Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2017 Sep 20;85(10):e00438-17. doi: 10.1128/IAI.00438-17

Interleukin-17A Aggravates Middle Ear Injury Induced by Streptococcus pneumoniae through the p38 Mitogen-Activated Protein Kinase Signaling Pathway

Wei Wang a,b, Wenbin Liu c, Jiali Liu c, Zimeng Wang a, Fangmei Fan a, Yurong Ma a, Chunfang Jin a, Yun Xiang a, Yifei Huang a, Xuemei Zhang a, Wenchun Xu a, Yibing Yin a, Yujuan He a,
Editor: Liise-anne Pirofskid
PMCID: PMC5607404  PMID: 28739823

ABSTRACT

Acute otitis media (AOM) is one of the most common bacterial infectious diseases in children aged 2 to 7 years worldwide. We previously demonstrated that interleukin-17A (IL-17A) promotes an acute inflammatory response characterized by the influx of neutrophils into the middle ear cavity during Streptococcus pneumoniae-induced AOM. In general, the inflammatory response is viewed as an effector that frequently causes local tissue damage. However, little is known about the pathogenic effects of IL-17A in AOM. Here, we investigated the pathogenic effects of IL-17A by using wild-type (WT) and IL-17A knockout (KO) mouse models. The results showed that the pathogenic effects of AOM, including weight loss, histopathological changes, and proinflammatory cytokine production, were more severe in WT mice than in IL-17A KO mice, suggesting that IL-17A aggravates tissue damage in AOM. Furthermore, these pathogenic effects were found to be dependent on p38 mitogen-activated protein kinase (MAPK) and could be reversed in the presence of a p38 MAPK-specific inhibitor. It was also demonstrated that IL-17A promoted the production of neutrophil myeloperoxidase (MPO) through the p38 MAPK signaling pathway, which was responsible for the middle ear tissue injury. These data support the conclusion that IL-17A contributes to middle ear injury through the p38 MAPK signaling pathway.

KEYWORDS: acute otitis media, IL-17A, injury, MPO, neutrophils

INTRODUCTION

Acute otitis media (AOM) is one of the most common infectious diseases in the pediatric population (1). According to data from the United States, about 50% to 85% of children have suffered from at least one episode of AOM by the age of 3 years (2). The annual cost for the diagnosis and treatment of AOM approaches $3 billion in the United States alone (3). A lack of timely and effective treatment for AOM often leads to some serious complications, such as permanent hearing loss and meningitis (3, 4). Pathogenic bacteria exist in up to 70% of middle ear fluid specimens from patients with AOM, and 50% of the bacterial cases are induced by Streptococcus pneumoniae. Other common pathogens include nontypeable Haemophilus influenzae and Moraxella catarrhalis (57). As a result, the clinical management of AOM relies heavily on antibiotic therapies (4), which may promote the emergence of antibiotic-resistant strains of bacteria (810) and cause prolonged and repeated cases of otitis media. Therefore, new insight into the molecular mechanisms for this highly prevalent disease is urgently needed to define novel therapeutic targets.

In infectious diseases, pathogens are recognized and destroyed within hours after entering the host by the acute inflammatory response, known as host resistance (11, 12). Recently, investigations have shown that the immune responses triggered by pathogens not only fight against pathogen invasion but also cause collateral damage to host tissues (1315), which could lead to more severe consequences. In the sepsis model, an early intense proinflammatory response after infection can cause harm or prompt subsequent organ damage (16). In the lipopolysaccharide (LPS)-induced acute lung injury model, activated macrophages and lung epithelial cells reportedly release proinflammatory cytokines and chemokines, aggravating the progression of acute lung injury (17). Given these findings, a new therapeutic strategy could be to limit tissue damage by alleviating the inflammatory response (18).

Interleukin-17A (IL-17A), the first identified member of the IL-17 family, has been confirmed to be produced by Th17 cells, CD8+ T cells, natural killer (NK) cells, neutrophils, epithelial cells, and innate lymphoid cells (ILCs) (19, 20). It is widely believed to play an essential role in host defense against extracellular bacteria and fungi, particularly at mucosal sites (21, 22). Our previous study also demonstrated that a high level of IL-17A is detected in the middle ear cavity (MEC) during AOM in a mouse model and IL-17A promotes an acute inflammatory response, characterized by the influx of neutrophils into the MEC (23). However, IL-17A also induces pathogenic injury effects in some infectious diseases, such as severe sepsis, acute lung injury, and acute kidney injury (2426). Recent research shows that neutralization of peritoneal IL-17A can significantly improve the survival rate of mice with severe sepsis (25). In clinical practice, monoclonal antibodies targeting IL-17A are being employed for treating rheumatological and dermatological diseases (27). Given this evidence, we hypothesized that an increased IL-17A concentration in the MEC not only triggers a robust inflammatory response but also leads to middle ear injury during AOM. We compared the pathogenic effects in a mouse model of AOM by deleting and restoring IL-17A and then analyzed the underlying pathogenic mechanism of IL-17A in middle ear injury.

In this study, we illustrate that pathological manifestations were more severe in wild-type (WT) mice than in IL-17A knockout (KO) mice and that after administration of exogenous recombinant murine IL-17A (rmIL-17A) to IL-17A KO more pathological findings were observed in IL-17A KO mice that WT mice. In addition, we demonstrate that IL-17A aggravated middle ear injury by promoting the production of myeloperoxidase (MPO) through the p38 mitogen-activated protein kinase (MAPK) signaling pathway.

RESULTS

Inflammation characteristics in murine model of AOM.

Weight change is regarded as a clinical indicator of the general health of a host during infection. In our experiment, significant weight loss was observed in mice with AOM (Fig. 1A). In addition, we also observed more noticeable mucosal hyperplasia and epithelial shedding in the middle ears of the infected mice than the control mice (Fig. 1B and C). Moreover, the middle ear lavage fluid (MELF) of infected mice contained significantly higher levels of multiple cytokines, such as tumor necrosis factor alpha (TNF-α), IL-6, and IL-1β, which are generally considered representative proinflammatory mediators in various infectious diseases (26, 28), than the control mice (Fig. 2A to C). The levels of IL-6 and IL-1β both peaked at day 1 postchallenge and gradually declined thereafter, while the level of TNF-α remained high until day 3. As shown in our previous study, more than 98% of the effector cells recruited into the MEC were neutrophils (23). Our results showed that the expression of chemokine CXCL1 and CXCL2 mRNA increased in the middle ear epithelium and peaked at different time points during AOM (Fig. 2D and E).

FIG 1.

FIG 1

S. pneumoniae induces middle ear injury during AOM. (A) Weight loss was determined daily following the direct bilateral transtympanic inoculation of S. pneumoniae and is displayed relative to the initial weight. Mock infection consisted of PBS treatment of the middle ear. Values represent means ± SDs (n = 6). P values are for the differences between two groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001. (B) Middle ear mucosal thickness was determined by NIS-Elements BR (version 4.10.00) software at 1 day, 3 days, 5 days, and 7 days following the direct bilateral transtympanic inoculation of S. pneumoniae. Mock infection consisted of PBS treatment of the middle ear. Values represent means ± SDs (n = 6). P values are for the differences between two groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001. (C) Sections of middle ear tissue were stained with H&E at 1 day, 3 days, 5 days, and 7 days following direct bilateral transtympanic inoculation of S. pneumoniae (n = 6). Mock infection consisted of PBS treatment of the middle ear. The images in the squares in the top row are magnified in the bottom row. Data representative of those from three independent experiments are demonstrated in all panels. Bars = 50 μm. Magnifications, ×4 (top row) and ×40 (bottom row). Spn, S. pneumoniae; d, days.

FIG 2.

FIG 2

S. pneumoniae induces middle ear injury during AOM. (A to C) TNF-α (C), IL-1β (B), and IL-6 (C) levels in the supernatants of MELF were analyzed at 1 day, 3 days, 5 days, and 7 days following direct bilateral transtympanic inoculation of S. pneumoniae. (D and E) The levels of CXCL1 mRNA (D) and CXCL2 mRNA (E) expression in middle ear epithelium were analyzed by the real-time PCR method at 1 day, 3 days, 5 days, and 7 days following direct bilateral transtympanic inoculation of S. pneumoniae. (F and G) Total protein levels (F) and LDH activity (G) in the supernatants of MELF were analyzed at 1 day, 3 days, 5 days, and 7 days following direct bilateral transtympanic inoculation of S. pneumoniae. Mock infection consisted of PBS treatment of the middle ear. Values represent means ± SDs (n = 6). P values are for the differences between two groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Data representative of those from three independent experiments are demonstrated in all panels Spn, S. pneumoniae; d, days; NS, not significant.

Owing to the dysfunction of capillary walls during the inflammatory response, fluid and protein leak into sites of inflammation (24). On account of this, we measured the level of total protein in MELF as another indicator of inflammation (Fig. 2F). It could be seen that the total protein levels dramatically increased after infection. We also found that the activity of lactate dehydrogenase (LDH) was significantly increased in MELF from mice with AOM (Fig. 2G). Based on the observation of these features of injury, we concluded that the mice in the experimental cohort were suffering from AOM.

IL-17A contributes to middle ear injury during AOM.

Our previous research showed that IL-17A was upregulated in MELF during AOM (23). In order to understand the pathogenic effects of IL-17A in the middle ear, we examined and compared the injury features of IL-17A KO mice and WT mice. The results of the comparison of the features are illustrated in Fig. 3A to H. We found that the IL-17A KO mice had less weight loss, fewer pathological changes in their middle ears, and lower levels of proinflammatory cytokines, total protein, and LDH activity in their MELF than the WT mice during the experiment, indicating the alleviation of middle ear injury in the IL-17A KO mice. Furthermore, these injury features of IL-17A KO mice began to get closer to those of WT mice after administration of exogenous recombinant murine IL-17A (rmIL-17A) (Fig. 3B to H). Taken together, our data demonstrated that IL-17A contributes to middle ear injury in S. pneumoniae-induced AOM.

FIG 3.

FIG 3

IL-17A contributes to middle ear injury during AOM. (A) Weight loss of WT and IL-17A KO mice was determined daily following direct bilateral transtympanic inoculation of S. pneumoniae and is displayed relative to the initial weight. Mock infection consisted of PBS treatment of the middle ear. (B) Sections of middle ear tissue from WT mice and IL-17A KO mice were stained with H&E at day 3 postinfection by direct bilateral transtympanic inoculation of S. pneumoniae or S. pneumoniae plus rmIL-17A (n = 6). Magnifications, ×40. (C) Middle ear mucosal thickness was determined by NIS-Elements BR (version 4.10.00) software. (D to H) TNF-α (D), IL-6 (E), IL-1β (F), and total protein (G) levels and LDH activity (H) in the supernatants of MELF are shown. Mock infection consisted of PBS treatment of the middle ear. Values represent means ± SDs (n = 6). P values are for the differences between two groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Data representative of those from three independent experiments are demonstrated in all the panels. Spn, S. pneumoniae; d, days; NS, not significant.

IL-17A aggravates middle ear injury through the p38 MAPK signaling pathway during AOM.

Considering that our previous study confirmed that IL-17A promotes immune responses through the p38 MAPK signaling pathway during AOM, we hypothesized that the mechanism of IL-17A affecting middle ear injury is also involved in the p38 MAPK signaling pathway. Employing a p38 MAPK signaling pathway inhibitor, SB-203580, we found that the pathological manifestations, proinflammatory cytokine production, protein infiltration, and LDH activity dropped dramatically in the middle ears of both WT and IL-17A KO mice (Fig. 4A to G), indicating the involvement of the p38 MAPK signaling pathway in middle ear injury during AOM. Meanwhile, the suppression effect was much more obvious in WT mice than in IL-17A KO mice, suggesting the significant role of IL-17A in this process. In summary, IL-17A aggravates S. pneumoniae-induced middle ear injury through the p38 MAPK signaling pathway during AOM.

FIG 4.

FIG 4

IL-17A contributes to middle ear injury through the p38 MAPK signaling pathway during AOM. (A) Sections of middle ear tissue from WT mice and IL-17A KO mice were stained with H&E at day 3 postinfection by direct bilateral transtympanic inoculation of S. pneumoniae or S. pneumoniae plus SB-203580 (SB; a p38 MAPK-specific inhibitor) (n = 6). Magnifications, ×40. (B) The middle ear mucosal thickness was determined by NIS-Elements BR (version 4.10.00) software. (C to G) TNF-α (C), IL-6 (D), IL-1β (E), and total protein (F) levels and LDH activity (G) in the supernatants of MELF are shown. Mock infection consisted of PBS treatment of the middle ear. Values represent means ± SDs (n = 6). P values are for the differences between two groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Data representative of those from three independent experiments are demonstrated in all panels. Spn, S. pneumoniae.

IL-17A aggravates middle ear injury by inducing production of MPO through the p38 MAPK signaling pathway during AOM.

Considering that MPO is an important component of the neutrophil cytoplasm and our previous research showed that MPO is involved in middle ear injury during AOM (29), we hypothesized that MPO may play a role in the pathogenic effects of IL-17A in the middle ear during AOM. First, we found that the levels of MPO expression and MPO activity were lower in IL-17A KO mice than in WT mice during AOM and then increased by the administration of rmIL-17A (Fig. 5A to C). On the other hand, after administration of the MPO-specific inhibitor 4-aminobenzoic acid hydrazide (4-ABAH), we found that pathological manifestations, proinflammatory cytokine production, protein infiltration, and LDH activity were all significantly reduced in the middle ears of both the WT and the IL-17A KO mice (Fig. 6A to G), suggesting that IL-17A contributes, to some extent, to middle ear injury through the production of MPO. More interestingly, by employing a p38 MAPK inhibitor, SB-203580, in our model, we found a remarkable decline in the MPO protein level and MPO activity in both the IL-17A KO mice and the WT mice (Fig. 7A to C). The evidence showed that the p38 MAPK signaling pathway contributes to the production of MPO. Taking the results presented above together, our study demonstrates that IL-17A aggravates middle ear injury by inducing the production of MPO through the p38 MAPK signaling pathway during AOM.

FIG 5.

FIG 5

IL-17A contributes to the production of MPO during AOM. (A) The MPO activity in the supernatants of MELF from WT mice and IL-17A KO mice was analyzed at day 3 postinfection by direct bilateral transtympanic inoculation of S. pneumoniae or S. pneumoniae plus rmIL-17A. (B and C) Representative photomicrographs of immunohistochemistry staining of MPO (C) and percentage of neutrophils expressing MPO (B) in middle ear tissue histologic sections of WT mice and IL-17AKO mice at day 3 postinfection by direct bilateral transtympanic inoculation of S. pneumoniae or S. pneumoniae plus rmIL-17A (n = 6). Magnifications, ×100. Quantification of the positive neutrophils and total neutrophils was obtained from at least 20 fields of each middle ear section. Values represent means ± SDs. P values are for the differences between two groups. *, P < 0.05; **, P < 0.01. Data representative of those from three independent experiments are demonstrated in all panels. Spn, S. pneumoniae; NS, not significant.

FIG 6.

FIG 6

IL-17A contributes to middle ear injury by inducing the production of MPO during AOM. (A) Sections of middle ear tissue from WT mice and IL-17A KO mice were stained with H&E at day 3 postinfection by direct bilateral transtympanic inoculation of S. pneumoniae or S. pneumoniae plus 4-ABAH (a MPO specific inhibitor) (n = 6). Magnifications, ×40. (B) The middle ear mucosal thickness was determined by NIS-Elements BR (version 4.10.00) software. (C to G) TNF-α (C), IL-6 (D), IL-1β (E), and total protein (F) levels and LDH activity (G) in the supernatants of MELF are shown. Mock infection consisted of PBS treatment of the middle ear. Values represent means ± SDs (n = 6). P values are for the differences between two groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Data representative of those from three independent experiments are demonstrated in all panels. Spn, S. pneumoniae.

FIG 7.

FIG 7

IL-17A contributes to the production of MPO through the p38 MAPK signaling pathway during AOM. (A) The MPO activity in the supernatants of MELF from WT mice and IL-17A KO mice were analyzed at day 3 postinfection by direct bilateral transtympanic inoculation of S. pneumoniae or S. pneumoniae plus SB-203580. (B and C) Representative photomicrographs of immunohistochemistry staining of MPO (B) and the percentage of neutrophils expressing MPO (C) in middle ear tissue histologic sections of WT mice and IL-17AKO mice at day 3 postinfection by direct bilateral transtympanic inoculation of S. pneumoniae or S. pneumoniae plus SB-203580 (n = 6). P values are for the differences between two groups. *, P < 0.05; ***, P < 0.001. Magnifications, ×100. Spn, S. pneumoniae.

DISCUSSION

In infectious diseases, most pathogens are detected and destroyed within hours after entering the host due to the initiation of inflammatory cascades that result in phagocyte recruitment and pathogen containment (30). Meanwhile, hosts might suffer from damage caused by invading microbes and the immune response (13). For example, neutrophil transepithelial migration during inflammation increases epithelial permeability and tissue damage by altering the barrier function and homeostasis of the epithelium (31). Therefore, it is not surprising that the migration of abundant neutrophils across the epithelium facilitates host-induced tissue damage, which includes organ dysfunction and inflammation-related diseases and even leads to death (17, 32, 33). As a result, a beneficial immune response to an infection consists of efficiently clearing pathogenic organisms, limiting unnecessary damage, and promoting the repair of host tissues and thus maintains the homeostasis between host resistance and tolerance (34). Many researchers suggested that the acute inflammation response should be terminated to avoid excessive immune injury, as long as the pathogens are removed. On the basis of that, the precise restriction of leukocyte recruitment into infected sites has been considered to be an effective strategy to ameliorate tissue damage in acute inflammation (35, 36).

IL-17A has been reported to be secreted by Th17 cells, CD8+ T cells, NK cells, αβT cells, γδT cells, and neutrophils (19). In our previous study, we found that the IL-17A level increased significantly in MELF rather than in serum during AOM. Using flow cytometry, we identified more than 98% of infiltrated leukocytes to be neutrophils, about 69% of which were able to produce IL-17A in the middle ear cavity (23). Therefore, neutrophils could be an important source of IL-17A production in AOM. Furthermore, we demonstrated that upregulation of IL-17A in MELF induces neutrophil recruitment (23), so we hypothesized that IL-17A contributes to the middle ear tissue damage in AOM. In this study, the injury characteristics in IL-17A KO mice compared with those of WT mice, including weight loss and histopathological changes, indicated the alleviation of AOM in IL-17A KO mice. Furthermore, the pathological findings in IL-17A KO mice were more significant than those in WT mice after administration of rmIL-17A. The experimental results indicate that IL-17A aggravated the middle ear injury in AOM. Li and coauthors also reported that the intraperitoneal blockade of IL-17A improved the survival of septic mice by decreasing the levels of proinflammatory cytokine production, neutrophil infiltration, and lung injury (25). Besides, Kim et al. showed that inhibition of IL-17A reduced the levels of LPS-induced pulmonary neutrophilia and vascular leakage, indicating the pathogenic effect of IL-17A (26). However, the role of IL-17A in tissue damage is still controversial. Recently, Habets and coauthors suggested that the IL-17 response to the pneumococcal conjugate vaccine pneumococcal surface protein A (PspA) was important for protection against pneumococcal otitis media (37). In a mouse model of nonsevere cecal ligation and puncture, IL-17R deficiency was detrimental to the host (38), suggesting the protective effect of IL-17A. The discrepancies of the findings described in the literature may be ascribed to the different degrees of severity and the different types of models. That is, in severe inflammation, increased levels of IL-17A recruit neutrophils and promote the inflammatory response, which are beneficial to host resistance but harmful to host tolerance. Therefore, blockade of IL-17A improves the survival rate. In mild inflammations, however, increased amounts of IL-17A do not affect host tolerance but induce host resistance to rapidly clear the pathogen. As a result, blockage of IL-17A may impair host resistance and impede host recovery in the latter case. These data suggest that mediators of host immune IL-17A must be strictly regulated to optimize the balance between resistance and tolerance and to minimize the negative impact on the inflammatory response.

With an optimal balance between protective and destructive effects, the production, migration, and clearance of neutrophils are tightly regulated. Neutrophils can lead to tissue and even organ damage through the release of various inflammatory mediators, including reactive oxygen species (ROS), proinflammatory cytokines, and proteases, when the balance is broken (39). MPO, a major constituent of the neutrophil cytoplasmic granule, catalyzes the formation of hypochlorous acid (HOCl) from the oxidation of chloride ion with the presence of hydrogen peroxide, which is primarily responsible for tissue damage (40). Our recent study has shown that MPO worsens tissue damage by inducing neutrophil apoptosis and necrosis (29). In a mouse (C57BL/6) model of ischemia and reperfusion (I/R)-induced renal failure, Matthijsen and coauthors also demonstrated that MPO plays an important role in the induction of organ damage after renal I/R (41). Likewise, in an experimental rheumatoid arthritis model, Odobasic and coauthors confirmed that MPO is a mediator of joint inflammation and damage, exacerbating the severity of disease (42). Furthermore, a recent study showed that inhibition of IL-17A using a neutralizing anti-IL-17A antibody markedly reduced MPO activity and reduced the manifestations of endotoxin-induced inflammation/injury, including pulmonary neutrophilia and histologic changes (26). These observations highlight the role of MPO in tissue damage and indicate that MPO may contribute to the pathogenic effects of IL-17A in AOM. As expected, we found the activity of MPO to be significantly increased in MELF of WT mice at days 1, 3, and 5 postchallenge during AOM. Application of the MPO-specific inhibitor 4-ABAH improved the pathological manifestations in both WT and IL-17A KO mice after S. pneumoniae challenge. Importantly, despite improved pathological manifestations, the MPO protein levels and the activity of MPO in the middle ears of IL-17A KO mice were also lower than those in the middle ears of WT mice, indicating that the MPO induced by IL-17A is related to the middle ear injury.

It has been shown that IL-17A binds the IL-17A receptor–IL-17C receptor complex to induce inflammatory gene expression by activating the p38 MAPK signaling pathway (43), indicating that p38 MAPK phosphorylation is a critical signaling pathway in IL-17A-induced inflammation. Zhou et al. showed that treatment of the human gastric adenocarcinoma cell line AGS with IL-17 caused activation of MAPK signaling, including extracellular signal-regulated kinase (ERK), p38, and Jun N-terminal protein kinase (JNK) signaling (44). Similarly, our previous studies have demonstrated that IL-17A induces neutrophil recruitment through the p38 MAPK signaling pathway rather than the ERK or JNK signaling pathway during AOM (23). Furthermore, studies have shown that activation of p38 MAPK exacerbates acute lung injury and dengue virus-induced liver injury (45, 46). Therefore, we wondered whether IL-17A-related pathogenic effects were also dependent on the p38 MAPK signaling pathway during AOM. In our experiment, treatment with the p38 MAPK inhibitor SB-203580 significantly decreased the pathological manifestations, proinflammatory cytokine production, protein infiltration, and LDH activity in WT mice and IL-17A KO mice, suggesting that the p38 MAPK signaling pathway contributes to the pathological effects of IL-17A during AOM. Moreover, the MPO protein level and MPO activity in the MELF of both the WT and IL-17A KO mice remarkably decreased after the administration of the p38 MAPK inhibitor SB-203580 in our model, indicating that IL-17A contributed to tissue damage by inducing the production of MPO through the p38 MAPK signaling pathway during AOM. Undoubtedly, the IL-17A response in our study was not the only factor contributing to middle ear tissue damage during AOM, since injury features were not completely eliminated by the lack of IL-17A. Other cytokines and pathogen virulence, such as TNF-α, IL-6, toxins, and virulence factors, can be correlated with direct damage to the host (47).

In conclusion, our study confirmed that IL-17A, as the front line of the immune response, plays a significant role in tissue injury during AOM. Specifically, IL-17A aggravates middle ear injury by inducing the production of proinflammatory cytokines and MPO through the p38 MAPK signaling pathway. Our study further suggests that the specific and appropriate neutralization of IL-17A may have a significant value in attenuating tissue injury during AOM.

MATERIALS AND METHODS

Bacteria.

S. pneumoniae clinical isolate 31207 (serotype 6B) was obtained from the National Center for Medical Culture Collections (CMCC; Beijing, China). Bacteria were inoculated on blood agar plates overnight at 37°C in 5% CO2 and then harvested by washing the blood agar plates with sterile pyrogen-free phosphate-buffered saline (PBS). After centrifugation, the pneumococcal pellet was washed and resuspended in sterile pyrogen-free PBS or vehicle. The concentration of S. pneumoniae was determined by standard dilution and plate counts.

Mice.

C57BL/6 mice aged 4 to 6 weeks were purchased from The Jackson Laboratory and bred at Chongqing Medical University, Chongqing, China. IL-17A knockout (KO) mice with a C57BL/6 mouse background were kindly provided by Zhinan Yin (College of Life Sciences, Nankai University, Tianjin, China). All mice were housed in a specific-pathogen-free environment in the laboratory animal center of Chongqing Medical University. The following experiments were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee of Chongqing Medical University.

Mouse model of AOM.

AOM was induced in the mouse model by direct bilateral transtympanic inoculation of the middle ear, as previously described (48). Briefly, mice were anesthetized by intraperitoneal injection of ketamine hydrochloride (20 mg/kg of body weight) and xylazine (5 mg/kg). AOM was then induced by direct bilateral transtympanic injection of 5 μl of a suspension containing 106 to 107 CFU of S. pneumoniae in sterile pyrogen-free PBS. In some cases, 5 μl of sterile pyrogen-PBS containing recombinant murine IL-17A (rmIL-17A; 2 ng/ml; BioLegend, San Diego, CA) and 106 to 107 CFU of S. pneumoniae was injected. A control cohort of five mice was sham inoculated with 5 μl of PBS alone.

Inhibition of the p38 MAPK signaling pathway and MPO activity in vivo.

To inhibit the p38 MAPK signaling pathway, mice were inoculated with S. pneumoniae plus the p38 MAPK inhibitor SB-203580 (25 μM in PBS; Merck KGaA, Darmstadt, Germany) by direct bilateral transtympanic inoculation of the middle ear (23). To inhibit the MPO activity, mice were treated by intraperitoneal injection of the MPO-specific inhibitor 4-ABAH (40 mg/kg; Sigma-Aldrich), and the following injections were given every 12 h.

Collection of MELF.

Mice were anesthetized and sacrificed at designated time points postchallenge. Middle ear lavage fluid (MELF) samples were collected by lavage of the middle ear space six times with 10 μl sterile pyrogen-free PBS. The MELF samples were then centrifuged at 500 × g for 10 min, and single-use aliquots of the MELF samples were stored at −80°C. The cell pellets were washed twice after lysis of red blood cells and resuspended in PBS for inflammatory cell quantification by use of a hemocytometer. Following lavage, the middle ear epithelium was harvested by in situ lysis with 10 μl of lysis buffer from an RNeasy minikit (Qiagen, Valencia, CA) (49). This process was repeated six times, and the lysates were aspirated and pooled. Total RNA was extracted from the middle ear epithelium lysates pooled from six mice at each time point by using an RNeasy minikit according to the manufacturer's instructions (Qiagen, Valencia, CA) and stored at −80°C until it was analyzed by real-time PCR.

Quantitation of mRNA from the middle ear epithelium by real-time PCR.

Real-time PCR assays were performed to quantitate the CXCL1 and CXCL2 transcripts. Total RNA from the middle ear epithelium lysate sample was reverse transcribed with random hexamers by using a SuperScript preamplification system (Invitrogen, Carlsbad, CA). cDNA was then used for real-time PCR using SYBR green master mix (TaKaRa Bio, Inc., Tokyo, Japan) on an ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, CA) with SYBR green I dye as the amplicon detector. The gene for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was amplified as an endogenous reference. Primer and probe sequences were as follows: for CXCL1, TGGCTGGGATTCACCTCAAGAACA (forward) and TGTGGCTATGACTTCGGTTTGGGT (reverse); for CXCL2, ACATCCCACCCACACAGTGAAAGA (forward) and ACATCCCACCCACACAGTGAAAGA (reverse); and for GAPDH, ACGGCAAATTCAACGGCACAGTCA (forward) and TGGGGGCATCGGCAGAAGG (reverse).

ELISA.

The levels of IL-6, TNF-α, and IL-1β in MELF samples from each group were measured with commercially available enzyme-linked immunosorbent assay (ELISA) kits (BioLegend) following the manufacturer's protocol. MELF collected from six sham-inoculated animals served as the controls.

H&E staining and immunohistochemistry.

Temporal bones from five to six mice in each cohort were removed immediately after sacrifice at designated time points postchallenge and then fixed in 4% paraformaldehyde (PFA) at 4°C for 24 h, decalcified in 10% EDTA at 4°C for approximately a month, and embedded in paraffin, which was cut into 6-μm-thick serial sections by use of a Leica microtome. The middle ear sections were then deparaffinized and rehydrated through Histo-Clear histologic clearing agent and a graded alcohol series and stained with hematoxylin and eosin (H&E). For immunohistochemistry, the endogenous peroxidase activity was blocked with 0.3% H2O2 in 0.1 M PBS (pH 7.4), and the sections were incubated with 0.05% trypsin solution (Invitrogen, Carlsbad, CA) to unmask antigens. The sections were subsequently blocked with PBS containing 5% bovine serum albumin for 1 h at room temperature; incubated with rabbit anti-MPO primary antibody (1:100; Boster, Wuhan, China) at 4°C overnight and horseradish peroxidase-labeled goat anti-rabbit immunoglobulin secondary antibody (Zhonghshanjinqiao, Beijing, China), which was developed by use of a diaminobenzidine substrate kit for peroxidase; and then counterstained with hematoxylin. Digital micrographs were taken at standardized positions of each middle ear specimen. The thickness of the middle ear mucosa was analyzed with NIS-Elements BR (version 4.10.00) software by two pathologists in a blind fashion.

Total protein assay.

The amount of total protein in MELF was quantified by the bicinchoninic acid (BCA) protein microassay method (Beyotime, China) according to the manufacturer's instructions. The absorbance was read at 562 nm.

Quantification of MPO activity in MELF.

The MPO activity was quantified by an MPO kinetic-colorimetric assay (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Briefly, the supernatant of MELF was first diluted in reaction buffer, then added to the reaction system, and finally, mixed and incubated for 10 min at 60°C in a water bath. The absorbance of each tube was measured at 460 nm to calculate MPO activity according to the manufacturer's protocol.

Assay for LDH activity.

The lactate dehydrogenase (LDH) in the supernatant of MELF released by damaged cells was measured by use of an LDH assay kit (Beyotime, China) according to the instructions of the manufacturer. In brief, the supernatant of MELF was mixed with the detection solution and incubated at room temperature in the dark for 30 min, and the absorbance was measured at a wavelength of 490 nm.

Statistical analysis.

All data are presented as the mean ± standard error of the mean. GraphPad Prism software (version 5.01) was applied for statistical analysis. Independent t tests were used for data with a normal distribution, and Mann-Whitney U tests were performed for data with a nonnormal distribution. Differences were considered statistically significant if P was <0.05.

ACKNOWLEDGMENTS

This study was supported by grants from the National Natural Science Foundation of China (no. csfc81373151), the Natural Science Foundation Project of CQCSTC (no. cstc2012jjA0035), and the Scientific and Technological Research Program of Chongqing Municipal Education Commission of China (no. KJ130313).

We are grateful to Zhinan Yin from Nankai University and Richard A. Flavell from the Yale University School of Medicine for kindly providing the IL-17A KO mice. We thank Zhiqiang Ding for correction of the English usage in the manuscript.

We declare no conflict of interest.

REFERENCES

  • 1.Ahmed S, Shapiro NL, Bhattacharyya N. 2014. Incremental health care utilization and costs for acute otitis media in children. Laryngoscope 124:301–330. doi: 10.1002/lary.24190. [DOI] [PubMed] [Google Scholar]
  • 2.Vergison A, Dagan R, Arguedas A, Bonhoeffer J, Cohen R, Dhooge I, Hoberman A, Liese J, Marchisio P, Palmu AA, Ray GT, Sanders EA, Simões EA, Uhari M, van Eldere J, Pelton SI. 2010. Otitis media and its consequences: beyond the earache. Lancet Infect Dis 10:195–203. doi: 10.1016/S1473-3099(10)70012-8. [DOI] [PubMed] [Google Scholar]
  • 3.Monasta L, Ronfani L, Marchetti F, Montico M, Vecchi Brumatti L, Bavcar A, Grasso D, Barbiero C, Tamburlini G. 2012. Burden of disease caused by otitis media: systematic review and global estimates. PLoS One 7:e36226. doi: 10.1371/journal.pone.0036226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Auinger P, Lanphear BP, Kalkwarf HJ, Mansour ME. 2003. Trends in otitis media among children in the United States. Pediatrics 112:514–520. doi: 10.1542/peds.112.3.514. [DOI] [PubMed] [Google Scholar]
  • 5.Eskola J, Kilpi T, Palmu A, Jokinen J, Haapakoski J, Herva E, Takala A, Käyhty H, Karma P, Kohberger R, Siber G, Mäkelä PH. 2001. Efficacy of a pneumococcal conjugate vaccine against acute otitis media. N Engl J Med 344:403–409. doi: 10.1056/NEJM200102083440602. [DOI] [PubMed] [Google Scholar]
  • 6.Prymula R, Peeters P, Chrobok V, Kriz P, Novakova E, Kaliskova E, Kohl I, Lommel P, Poolman J, Prieels JP, Schuerman L. 2006. Pneumococcal capsular polysaccharides conjugated to protein D for prevention of acute otitis media caused by both Streptococcus pneumoniae and non-typeable Haemophilus influenzae: a randomised double-blind efficacy study. Lancet 367:740–748. doi: 10.1016/S0140-6736(06)68304-9. [DOI] [PubMed] [Google Scholar]
  • 7.Leibovitz E, Jacobs MR, Dagan R. 2004. Haemophilus influenzae: a significant pathogen in acute otitis media. Pediatr Infect Dis J 23:1142–1152. [PubMed] [Google Scholar]
  • 8.Ladhani S, Heath PT, Ramsay ME, Slack MP. 2008. Changes in antibiotic resistance rates of invasive Haemophilus influenzae isolates in England and Wales over the last 20 years. J Antimicrob Chemother 62:776–779. doi: 10.1093/jac/dkn274. [DOI] [PubMed] [Google Scholar]
  • 9.Nazir J, Urban C, Mariano N, Burns J, Tommasulo B, Rosenberg C, Segal-Maurer S, Rahal JJ. 2004. Quinolone-resistant Haemophilus influenzae in a long-term care facility: clinical and molecular epidemiology. Clin Infect Dis 38:1564–1569. doi: 10.1086/420820. [DOI] [PubMed] [Google Scholar]
  • 10.Watanabe H, Hoshino K, Sugita R, Asoh N, Watanabe K, Oishi K, Nagatake T. 2004. Possible high rate of transmission of nontypeable Haemophilus influenzae, including beta-lactamase-negative ampicillin-resistant strains, between children and their parents. J Clin Microbiol 42:362–365. doi: 10.1128/JCM.42.1.362-365.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Strowig T, Henao-Mejia J, Elinav E, Flavell R. 2012. Inflammasomes in health and disease. Nature 481:278–286. doi: 10.1038/nature10759. [DOI] [PubMed] [Google Scholar]
  • 12.Lavoie EG, Wangdi T, Kazmierczak BI. 2011. Innate immune responses to Pseudomonas aeruginosa infection. Microbes Infect 13:1133–1145. doi: 10.1016/j.micinf.2011.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ayres JS, Schneider DS. 2012. Tolerance of infections. Annu Rev Immunol 30:271–294. doi: 10.1146/annurev-immunol-020711-075030. [DOI] [PubMed] [Google Scholar]
  • 14.Ayres JS. 2013. Inflammasome-microbiota interplay in host physiologies. Cell Host Microbe 14:491–497. doi: 10.1016/j.chom.2013.10.013. [DOI] [PubMed] [Google Scholar]
  • 15.Schneider DS, Ayres JS. 2008. Two ways to survive infection: what resistance and tolerance can teach us about treating infectious diseases. Nat Rev Immunol 8:889–895. doi: 10.1038/nri2432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Riedemann NC, Guo RF, Ward PA. 2003. The enigma of sepsis. J Clin Invest 112:460–467. doi: 10.1172/JCI200319523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liou CJ, Lai YR, Chen YL, Chang YH, Li ZY, Huang WC. 2016. Matrine attenuates COX-2 and ICAM-1 expressions in human lung epithelial cells and prevents acute lung injury in LPS-induced mice. Mediators Inflamm 2016:3630485. doi: 10.1155/2016/3630485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Iadecola C, Alexander M. 2001. Cerebral ischemia and inflammation. Curr Opin Neurol 14:89–94. doi: 10.1097/00019052-200102000-00014. [DOI] [PubMed] [Google Scholar]
  • 19.Cua DJ, Tato M. 2010. Innate IL-17-producing cells: the sentinels of the immune system. Nat Rev Immunol 10:479–489. doi: 10.1038/nri2800. [DOI] [PubMed] [Google Scholar]
  • 20.Lin AM, Rubin CJ, Khandpur R, Wang JY, Riblett M, Yalavarthi S, Villanueva EC, Shah P, Kaplan MJ, Bruce AT. 2011. Mast cells and neutrophils release IL-17 through extracellular trap formation in psoriasis. J Immunol 187:490–500. doi: 10.4049/jimmunol.1100123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Miossec P, Korn T, Kuchroo VK. 2009. Interleukin-17 and type 17 helper T cells. N Engl J Med 361:888–898. doi: 10.1056/NEJMra0707449. [DOI] [PubMed] [Google Scholar]
  • 22.Kolls JK, Linden A. 2004. Interleukin-17 family members and inflammation. Immunity 21:467–476. [DOI] [PubMed] [Google Scholar]
  • 23.Wang W, Zhou A, Zhang X, Xiang Y, Huang Y, Wang L, Zhang S, Liu Y, Yin Y, He Y. 2014. Interleukin 17A promotes pneumococcal clearance by recruiting neutrophils and inducing apoptosis through a p38 mitogen-activated protein kinase-dependent mechanism in acute otitis media. Infect Immun 82:2368–2377. doi: 10.1128/IAI.00006-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chan AJ, Alikhan MA, Odobasic D, Gan PY, Khouri MB, Steinmetz OM, Mansell AS, Kitching AR, Holdsworth SR, Summers SA. 2014. Innate IL-17A-producing leukocytes promote acute kidney injury via inflammasome and Toll-like receptor activation. Am J Pathol 184:1411–1418. doi: 10.1016/j.ajpath.2014.01.023. [DOI] [PubMed] [Google Scholar]
  • 25.Li J, Zhang Y, Lou J, Zhu J, He M, Deng X, Cai Z. 2012. Neutralisation of peritoneal IL-17A markedly improves the prognosis of severe septic mice by decreasing neutrophil infiltration and proinflammatory cytokines. PLoS One 7:e46506. doi: 10.1371/journal.pone.0046506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kim SR, Kim HJ, Kim DI, Lee KB, Park HJ, Jeong JS, Cho SH, Lee YC. 2015. Blockade of interplay between IL-17A and endoplasmic reticulum stress attenuates LPS-induced lung injury. Theranostics 5:1343. doi: 10.7150/thno.11685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Miossec P, Kolls JK. 2012. Targeting IL-17 and TH17 cells in chronic inflammation. Nat Rev Drug Discov 11:763–776. doi: 10.1038/nrd3794. [DOI] [PubMed] [Google Scholar]
  • 28.Ferrari RS, Andrade CF. 2015. Oxidative stress and lung ischemia-reperfusion injury. Oxid Med Cell Longev 2015:590987. doi: 10.1155/2015/590987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Xiang Y, Jin C, Wang W, Wang Z, Huang Y, Fan F, Ma Y, Zhang X, Xu W, Yin Y, He Y. 2017. The critical role of myeloperoxidase in Streptococcus pneumoniae clearance and tissue damage during mouse acute otitis media. Innate Immun 23:296–306. doi: 10.1177/1753425917693907. [DOI] [PubMed] [Google Scholar]
  • 30.McAleer JP, Kolls JK. 2014. Directing traffic: IL-17 and IL-22 coordinate pulmonary immune defense. Immunol Rev 260:129–144. doi: 10.1111/imr.12183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Weber DA, Sumagin R, McCall IC, Leoni G, Neumann PA, Andargachew R, Brazil JC, Medina-Contreras O, Denning TL, Nusrat A, Parkos CA. 2014. Neutrophil-derived JAML inhibits repair of intestinal epithelial injury during acute inflammation. Mucosal Immunol 7:1221–1232. doi: 10.1038/mi.2014.12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lambeth JD. 2007. Nox enzymes, ROS, and chronic disease: an example of antagonistic pleiotropy. Free Radic Biol Med 43:332–347. doi: 10.1016/j.freeradbiomed.2007.03.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Segel GB, Halterman MW, Lichtman MA. 2011. The paradox of the neutrophil's role in tissue injury. J Leukoc Biol 89:359–372. doi: 10.1189/jlb.0910538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Marion CR, Wang J, Sharma L, Losier A, Lui W, Andrews N, Elias JA, Kazmierczak BI, Roy CR, Dela Cruz CS. 2016. Chitinase 3-like-1 (Chil1) regulates survival and macrophage-mediated IL-1β and TNF-α2 during Pseudomonas pneumonia. Infect Immun 84:2094–2104. doi: 10.1128/IAI.00055-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yoshikai Y. 2001. Roles of prostaglandins and leukotrienes in acute inflammation caused by bacterial infection. Curr Opin Infect Dis 14:257–263. doi: 10.1097/00001432-200106000-00003. [DOI] [PubMed] [Google Scholar]
  • 36.Ulbrich H, Eriksson EE, Lindbom L. 2003. Leukocyte and endothelial cell adhesion molecules as targets for therapeutic interventions in inflammatory disease. Trends Pharmacol Sci 24:640–647. doi: 10.1016/j.tips.2003.10.004. [DOI] [PubMed] [Google Scholar]
  • 37.Habets MN, van Selm S, van Opzeeland FJ, Simonetti E, Hermans PW, de Jonge MI, Diavatopoulos DA. 2016. Role of antibodies and IL17-mediated immunity in protection against pneumococcal otitis media. Vaccine 34:5968–5974. doi: 10.1016/j.vaccine.2016.09.057. [DOI] [PubMed] [Google Scholar]
  • 38.Freitas A, Alves-Filho JC, Victoni T, Secher T, Lemos HP, Sônego F, Cunha FQ, Ryffel B. 2009. IL-17 receptor signaling is required to control polymicrobial sepsis. J Immunol 182:7846–7854. doi: 10.4049/jimmunol.0803039. [DOI] [PubMed] [Google Scholar]
  • 39.Odobasic D, Kitching AR, Holdsworth SR. 2016. Neutrophil-mediated regulation of innate and adaptive immunity: the role of myeloperoxidase. J Immunol Res 2016:2349817. doi: 10.1155/2016/2349817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yang L, Latchoumycandane C, McMullen MR, Pratt BT, Zhang R, Papouchado BG, Nagy LE, Feldstein AE, McIntyre TM. 2010. Chronic alcohol exposure increases circulating bioactive oxidized phospholipids. J Biol Chem 285:22211–22220. doi: 10.1074/jbc.M110.119982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Matthijsen RA, Huugen D, Hoebers NT, de Vries B, Peutz-Kootstra CJ, Aratani Y, Daha MR, Tervaert JW, Buurman WA, Heeringa P. 2007. Myeloperoxidase is critically involved in the induction of organ damage after renal ischemia reperfusion. Am J Pathol 171:1743–1752. doi: 10.2353/ajpath.2007.070184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Odobasic D, Yang Y, Muljadi RC, O'Sullivan KM, Kao W, Smith M, Morand EF, Holdsworth SR. 2014. Endogenous myeloperoxidase is a mediator of joint inflammation and damage in experimental arthritis. Arthritis Rheumatol 66:907–917. doi: 10.1002/art.38299. [DOI] [PubMed] [Google Scholar]
  • 43.Iwakura Y, Ishigame H, Saijo S, Nakae S. 2011. Functional specialization of interleukin-17 family members. Immunity 34:149–162. doi: 10.1016/j.immuni.2011.02.012. [DOI] [PubMed] [Google Scholar]
  • 44.Zhou Y, Toh ML, Zrioual S, Miossec P. 2007. IL-17A versus IL-17F induced intracellular signal transduction pathways and modulation by IL-17RA and IL-17RC RNA interference in AGS gastric adenocarcinoma cells. Cytokine 38:157–164. doi: 10.1016/j.cyto.2007.06.002. [DOI] [PubMed] [Google Scholar]
  • 45.Sreekanth GP, Chuncharunee A, Sirimontaporn A, Panaampon J, Noisakran S, Yenchitsomanus PT, Limjindaporn T. 2016. B203580 modulates p38 MAPK signaling and dengue virus-induced liver injury by reducing MAPKAPK2, HSP27, and ATF2 phosphorylation. PLoS One 11:e0149486. doi: 10.1371/journal.pone.0149486. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Li L, Hu J, He T, Zhang Q, Yang X, Lan X, Zhang D, Mei H, Chen B, Huang Y. 2015. p38/MAPK contributes to endothelial barrier dysfunction via MAP4 phosphorylation-dependent microtubule disassembly in inflammation-induced acute lung injury. Sci Rep 5:8895. doi: 10.1038/srep08895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Jamieson AM, Pasman L, Yu S, Gamradt P, Homer RJ, Decker T, Medzhitov R. 2013. Role of tissue protection in lethal respiratory viral-bacterial coinfection. Science 340:1230–1234. doi: 10.1126/science.1233632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Tong HH, Li YX, Stahl GL, Thurman JM. 2010. Enhanced susceptibility to acute pneumococcal otitis media in mice deficient in complement C1qa, factor B, and factor B/C2. Infect Immun 78:976–983. doi: 10.1128/IAI.01012-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Long JP, Tong HH, Shannon PA, DeMaria TF. 2003. Differential expression of cytokine genes and inducible nitric oxide synthase induced by opacity phenotype variants of Streptococcus pneumoniae during acute otitis media in the rat. Infect Immun 71:5531–5540. doi: 10.1128/IAI.71.10.5531-5540.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES