the presence of FRET acceptors in each molecule selected for analysis.

Single-molecule data analysis

Molecules were picked and trajectories for individual molecules were extracted from movies using a custom IDL code as described previously45. Only trajectories containing both the FRET donor and acceptor were selected for further analysis. We calculated the FRET efficiency with leakage correction: EFRET = (IALf*ID)/[ID + (IALf*ID)], in which ID and IA are the fluorescence intensities of the donor (Cy3) and the acceptor (Cy5) respectively and Lf is the leakage factor for the TIRF microscope. Histograms of FRET efficiency at different divalent salt concentrations were built using more than 200 molecules apiece. Individual trajectories were weighted so that each molecule contributed equally to the histogram regardless of the length of its trajectory before photobleaching. To build the histogram, 1) we built a histogram for each individual trajectory, with each frame of that trajectory as one data point; 2) we normalized each individual histogram so that each has a total area of 1; 3) we added all individual histograms together to get an overall histogram; 4) we divided the overall histogram by a factor equal to the total number of trajectories used and the frequencies were labeled as “relative counts” in the y- axes. FRET histograms were fitted to a double Gaussian using Origin (OriginLab), and the absolute fractional folding calculated from AhF/(AlF+AhF), where AlF and AhF are the areas under the low FRET and high FRET peaks, respectively. HaMMy was used to calculate the transition rates between folded and unfolded states47. All custom software and codes mentioned above are available upon request. For flow-in experiments, 5 nM Cy3 was co-injected with the imaging buffer containing 10 mM MgCl2 while recording continuously with a time resolution of 30 ms. 100 selected trajectories were aligned based on the time when MgCl2 reached the molecule, as determined by a small rise in the Cy3 background. The 2D histogram was generated using Origin.

Supplementary Material

1
2

Acknowledgments

The authors thank K. Sarkar and S. Abeysirigunawardena for their assistance and M. Greenberg, K. Karlin and J. Morrow for helpful discussion.

This work was supported by a grant from the NSF [MCB-1616081 to S.W.] and the NIH [GM 065367 to T.H.].

Footnotes

Author contributions

S.P., T.H. and S.W. designed the experiments; S.P. and B.H. performed the single-molecule experiments and analyzed the data; S.P. and D.Z. performed activity assays; S.P. performed other experiments; S.P, T.H. and S.W. wrote the manuscript; and all of the authors interpreted the data and reviewed the text and figures.

Competing financial interests

The authors declare no competing financial interests.

Data Availability

All data including single molecule trajectories are available from the authors upon request to S. Panja (corresponding author) or to swoodson@jhu.edu.

Code Availability

All custom software and codes mentioned above are available upon request to tjha@jhu.edu.

References

  • 1.Jimenez RM, Polanco JA, Luptak A. Chemistry and Biology of Self-Cleaving Ribozymes. Trends Biochem Sci. 2015;40:648–661. doi: 10.1016/j.tibs.2015.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Roth A, et al. A widespread self-cleaving ribozyme class is revealed by bioinformatics. Nat Chem Biol. 2014;10:56–60. doi: 10.1038/nchembio.1386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Weinberg Z, et al. New classes of self-cleaving ribozymes revealed by comparative genomics analysis. Nat Chem Biol. 2015;11:606–610. doi: 10.1038/nchembio.1846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Furukawa K, et al. Bacterial riboswitches cooperatively bind Ni(2+) or Co(2+) ions and control expression of heavy metal transporters. Mol Cell. 2015;57:1088–1098. doi: 10.1016/j.molcel.2015.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Price IR, Gaballa A, Ding F, Helmann JD, Ke A. Mn(2+)-sensing mechanisms of yybP-ykoY orphan riboswitches. Mol Cell. 2015;57:1110–1123. doi: 10.1016/j.molcel.2015.02.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.DeRose VJ. Metal ion binding to catalytic RNA molecules. Curr Opin Struct Biol. 2003;13:317–324. doi: 10.1016/s0959-440x(03)00077-0. [DOI] [PubMed] [Google Scholar]
  • 7.Liu Y, Wilson TJ, McPhee SA, Lilley DM. Crystal structure and mechanistic investigation of the twister ribozyme. Nat Chem Biol. 2014;10:739–744. doi: 10.1038/nchembio.1587. [DOI] [PubMed] [Google Scholar]
  • 8.Ren A, et al. In-line alignment and Mg(2)(+) coordination at the cleavage site of the env22 twister ribozyme. Nat Commun. 2014;5:5534. doi: 10.1038/ncomms6534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wilson TJ, Liu Y, Domnick C, Kath-Schorr S, Lilley DM. The Novel Chemical Mechanism of the Twister Ribozyme. J Am Chem Soc. 2016;138:6151–6162. doi: 10.1021/jacs.5b11791. [DOI] [PubMed] [Google Scholar]
  • 10.Gaines CS, York DM. Ribozyme Catalysis with a Twist: Active State of the Twister Ribozyme in Solution Predicted from Molecular Simulation. J Am Chem Soc. 2016;138:3058–3065. doi: 10.1021/jacs.5b12061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhang S, et al. Role of the active site guanine in the glmS ribozyme self-cleavage mechanism: quantum mechanical/molecular mechanical free energy simulations. J Am Chem Soc. 2015;137:784–798. doi: 10.1021/ja510387y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gebetsberger J, Micura R. Unwinding the twister ribozyme: from structure to mechanism. Wiley Interdiscip Rev RNA. 2017;8 doi: 10.1002/wrna.1402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Vusurovic N, Altman RB, Terry DS, Micura R, Blanchard SC. Pseudoknot Formation Seeds the Twister Ribozyme Cleavage Reaction Coordinate. J Am Chem Soc. 2017;139:8186–8193. doi: 10.1021/jacs.7b01549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kosutic M, et al. A Mini-Twister Variant and Impact of Residues/Cations on the Phosphodiester Cleavage of this Ribozyme Class. Angew Chem Int Ed Engl. 2015;54:15128–15133. doi: 10.1002/anie.201506601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ucisik MN, Bevilacqua PC, Hammes-Schiffer S. Molecular Dynamics Study of Twister Ribozyme: Role of Mg(2+) Ions and the Hydrogen-Bonding Network in the Active Site. Biochemistry. 2016;55:3834–3846. doi: 10.1021/acs.biochem.6b00203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Alatossava T, Jutte H, Kuhn A, Kellenberger E. Manipulation of intracellular magnesium content in polymyxin B nonapeptide-sensitized Escherichia coli by ionophore A23187. J Bacteriol. 1985;162:413–419. doi: 10.1128/jb.162.1.413-419.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Froschauer EM, Kolisek M, Dieterich F, Schweigel M, Schweyen RJ. Fluorescence measurements of free [Mg2+] by use of mag-fura 2 in Salmonella enterica. FEMS Microbiol Lett. 2004;237:49–55. doi: 10.1016/j.femsle.2004.06.013. [DOI] [PubMed] [Google Scholar]
  • 18.Zhong W, Schobert C, Komor E. Transport of magnesium ions in the phloem of Ricinus communis L. seedlings. Planta. 1993;190:114–119. [Google Scholar]
  • 19.Ha T, et al. Probing the interaction between two single molecules: fluorescence resonance energy transfer between a single donor and a single acceptor. Proc Natl Acad Sci U S A. 1996;93:6264–6268. doi: 10.1073/pnas.93.13.6264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Roy R, Hohng S, Ha T. A practical guide to single-molecule FRET. Nat Methods. 2008;5:507–516. doi: 10.1038/nmeth.1208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kilburn D, Roh JH, Guo L, Briber RM, Woodson SA. Molecular crowding stabilizes folded RNA structure by the excluded volume effect. J Am Chem Soc. 2010;132:8690–8696. doi: 10.1021/ja101500g. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Paudel BP, Rueda D. Molecular crowding accelerates ribozyme docking and catalysis. J Am Chem Soc. 2014;136:16700–16703. doi: 10.1021/ja5073146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Dupuis NF, Holmstrom ED, Nesbitt DJ. Molecular-crowding effects on single-molecule RNA folding/unfolding thermodynamics and kinetics. Proc Natl Acad Sci U S A. 2014;111:8464–8469. doi: 10.1073/pnas.1316039111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bokinsky G, et al. Single-molecule transition-state analysis of RNA folding. Proc Natl Acad Sci U S A. 2003;100:9302–9307. doi: 10.1073/pnas.1133280100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Leffler JE. Parameters for the Description of Transition States. Science. 1953;117:340–341. doi: 10.1126/science.117.3039.340. [DOI] [PubMed] [Google Scholar]
  • 26.Tanford C. Protein denaturation. C. Theoretical models for the mechanism of denaturation. Adv Protein Chem. 1970;24:1–95. [PubMed] [Google Scholar]
  • 27.Jackson SE, Fersht AR. Folding of chymotrypsin inhibitor 2. 1. Evidence for a two-state transition. Biochemistry. 1991;30:10428–10435. doi: 10.1021/bi00107a010. [DOI] [PubMed] [Google Scholar]
  • 28.Koculi E, Thirumalai D, Woodson SA. Counterion charge density determines the position and plasticity of RNA folding transition states. J Mol Biol. 2006;359:446–454. doi: 10.1016/j.jmb.2006.03.031. [DOI] [PubMed] [Google Scholar]
  • 29.Sosnick TR. Kinetic barriers and the role of topology in protein and RNA folding. Protein Sci. 2008;17:1308–1318. doi: 10.1110/ps.036319.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Irving H, Willams RJP. Order of Stability of Metal Complexes. Nature. 1948;162:746–747. [Google Scholar]
  • 31.Woodson SA. Metal ions and RNA folding: a highly charged topic with a dynamic future. Curr Opin Chem Biol. 2005;9:104–109. doi: 10.1016/j.cbpa.2005.02.004. [DOI] [PubMed] [Google Scholar]
  • 32.Draper DE, Grilley D, Soto AM. Ions and RNA folding. Annu Rev Biophys Biomol Struct. 2005;34:221–243. doi: 10.1146/annurev.biophys.34.040204.144511. [DOI] [PubMed] [Google Scholar]
  • 33.Ward WL, Plakos K, DeRose VJ. Nucleic acid catalysis: metals, nucleobases, and other cofactors. Chem Rev. 2014;114:4318–4342. doi: 10.1021/cr400476k. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Eiler D, Wang J, Steitz TA. Structural basis for the fast self-cleavage reaction catalyzed by the twister ribozyme. Proc Natl Acad Sci U S A. 2014;111:13028–13033. doi: 10.1073/pnas.1414571111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kobori S, Yokobayashi Y. High-Throughput Mutational Analysis of a Twister Ribozyme. Angew Chem Int Ed Engl. 2016;55:10354–10357. doi: 10.1002/anie.201605470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Saunders AM, DeRose VJ. Beyond Mg2+: functional interactions between RNA and transition metals. Curr Opin Chem Biol. 2016;34:152–158. doi: 10.1016/j.cbpa.2016.07.017. [DOI] [PubMed] [Google Scholar]
  • 37.Dahm SC, Uhlenbeck OC. Role of divalent metal ions in the hammerhead RNA cleavage reaction. Biochemistry. 1991;30:9464–9469. doi: 10.1021/bi00103a011. [DOI] [PubMed] [Google Scholar]
  • 38.Pan T, Uhlenbeck OC. A small metalloribozyme with a two-step mechanism. Nature. 1992;358:560–563. doi: 10.1038/358560a0. [DOI] [PubMed] [Google Scholar]
  • 39.Leonarski F, D’Ascenzo L, Auffinger P. Binding of metals to purine N7 nitrogen atoms and implicationsfor nucleic acids: A CSD survey. Inorg Chim Acta. 2016;452:82–89. [Google Scholar]
  • 40.Sigel RK, Sigel H. A stability concept for metal ion coordination to single-stranded nucleic acids and affinities of individual sites. Acc Chem Res. 2010;43:974–984. doi: 10.1021/ar900197y. [DOI] [PubMed] [Google Scholar]
  • 41.Kobayashi NI, Tanoi K. Critical Issues in the Study of Magnesium Transport Systems and Magnesium Deficiency Symptoms in Plants. Int J Mol Sci. 2015;16:23076–23093. doi: 10.3390/ijms160923076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Yoneyama T, Ishikawa S, Fujimaki S. Route and Regulation of Zinc, Cadmium, and Iron Transport in Rice Plants (Oryza sativa L.) during Vegetative Growth and Grain Filling: Metal Transporters, Metal Speciation, Grain Cd Reduction and Zn and Fe Biofortification. Int J Mol Sci. 2015;16:19111–19129. doi: 10.3390/ijms160819111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Takahashi R, Bashir K, Ishimaru Y, Nishizawa NK, Nakanishi H. The role of heavy-metal ATPases, HMAs, in zinc and cadmium transport in rice. Plant Signal Behav. 2012;7:1605–1607. doi: 10.4161/psb.22454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Solomatin S, Herschlag D. Methods of site-specific labeling of RNA with fluorescent dyes. Methods Enzymol. 2009;469:47–68. doi: 10.1016/S0076-6879(09)69003-0. [DOI] [PubMed] [Google Scholar]
  • 45.Hua B, et al. An improved surface passivation method for single-molecule studies. Nat Methods. 2014;11:1233–1236. doi: 10.1038/nmeth.3143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Kim H, et al. Protein-guided RNA dynamics during early ribosome assembly. Nature. 2014;506:334–338. doi: 10.1038/nature13039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.McKinney SA, Joo C, Ha T. Analysis of single-molecule FRET trajectories using hidden Markov modeling. Biophys J. 2006;91:1941–1951. doi: 10.1529/biophysj.106.082487. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

RESOURCES