Skip to main content
Frontiers in Molecular Neuroscience logoLink to Frontiers in Molecular Neuroscience
. 2017 Aug 24;10:267. doi: 10.3389/fnmol.2017.00267

The Histone H3K27 Demethylase UTX Regulates Synaptic Plasticity and Cognitive Behaviors in Mice

Gang-Bin Tang 1,, Yu-Qiang Zeng 1,, Pei-Pei Liu 1,2,, Ting-Wei Mi 1, Shuang-Feng Zhang 1,3, Shang-Kun Dai 1,2, Qing-Yuan Tang 1,2, Lin Yang 4, Ya-Jie Xu 1,2, Hai-Liang Yan 1, Hong-Zhen Du 1, Zhao-Qian Teng 1,2,*, Feng-Quan Zhou 5,6,*, Chang-Mei Liu 1,2,*
PMCID: PMC5609596  PMID: 28970783

Abstract

Histone demethylase UTX mediates removal of repressive trimethylation of histone H3 lysine 27 (H3K27me3) to establish a mechanistic switch to activate large sets of genes. Mutation of Utx has recently been shown to be associated with Kabuki syndrome, a rare congenital anomaly syndrome with dementia. However, its biological function in the brain is largely unknown. Here, we observe that deletion of Utx results in increased anxiety-like behaviors and impaired spatial learning and memory in mice. Loss of Utx in the hippocampus leads to reduced long-term potentiation and amplitude of miniature excitatory postsynaptic current, aberrant dendrite development and defective synapse formation. Transcriptional profiling reveals that Utx regulates a subset of genes that are involved in the regulation of dendritic morphology, synaptic transmission, and cognition. Specifically, Utx deletion disrupts expression of neurotransmitter 5-hydroxytryptamine receptor 5B (Htr5b). Restoration of Htr5b expression in newborn hippocampal neurons rescues the defects of neuronal morphology by Utx ablation. Therefore, we provide evidence that Utx plays a critical role in modulating synaptic transmission and cognitive behaviors. Utx cKO mouse models like ours provide a valuable means to study the underlying mechanisms of the etiology of Kabuki syndrome.

Keywords: Utx, H3K27me3, synaptic transmission, cognition

Introduction

Accumulating evidence suggests that epigenetic regulations play critical roles in neurological disorders (Tsankova et al., 2007; Ma et al., 2010). Trimethylation at Lysine 27 of histone H3 (H3K27me3) establishes a repressive chromatin state in silencing an array of crucial genes, which contributes to important biological processes including X-inactivation, genomic imprinting, stem cell maintenance, circadian rhythms, and cancer (Plath et al., 2003; Etchegaray et al., 2006; Sparmann and van Lohuizen, 2006; Van der Meulen et al., 2014). In mammals, the dynamic steady-state levels of dimethylation and trimethylation of histone H3 lysine 27 (H3K27me2/3) are mainly maintained through balance between methyltransferase Polycomb Repressor Complex 2 (PRC2) and the demethylases UTX (also known as KDM6A) and Jumonji D3 (JMJD3, also known as KDM6B) (Agger et al., 2007; Lee et al., 2007; Van der Meulen et al., 2014). H3K27me3 is involved not only in the balance between self-renewal and differentiation of neural stem cells (NSCs) (Pereira et al., 2010; Zhang et al., 2014), but also in the development of neurodegenerative diseases (Li et al., 2013; von Schimmelmann et al., 2016).

The Utx gene is encoded on the X chromosome but escapes X inactivation in females and is ubiquitously expressed (Greenfield et al., 1998). Earlier studies have demonstrated a critical role of Utx in cell reprogramming, cell differentiation, embryonic development, muscle regeneration, circadian rhythm, and senescence (Agger et al., 2007; Mansour et al., 2012). Utx mutation has been found in a variety of human cancers, including multiple myeloma, esophageal, renal cancer, bladder cancer, and T-cell acute lymphoblastic leukemia (van Haaften et al., 2009; Van der Meulen et al., 2014). Interestingly, recent studies have shown that de novo deletion and point mutations of Utx are associated with Kabuki syndrome (Lederer et al., 2012; Miyake et al., 2013), a rare congenital anomaly syndrome with mild to severe intellectual disability, growth retardation, and a variety of visceral malformations. Recent clinical data suggests that UTX and UTX-mediated H3K27me2/3 demethylation may play a critical role in the brain development (Miyake et al., 2013). Although Utx is highly expressed in most of the brain regions (Xu et al., 2008), its functional role in the central nervous system (CNS) is largely unknown. More importantly, we still do not know whether deletion of UTX in brain could replicate moderate-to-severe congenital anomaly/mental retardation observed from clinical Kabuki syndrome patients, and the pathomechanisms of Kabuki syndrome as well as the roles of Utx in the brain are largely unknown.

To investigate the function of Utx in CNS, we generated forebrain specific Utx deletion mice (cKO). Here we show that Utx cKO mice exhibited anxiety-like behaviors, learning and memory impairments. At the physiological and cellular levels, these cKO mice displayed abnormal synaptic transmission and long-term potentiation (LTP) accompanied with the abnormal neuronal morphology. Bioinformatics analysis revealed that UTX mediated-H3K27me3 demethylation suppressed expression of a subset of genes that are involved in the regulation of neuronal morphology and synaptic activity. The neurotransmitter 5-hydroxytryptamine receptor 5B (Htr5b) is a downstream target of Utx. Overexpression of Htr5b can rescue neuronal morphological impairment induced by Utx deficiency. The results from the present study provide evidence for the first time that Utx plays important roles in neuroplasticity and behaviors. Our work also suggests that Utx deficiency lead to cognition deficits underlying intellectual disability in Kabuki syndrome.

Materials and methods

Mice

All experiments involving animals were performed in accordance with the animal protocol approved by the Institutional Animal Care and Use Committee at the Institute of Zoology, Chinese Academy of Sciences. Mice were housed in groups of 3–5 animals in a 12 h light/12 dark cycle, with standard mouse chow and water ad libitum. Utxf/f (stock number 021926), transgenic Nestin-Cre (stock number 003771), and Emx1-Cre transgenic mice (stock number 005628) were bought from Jackson Lab. The conditional Utx knockout mice were generated by breeding Utxf/f mice with either Nestin-Cre or Emx1-Cre transgenic mice.

Behavioral tests

All behavioral tests were performed during the light cycle between 07:00 and 19:00. Male mice at 2–3 months of age were used for all the behavioral tests. All the videos were analyzed by the Smart software (Pan Lab, Harvard Apparatus).

Open field test

The open field test was conducted in a large box (72 × 72 × 36 cm) in a brightly lit room. Mice were placed in the center of the maze and were monitored from above by a video camera. The number of entries in the center zone (18 × 18 cm) of the maze was recorded over a 5-min trial to evaluate anxiety effects.

Light-dark box test

Light-dark box test was performed as previously described (Costall et al., 1993). An apparatus (45 × 27 × 27 cm) consisting of two chambers, a black chamber (18 × 27 cm) and a light chamber (27 × 27 cm), was used for the light/dark exploration test. Mice were placed into the dark box and allowed to move between the light box and dark box for 5 min. The total number of transitions and the time spent in each box were analyzed.

Elevated plus maze

The elevated plus maze is a plus-shaped apparatus with four arms (two open, 62 × 8.5 cm; two closed, 62 × 8.5 × 30 cm), elevated 70 cm from the floor. Mice were placed at the junction of the four arms of the maze, and allowed to freely explore the maze for 5 min. The number of entries and duration in each arm were analyzed (Rodgers and Dalvi, 1997).

Morris water maze

Morris water maze test was performed as described previously (Vorhees and Williams, 2006). A 120 cm diameter, 45 cm deep Morris water maze was filled with water to a depth of 25 cm. Target escape platform (diameter 13 cm) was hidden 1.5 cm beneath the surface of the water at the center of a given quadrant of the water tank. Four extra-maze cues, in different shapes, colors, and sizes, were uniformly located on the wall surrounding the water tank. The water temperature was adjusted to 21 ± 1°C. During training trials, mice were trained in four trials per day starting from different sites. The mice were allowed to swim for up to 1 min to locate the platform. If it failed to locate the platform within that time, escape was assisted. Mice were introduced gently to the hidden platform and allowed to rest on the platform for 15 s. For the probe trial, 24 h after the final training day the platform was removed and time spent and entry in each of the four quadrants were recorded.

Electrophysiology

Acute hippocampal slice preparation

Acute hippocampal slices were prepared from 8-week-old cKO mice and their WT littermates. Briefly, mice were deeply anesthetized with isoflurane and decapitated. The brain was rapidly removed and transferred into ice-cooled artificial cerebrospinal fluid (aCSF) (in mM: 125 NaCl, 2.5 KCl, 1.25 NaH2PO4, 25 NaHCO3, 25 D-Glucose, 2 CaCl2, and 1.5 MgCl2 saturated with 95% O2 and 5% CO2 to pH: 7.4). A filter paper was placed on the bottom of a petri dish in advance. The brain was transferred into the petri dish containing ice-cold aCSF. Coronal slices with 300 μm thickness containing hippocampus were cut with a vibratome (Leica, VT 1000 S, Germany), which was filled with the cold aCSF. The prepared slices were incubated in oxygenated aCSF at room temperature at least for 1 h, and then individual slices were transferred to a recording chamber, which was bubbled with oxygenated aCSF. The temperature of the aCSF in the recording chamber was 31 ± 1°C. Individual pyramidal neurons visualized with an Olympus microscope (Olympus BX50-WI, Olympus, Japan) fitted with a 40x long-working distance objective (NA 0.8).

Electrophysiological recordings

Whole-cell patch-clamp recordings were made using an Axopatch 700B amplifier and the pClamp10.6 software was used for data acquisition and analysis. Patch pipettes (4–6 MΩ) were pulled from borosilicate glass capillaries (GB 150F-8P) with a micropipette puller (Sutter instrument, USA). The internal pipette solution contained: (in mM) 135 K-gluconate, 10 HEPES, 2 MgCl2, 10 EGTA, 0.3 MgGTP, 0.5 Na2ATP (pH 7.3 with KOH). Spontaneous miniature excitatory postsynaptic currents (mEPSCs) were recorded under the whole-cell configuration of voltage clamp. The membrane potential was held at −70 mV. Series resistances and cell capacitance compensation were carried out prior to recording. The recordings were included only in those with high resistance seal (>1 GΩ) and a series resistance <25 MΩ. To isolate AMPA receptor-mediated mEPSCs, 10 nM glycine, 10 μM bicuculline (the GABAA receptor antagonist), and D-AP-5(NMDA receptor antagonist) were added to the aCSF. In addition, TTX (0.5 μM) was included in the extracellular solution.

Field excitatory postsynaptic potentials (fEPSPs) were recorded in the CA1 region of hippocampus. A bipolar concentric stimulating electrode (FHC Inc., Bowdoin, ME) was placed at the Schaffer collaterals to deliver stimuli. A glass recording electrode (3–4 MΩ) filled with aCSF was positioned in the stratum radiatum of the CA1 area. fEPSPs in CA1 were induced by stimulus at 0.033 Hz with an intensity that elicited a fEPSP amplitude of 40–50% of the maximum. After establishment of stable baseline recordings for at least 15 min, LTP was induced by a high-frequency stimulation (HFS) consisting of one train of 100 Hz stimulation for 1 s at baseline stimulation intensity. The fEPSP signals were digitized using Digidata1440A interface board. The data were sampled at 10 kHz and filtered at 2 kHz. Recordings were analyzed using the Clampfit 10.6 (Axon Instruments, Foster City, CA).

Neuronal culture and transfection

Primary hippocampal neurons (1 × 104 cells per well in a 24-well plate) were cultured from P0 Utx cKO and WT mice on plates coated with poly-D-lysine (100 μg/ml). The dissected hippocampus tissue was digested with trypsin-EDTA for 10 min at 37°C. The tissue was then washed three times with MEM plus 10% FBS and dissociated with the culture medium. Then neurons were grown in Neurobasal medium (Invitrogen) supplemented with 2% B27 (Invitrogen) and 2 mM GlutaMAX (Invitrogen) and penicillin/streptomycin. Primary hippocampal neurons were transfected with Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol.

Neuronal morphology analysis

In vivo dendritic and spine density analysis

We analyzed in vivo dendrites and spine density by using Golgi Stain Kit following the manufacturer's instructions. Generally, freshly 8-week-old mouse brains were incubated in the dark in Golgi solution A+B (FD Rapid Golgi Stain Kit, PK401, FD NeuroTechnologies) for 2 weeks. After incubation, brains were transferred into Solution C and were stored at room temperature in the dark for 3 days. Coronal sections (200 μm) were cut with a Leica CM1950 cryostat and mounted on 3% gelatin-coated slides. Staining procedures were followed according to the manufacturer's protocol (FD NeuroTechnologies), and slides were dehydrated in ethanol and mounted with Permount for microscopy. Images of the dendrites and the second segment apical dendrite spine were acquired on LSM 710 confocal microscope with 20 × and 100 × oil lense, respectively. Dendritic branches were traced, and their lengths were calculated using the Simple Neurite Tracer plugin of Fiji.

In vitro dendritic and spine analysis

For dendrites analysis, cultured neurons were fixed with 4% paraformaldehyde and then were washed with PBS at 7 day in vitro (DIV-7). Fixed neurons were blocked by 2% normal goat serum and 0.1% Triton X-100 in TBS for 1 h at room temperature. Neurons were incubated in primary antibodies (Map2, Mab3418, Millipore, 1:1,000) overnight at 4°C, and then incubated with secondary antibodies. Images of dendrites were acquired on Zeiss LSM710 confocal microscope with a 20 × lense. For spine analysis, cultures were used for immunostaining at DIV-19. Images of spines were acquired on Zeiss LSM710 confocal microscope with a 63 × oil lense. The secondary dendritic spines were analyzed.

Stereotactic injection

Stereotactic injections into the hippocampus (stereotaxic coordinates from Bregma: 2.0 mm caudal, 1.2 mm lateral, 2.0 mm ventral; 2.8 mm caudal, 2.0 mm lateral, 1.7 mm ventral) were performed as follows: 8-week-old Utxflox/flox were bilaterally injected with 1 μl Adeno-associated virus (AAV) 2/8 (Heyuan, China; Titer: Control virus:6.24 × 1012 V.G./ml; Cre virus: 5.04 × 1012 V.G./ml) at a rate of 0.125 μl/min.

RNA isolation and RT-qPCR

Total RNA were extracted from hippocampus tissues or cultured cells according to procedures using Trizol reagent (Invitrogen). Two micrograms of total RNA was reverse transcribed using either oligo (dT) primers or specific primers by using a Transcriptor First Strand cDNA Synthesis Kit (Roche). For real-time PCR analysis, according to the manufacturer's instructions, using a SYBR mix from Roche. 25 ng of cDNA and 0.5 mM primers were used in a final volume of 20 μl. The PCR steps were performed 30 s pre-denaturation at 95°C, followed by 45 cycles of 10 s denaturation at 94°C, 30 s annealing at 60°C, 30 s extension at 72°C. The analysis of RT-qPCR used the 2ΔΔCT method. Each reaction was run in triplicate and analyzed following the ΔΔCt method using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a normalization control. All primers are listed in Table 1.

Table 1.

Description of primers used in this study.

Gene/Primer Primer sequence (5′–3′)
Utx-F CGGGCGGACAAAAGAAGAAC
Utx-R CATAGACTTGCATCAGATCCTCC
Uty-F GGAATGAATGTGTTCCATGTCT
Uty-R CTCATGTAGACCAAGATGACC
Htr5b-F CTGGTGAGCGAGTTGTCCG
Htr5b-R GCGTGATAGTCCAGTAGCGA
Egr1-F AGCGAACAACCCTATGAGCACC
Egr1-R ATGGGAGGCAACCGAGTCGTTT
Egr3-F CTGACAATCTGTACCCCGAGGA
Egr3-R GCTTCTCGTTGGTCAGACCGAT
Shank1-F CAACCATCTCCCTGCGTTCCAA
Shank1-R GAGAGCCATCTGATACACGGTC
Wnt4-F GAGAACTGGAGAAGTGTGGCTG
Wnt4-R CTGTGAGAAGGCTACGCCATAG
Nos1-F CTACACCACACACATCCTCAAGG
Nos1-R GCACTTTGGAGAGCGGGCAATA
Edn1-F CTACTTCTGCCACCTGGACATC
Edn1-R CGCACTGACATCTAACTGCCTG
Actn2-F CACCTGGAGTTTGCCAAGAGAG
Actn2-R GCCTTGAACTGCTCATGTGCAG
Cacna1g-F GACCATGTGGTCCTCGTCATCA
Cacna1g-R TTTCAGCCAGGAAGACTGCCGT
Tgfb2-F TTGTTGCCCTCCTACAGACTGG
Tgfb2-R GTAAAGAGGGCGAAGGCAGCAA
Gpr88-F TCCTCCACTTCGACCTCCAC
Gpr88-R GCCCGAGTACAGGAGAGAC

Protein quantification

Hippocampal tissues and cultured neurons were lysed in buffer containing 25 mM HEPES at pH7.9, 150 mM NaCl, 1 mM PMSF, 20 mM NaF, 1 mM DTT, 0.1% NP40, and proteinase inhibitor cocktails (Roche). Protein concentrations were determined by Folin phenol method with bovine serum albumin as standard. Twenty micrograms of the protein was separated on 8–12% SDS-PAGE gels (Bio-Rad) and transferred to PVDF membranes (Millipore). The membranes were blocked in 5% BSA in TBS-T with 0.05% Tween-20 and incubated with primary antibodies at 4°C overnight. Dilutions of primary antibodies were 1:1000 for UTX (E409, Millipore), H3K27me3 (1:1,000, 07449, Millipore), PSD95 (ab2723, Abcam), Synapsin (ab8049, Abcam), and 1:10,000 for β-actin antibody (Sigma). As for the secondary antibodies, we used HRP-linked goat anti-mouse or HRP-Linked goat anti-rabbit at 1:500. Enhanced chemoluminescence (ECL, Pierce) was used for detection. Quantification of the blots was determined with Quantity One Ver.4.4.0 (BioRad, USA).

Immunohistochemistry

Adult mice were anesthetized, perfused with 4% PFA. Brain tissue was dissected out, equilibrated in 30% sucrose, and sectioned into 40 μm-thick serial sections. The brain sections were washed in PBS for 15 min three times, and then blocked in blocking solution (3% BSA+0.3%Triton X-100+0.2% sodium azide) at room temperature for 1 h. The primary antibodies we used are as follows: anti-H3K27me3 (1:1,000, 07449, Millipore), anti-Map2 (1:1,000, Mab3418, Millipore), anti-GFP (1:1,000, A10262, Life technology), anti-NeuN (1:1,000, millipore), anti-Doublecortin (1:500, millipore). After incubation in primary antibody solution at 4°C overnight, the brain sections were washed with TBS for 30 min three times and then incubated with the secondary antibodies conjugated to Alexa Fluor 488 or 594 with a concentration of 1:500 at room temperature. The sections were finally stained with DAPI and mounted using adhesion anti-fade medium.

Bioinformatics analyses

Only transcripts that showed more than 1.5-fold differential expression compared to control were subjected to relevance network analysis. GO analysis was performed by Database for Annotation, Visualization and Integrated Discovery (DAVID v6.7) (Huang et al., 2009). Mouse phenotype and gene enrichment were analyzed by WEB-based Toolkit (https://toppgene.cchmc.org/).

Statistical analysis

Statistical analysis was performed using SPSS 17.0 software (SPSS Inc., Chicago, IL, USA) with one-way or two-way analysis of variance as specified in legend of each figure. Prior to all statistical analyses, data were examined for normality of variance using the Kolmogorov-Smirnov test. All data were presented as mean ± SEM, and statistically significant was defined as *p < 0.05; **p < 0.01; ***p < 0.001.

Results

Utx cKO mice display anxiety-like behaviors and spatial learning and memory deficits

To evaluate the function of Utx in the brain, we used Utx conditional knockout (cKO) mice that lack Utx expression in NSCs during development (Figure 1A). Utx cKO male mice could survive to adult, however, almost all Utx cKO female mice died within 3 weeks after birth. Utx deletion was then confirmed at both mRNA and protein levels in cKO mice (Figures 1B,D), and we did not observe any change of its Y chromosome homolog Uty at mRNA level in the cKO brain (Figure 1C). Since Utx is a histone demethylase and functions in removal of repressive trimethylation of H3K27 (Agger et al., 2007), we next examined the histone marks H3K27me3 in cKO mice. Consistent with our expectations, Utx deletion significantly resulted in increased expression of H3K27me3 in the hippocampus compared to that in the WT littermates (Figures 1E,F).

Figure 1.

Figure 1

Nestin-Cre Utx cKO mice display anxiety-like behaviors and spatial learning and memory deficits. (A) Strategy for the generation of Nestin-Cre Utx cKO mice. (B) Real-time PCR analysis showing that Utx mRNA is decreased in the hippocampus of cKO mice (n = 3, p < 0.01). (C) Real-time PCR analysis showing that Uty mRNA had no change in the hippocampus of cKO mice (n = 3, p = 0.6287). (D) Western blotting analysis confirmed knockout of Utx in the hippocampus of cKO mice. (E) Representative images of fluorescent immunohistochemistry showing an increase of H3K27me3 in the dentate gyrus of hippocampus in cKO mice. Scale bars, 50 μm. (F) Protein levels of H3K27me3 are increased in the hippocampus from cKO mice. (G) Representative trajectory maps in an open field test. (H) Utx cKO mice had comparable locomotivity to WT littermate mice in open field test over a 5-min period [WT, n = 10; cKO, n = 9; two-tailed t-test: t(17) = 1.181, P = 0.2539]. (I) cKO mice showed decreased entry into the center zone during 5-min open field test [WT, n = 10; cKO, n = 9; two-tailed t-test: t(17) = 2.157; P = 0.0456]. (J) Representative trajectory maps of the light-dark box test. (K) cKO mice had decreased entry into the light box during 5-min light-dark box test [WT, n = 10; cKO, n = 9; two-tailed t-test: t(17) = 3.855, P = 0.0013]. (L) cKO mice spent less time in the light box over a 5-min light-dark box test [WT, n = 10; cKO, n = 9; two-tailed t-test: t(17) = 3.423, P = 0.0032]. (M) Representative trajectory maps of WT and Utx CKO mice in the elevated plus maze test. (N) cKO mice showed decreased entry into the open arms during 5-min elevated plus maze test [WT, n = 10; cKO, n = 9; two-tailed t-test: t(17) = 2.338, P = 0.0318]. (O) cKO mice spent less time significantly in the open arms over a 5-min elevated plus maze compared to WT littermates [WT, n = 10; cKO, n = 9; two-tailed t-test: t(17) = 2.659, P = 0.0165]. P cKO mice spent more time in reaching the platform during 5-day training in Morris water maze test [WT, n = 7; cKO, n = 6; repeated measures analysis of variance (ANOVA), followed by Turkey post-hoc test; Group effect: F(1, 11) = 8.977, P = 0.012; Day4: t(11) = 2.337, P = 0.039; Day5: t(11) = 2.366, P = 0.037]. (Q) Representative trajectory maps of WT and Utx CKO mice in water maze test. (R) cKO mice showed less platform crossing in Morris water maze test [WT, n = 7; cKO, n = 6; two-tailed t-test: t(11) = 2.602, P = 0.0246]. (P), repeated measures analysis of variance (ANOVA), followed by Turkey post-hoc test; others, unpaired t-test. n, number of mice. *P < 0.05; **P < 0.01. Error bars, s.e.m.

Male Utx cKO mice and their WT littermates were subjected to a battery of behavioral tests including tests for anxiety-like behaviors as well as learning and memory. We firstly conducted open field test and found that Utx cKO mice had smaller entries into the center of the arena (Figures 1G,I), whereas total distance traveled was comparable to that of WT littermates (Figure 1H). Increased anxiety-like behaviors of cKO mice were then confirmed in the light-dark box test and the elevated plus maze test. In the light-dark box test, Utx cKO mice showed a substantially decreased entries (Figures 1J,K) and time spent (Figure 1L) in the light box. Similarly, Utx cKO mice displayed decreased entries (Figures 1M,N) and spent less time in the open arms when compared with the WT littermates in the elevated plus maze test (Figure 1O).

Next, we determined whether Utx cKO mice have deficits in spatial learning and memory using the Morris water maze test. We found that cKO mice take a longer time to locate the hidden platform in the training trials (Figure 1P) and spend less time in the platform zone during the probe test (Figures 1Q,R), indicating that Utx cKO mice have deficits in hippocampus-dependent spatial learning and memory.

To further confirm the function of Utx in the brain, we crossed homozygous Utxf/f mice with transgenic Emx1-Cre mice, in which the endogenous Emx1 locus directs expression of Cre recombinase specifically in the neocortex and hippocampus, to generate Emx1-Cre Utx cKO mice with Utx deletion in the forebrain (Figure 2A). Consistent with the observations in Nestin-Cre Utx cKO mice, these Emx1-Cre Utx cKO mice also displayed anxiety-like behaviors as indicated by decreased entry into the center zone in the open field test (Figures 2B–D), decreased entries (Figures 2E,F), and time spent (Figure 2G) in the light box in the light-dark box test. In the Morris water maze test, Emx1-Cre Utx cKO mice took prolonged time to locate the hidden platform during both training (Figure 2H) and probe trials (Figures 2I,J), indicating that impaired spatial learning and memory also exists in Emx1-Cre Utx cKO mice. These results suggest that Utx specific ablation in the forebrain phenocopies the behavioral deficits observed in Nestin-Cre Utx-cKO mice, further strengthening the critical role of Utx in regulation of cognitive behaviors.

Figure 2.

Figure 2

Emx1-cre Utx cKO mice display anxiety-like behaviors and congenital abnormities. (A) Real-time PCR analysis showing that Utx mRNA are decreased in the cortex and hippocampus in Emx1-Cre Utx cKO mice [WT, n = 4; cKO, n = 3; two-tailed t-test: t(5) = 40.531, P < 0.001] and hippocampus [WT, n = 4; cKO, n = 3; two-tailed t-test: t(5) = 7.610, P = 0.001]. (B) Representative trajectory maps of Utx cKO and WT mice in the open field test. (C) Utx cKO and WT mice displayed similar locomotivity in the open field test over a 5-min period [WT n = 12, cKO n = 11; two-tailed t-test; t(21) = 0.7064; P = 0.4877 for WT vs. cKO]. (D) Utx cKO mice had decreased entries into the center zone during 5-min open field test [WT n = 12, cKO n = 11; two-tailed t-test; t(21) = 2.238; P = 0.0362 for WT vs. cKO]. (E) Representative trajectory maps in the light-dark box test. (F) Utx cKO mice showed decreased entries into the light box during 5-min light-dark test [WT, n = 12; cKO, n = 11; two-tailed t-test: t(21) = 3.730, P = 0.0012]. (G) Utx cKO mice spent comparable time in the light box over a 5-min light-dark test [WT, n = 12; cKO, n = 11; two-tailed t-test: t(21) = 0.270, P = 0.7845]. (H) Utx cKO mice spent significantly longer time in locating the platform during 5-day training [WT n = 5, cKO n = 10; repeated measures analysis of variance (ANOVA), followed by Turkey post-hoc test; Group effect: F(1, 13) = 7.016, P = 0.02; Day2: t(13) = 2.738; P = 0.0169; Day5: t(13) = 2.632; P = 0.0207 for WT vs. cKO]. (I) Representative trajectory maps in the Morris water maze test. (J) Utx cKO mice showed significant decreased number of platform crossing in the Morris water maze test [WT, n = 5; cKO, n = 10; two-tailed t-test: t(13) = 3.103, P = 0.0084]. *P < 0.05; **P < 0.01. Error bars, s.e.m.

Down-regulation of Utx in adult hippocampus phenocopies the behavioral deficits as in Utx cKO mice

The hippocampus is an important region in the brain in the information processing, consolidation, and storage, and responsible for cognitive ability and memory retention. It is also involved in emotional and cognitional functions (Eichenbaum, 2004). We then asked the question as to whether deletion of Utx in the hippocampus of adults could phenocopy the cognitive deficits exhibited in Utx cKO mice. To test this idea, we stereotactically injected AAV 2/8 virus expressing either GFP or Cre into the hippocampus of 8-week-old Utxf/f mice (Figure 3A). As shown in Figure 3B, expression of Utx at the protein level was significantly downregulated along with Cre recombinase after virus injection. In particular, we observed that deletion of Utx in the hippocampus of adult Utxf/f mice exhibited normal locomotion (Figure 3D), but showed fewer entries into the center zone (Figures 3C,E) in the open field test. This is consistent with the anxiety-like behavior and cognitional deficits in Utx cKO mice. Similarly, mice with Utx down-regulation in the hippocampus also showed decreased entries in the light chamber in the light-dark box test (Figures 3F,G,H), and fewer entries (Figures 3I,J), and time spent (Figures 3K) in the open arms in the elevated plus maze test. In the Morris water maze test, mice with Utx down-regulation in the hippocampus displayed the lower ability to locate the platform (Figures 3L,M,N), indicating impaired spatial learning and memory abilities. Taken together, these results indicate that deletion of Utx in the adult hippocampus indeed replicates the behavioral deficits observed in cKO mice in which deletion of Utx occurs during development, further supporting the idea that Utx plays critical roles in regulation of emotion and cognition in adults.

Figure 3.

Figure 3

Knocking-down of Utx expression in adult hippocampus phenocopies the behavioral deficits observed in Utx cKO mice. (A) Schematic illustrating injection of AAV-GFP-CRE and AAV-GFP control viruses into the adult Utx f/f hippocampus (left), representative images showing GFP expression in the hippocampus 2 months after viral injection (right). (B) UTX protein level was significantly reduced in the Utx f/f hippocampus 2 months after AAV2/8-cre viral injection. (C) Representative trajectory maps of WT and Utx cKO mice in the open field test. (D) Utx knockdown had no effect on locomotivity [CTRL, n = 10; CRE, n = 10; two-tailed t-test: t(18) = 0.05696, P = 0.9552]. (E) Utx knockdown resulted in less entries into the center zone during the open field test [CTRL, n = 10; CRE, n = 10; two-tailed t-test: t(18) = 2.249, P = 0.0373]. (F) Representative trajectory maps of WT and Utx cKO mice in the light-dark field test. (G) Mice with Utx knockdown had decreased entries into the light box during 5-min light-dark box test [CTRL, n = 10; CRE, n = 10; two-tailed t-test: t(18) = 2.561, P = 0.0196]. (H) Mice with Utx knockdown showed no significant changes of time in the light box compared to their controls over a 5-min light-dark box test [CTRL, n = 10; CRE, n = 10; two-tailed t-test: t(18) = 0.9038, P = 0.3780]. (I) Representative trajectory maps of WT and Utx cKO mice in elevated plus maze test. (J) Mice with Utx knockdown displayed decreased entries into the open arms during 5-min elevated plus maze test [CTRL, n = 10; CRE, n = 10; two-tailed t-test: t(18) = 2.655, P = 0.0161]. (K) Mice with Utx knockdown spent less time in the open arms over a 5-min elevated plus maze [CTRL, n = 10; CRE, n = 10; two-tailed t-test: t(18) = 2.655, P = 0.0161]. (L) Mice with Utx knockdown spent more time in reaching the platform during 5-day training in Morris water maze test [CTRL, n = 7; CRE, n = 8; repeated measures analysis of variance (ANOVA), followed by Turkey post-hoc test; Group effect: F(1, 13) = 6.038, P = 0.029; Day4: t(13) = 2.663, P = 0.020]. (M) Representative trajectory maps in a water maze test. (N) Mice with Utx knockdown showed significant changes of target crossing in Morris water maze test [CTRL, n = 6; CRE, n = 6; two-tailed t-test: t(10) = 3.051, P = 0.0122]. *P < 0.05. Error bars, s.e.m.

Utx cKO mice display abnormalities of LTP and basal synaptic transmission in the hippocampus

To explore the role of Utx loss-of-function in hippocampal synaptic transmission and plasticity, we recorded hippocampal LTP, a cellular model for learning and memory, in acute hippocampal slices prepared from 6 to 7 week-old Utx cKO and WT mice. As shown in Figures 4B,C, LTP at Schaffer collateral synapses in the CA1 region (Figure 4A) was significantly impaired in cKO mice when compared with that in WT littermates. There was a significant difference in the amplitude of LTP at 55–60 min after induction between cKO and WT mice (Figures 4B,C). These results indicated that Utx deficiency impairs hippocampal long-term synaptic plasticity, which may underlie the behavioral deficits displayed by cKO mice.

Figure 4.

Figure 4

Utx cKO mice display abnormalities of LTP and basal synaptic transmission in CA1 of the hippocampus. (A) Schematic overview of the electrophysiological protocol for acute hippocampal slice recording. (B) Typical experiment showing time course of CA1 LTP for a single recording from WT and cKO mice. fEPSP traces before (1, black) and after (2, red) are shown in the inset above. (C) cKO mice showed lower LTP amplitude measured at 55–60 min post-induction [WT, 10 slices from 4 animals; cKO, 7 slices from 4 animals; two-tailed t-test: t(338) = 12.07, P < 0.0001]. (D) Amplitudes [WT, 8 slices from 4 animals; cKO, 8 slices from 3 animals; two-tailed t-test: t(14) = 2.211, P = 0.0442] but not frequencies [WT, 8 slices from 4 animals; cKO, 8 slices from 3 animals; two-tailed t-test: t(14) = 0.8486, P = 0.4104] of spontaneous mEPSCs (monitored in 0.5 μM tetrodotoxin) was impaired in cKO CA1 neurons [top, representative traces; bottom, cumulative plots and summary graphs of the mEPSC (left) frequency and amplitude (right)]. (E) Representative western blotting for PSD95 and Synapsin (SYP) in total hippocampus extracts of WT and cKO mice. (F) Quantification of immunoreacitivity revealed a significant decrease of PSD95 expression in cKO mice. SYP protein levels were similar in cKO mice to WT mice [WT, n = 4; Cko, n = 4; two-tailed t-test: t(6) = 3.951, P = 0.0075]. SYP protein levels were similar in cKO mice to WT mice [WT, n = 4; cKO, n = 4; two-tailed t-test: t(6) = 1.262, P = 0.2538]. *P < 0.01; **P < 0.01; ***P < 0.001. Error bars, s.e.m.

To further determine the cause of the impaired hippocampal synaptic plasticity in Utx cKO mice, we recorded AMPA receptor (AMPAR)-mediated miniature excitatory postsynaptic currents (mEPSCs) in CA1 pyramidal cells using the whole-cell patchclamp technique. AMPAR mediated mEPSCs were pharmacologically isolated by bath application of the GABAA and NMDA receptor antagonists bicuculline (10 μM) and D-AP5 (25 μM) in the presence of TTX (0.5 μM). At a holding potential of −70 mV, mEPSCs displayed fast inward currents and sensitive to 20 μM DNQX, indicating AMPAR-mediated currents. As shown in Figure 4D, the amplitude, but not the frequency, of mEPSCs was significant decreased in slices from cKO mice when compared with that from WT mice. The results from electrophysiological recordings further support our speculation that Utx deletion impairs hippocampal synaptic transmission.

Impaired LTP and decreased amplitude of mEPSCs are most likely due to the deficits in postsynaptic function and/or reduction of functional synapses (Liao et al., 1995; Xiao et al., 2007). To test this assumption, we examined the immunoreactivity of synaptic-related proteins in the hippocampus of both WT and cKO mice. As shown in Figures 4E,F, expression of postsynaptic density protein PSD-95, a postsynaptic marker, was significantly decreased, while synapsin, a presynaptic marker, remained unchanged in cKO mice when compared to that in WT littermates. These results suggest that decreased expression of PSD-95 may lead to a deficit of postsynaptic plasticity in Utx cKO mice.

Morphological abnormalities of hippocampal neurons in Utx cKO mice in vivo

Neuronal signal integration as well as synaptic transmission and plasticity highly depend on the morphology of dendrites and their spines (Hering and Sheng, 2001). The impairment of hippocampal synaptic plasticity and the reduced PSD95 expression in Utx cKO mice prompted us to postulate that Utx deficiency may cause abnormal neuronal morphology. To determine whether disruption of Utx affects neuronal morphology, we traced Golgi-stained hippocampal neurons in the CA1 and dentate gyrus (DG). Utx cKO mice exhibited a significant reduction in dendritic length and number of branches in neurons in both the CA1 (Figures 5A–D) and DG regions (Figures 5E–G). Moreover, a reduction of spine density in hippocampal CA1 pyramidal neurons was also found in Utx deletion mice (Figures 5H,I). These data, together with the reduction in the postsynaptic PSD95 protein (Figure 4E), suggest an essential role for UTX in synaptic formation and dendritic development in hippocampal neurons, which in turn affect spatial learning and memory.

Figure 5.

Figure 5

Morphological abnormalities of hippocampal neurons in Utx cKO mice. (A) Representative projection images of Golgi-stained pyramidal neurons in the hippocampal CA1 region. Scale bar, 50 μm. (B) Quantification of dendritic length of CA1 neurons [WT, 21 neurons from 4 mice; cKO, 32 neurons from 3 mice; two-tailed t-test: basal dendrite, t(5) = 3.122, P = 0.0262; apical dendrite, t(5) = 5.137, P = 0.0037]. (C) Quantification of basal dendritic number of CA1 neurons [80 μm, t(5) = 3.090, P = 0.027; 90 μm, t(5) = 2.988, P = 0.031; 100 μm, t(5) = 3.313, P = 0.021; 110 μm, t(5) = 2.988, P = 0.031]. (D) Reduced branching of apical dendrites was found in Utx deletion CA1 neurons [50 μm, t(5) = 3.828, P = 0.012; 60 μm, t(5) = 4.781, P = 0.005]. (E) Representative images of dendritic spines of Golgi-stained secondary dendrites of pyramidal neurons in the hippocampal CA1 region. Scale bars, 2 μm. (F) Utx cKO mice decreased spine density in the CA1 neurons compared to WT littermate [WT, 50 neurons in 3 mice; cKO, 50 neurons in 3 mice; two-tailed t-test: t(4) = 4.082, P = 0.0151]. (G) Representative projection images of Golgi-stained neurons in the dentate gyrus. Scale bar, 50 μm. (H) Quantification of dendritic length of neurons in the dentate gyrus [WT, 26 neurons from 4 mice; cKO, 32 neurons from 3 mice; two-tailed t-test: t(5) = 3.086, P = 0.0273]. (I) Quantification results showed that Utx deletion decreased dendritic branching in the dentate gyrus [60 μm, t(5) = 3.140, P = 0.026; 70 μm, t(5) = 2.869, P = 0.035; 90 μm, t(5) = 3.042, P = 0.029; 110 μm, t(5) = 2.587, P = 0.049; 120 μm, t(5) = 3.886, P = 0.012; 130 μm, t(5) = 3.054, P = 0.028; 140 μm, t(5) = 6.444, P = 0.001; 150 μm, t(5) = 3.095, P = 0.027). *P < 0.05; **P < 0.01. Error bars, s.e.m.

Utx deletion in hippocampal neurons results in morphological defects in vitro

We next used a well-established in vitro primary neuron culture system to examine the effects of UTX deletion on the morphology of hippocampal neurons. Indeed, Utx cKO hippocampus neurons displayed a significant reduced in total dendritic length and dendritic complexity compared with control neurons isolated from littermate newborn pups (Figures 6A–C) at Day 7 in vitro (DIV7). At DIV19, cKO hippocampal neurons showed significant reductions in spine density (Figures 6D,E), which is consistent with the Golgi staining observations in the CA1 pyramidal neurons in vivo (Figures 5H,I). To further determine whether UTX regulates neuronal morphology, we acutely manipulated UTX expression by infecting in newborn hippocampus neurons isolated from Utxf/f pups with lenti-cre viruses to delete UTX expression. As expected, we found that acute knockdown of UTX in hippocampus neurons also led to a significant decrease in total dendritic length and dendritic complexity (Figures 6F–H). These loss-of-function data in primary neurons further support our in vivo observation that deletion of UTX inhibits neuronal dendritic development.

Figure 6.

Figure 6

Utx deletion results in abnormal dendritic development in cultured hippocampus neurons. (A) Neurons from the hippocampus of Utx cKO and WT littermate newborn mice were cultured for 7 days in vitro (DIV-7), fixed and stained for expression of Map2 (red). Scale bars, 50 μm. (B) Quantification of dendritic length of WT and cKO P0 hippocampal neurons. (C) Quantification of the branching of P0 hippocampal neurons (DIV-7) [WT, 70 neurons from 5 mice; cKO, 65 neurons from 5 mice; two-tailed t-test: t(8) = 3.494, P = 0.0082]. (D) Representative images of spines from Map2 stained secondary dendrites of cultured neurons (DIV-19) from P0 WT and cKO hippocampus [WT, 45 neurons from 3 mice, Cko, 50 neurons from 4 mice; two-tailed t-test: t(8) = 2.309, P = 0.0497]. Scale bars, 2 μm. (E) Spine density from Map2 stained secondary dendrites of cultured neurons (DIV-19) was reduced in cKO. (F) Representative images of Utxf/f hippocampal neurons infected with Cre-expressing lenti-virus (DIV7). GFP (green), Map2 (red). Scale bars, 50 μm. (G) Cre-mediated Utx deletion resulted in shorter dendritic length in cultured hippocampal neurons [CTRL, 31 neurons from 3 mice; CRE, 31 neurons from 3 mice; two-tailed t-test: t(60) = 2.872; P = 0.0056]. (H) The dendrite complexity was decreased in cultured Utxf/f hippocampal neurons that infected with Cre-expressing lenti-virus [CTRL, 31 neurons from 3 mice; CRE, 31 neurons from 3 mice; 70 μm: t(60) = 2.024, P = 0.047; 80 μm: t(60) = 2.106, P = 0.039; 90 μm: t(60) = 2.012, P = 0.019]. *P < 0.05, **P < 0.01. Error bars, s.e.m.

Altered expression of synaptic plasticity and cognition associated genes in the hippocampus of Utx cKO mice

Next, we investigated the effects of Utx loss-of-function on hippocampal gene expression, in order to identify potential mechanisms that might be associated with the synaptic plasticity and cognitive dysfunction in Utx cKO mice. To delineate the molecular pathways regulated by Utx, we conducted gene expression profiling (RNA-seq) using total RNA from the hippocampus of WT and cKO mice. One hundred forty seven down-regulated and 87 up-regulated genes were identified in cKO mice when compared with WT mice (Figures 7A–C and Table 2). To uncover the genes involved in the phenotypes of Utx loss-of-function, we performed Gene Ontology (GO) enrichment analysis of dysregulated genes in Utx cKO mice and found several enriched GO terms for biological processes, including cognition, learning and memory, anxiety, and synaptic transmission (Figure 7C). We then focused on the 147 genes with decreased expression in cKO mice, as their downregulation likely resulted from a loss of Utx. Most of those down-regulated genes are involved in regulation of Ion transport, calcium ion binding, neurite elongation, dendritic, and synaptic formation (Table 3), suggesting an essential role of Utx in Cognition, Learning and Memory, Anxiety, Synaptic Formation, and Function (Figures 7C,D and Table 3).

Figure 7.

Figure 7

Altered expression of synaptic plasticity and cognition associated genes in the hippocampus of Utx cKO mice. (A) Correlation analysis of differential genes between cKO and WT samples. (B) Histograms of differentially expressed genes in the hippocampus of cKO mice compared to the littermate WT mice. (C) Gene ontology (GO) analysis of differentially expressed genes. Red represents down-regulated genes; Blue represents up-regulated genes. (D) Validation of down-regulated genes in cKO hippocampus by RT-qPCR. (D), paired t-test; *P < 0.05, **P < 0.01. Error bars, s.e.m. (E) Representative image of western blotting analysis on Htr5b. (F) Quantification of Htr5b protein levels in the hippocampus of cKO and littermate WT mice [WT, n = 3; cKO, n = 3; two-tailed t-test: t(4) = 14.79, P = 0.0001]. (G) ChIP assay showed that H3K27me3 was enriched at the promoter of Htr5b gene (n = 5, P = 0.0105). *P < 0.05, ***P < 0.001. Error bars, s.e.m.

Table 2.

Differential gene expression in the hippocampus of Utx cKO mice.

Gene ID Gene name cKO WT log2FC P-value Q-value
DOWN-REGULATED GENES
ENSMUSG00000092837 Rpph1 343.15316 5308.8495 −3.951475 0 0
ENSMUSG00000081824 BC002163 2.4534164 80.746173 −5.04053 1.62E-63 1.71E-59
ENSMUSG00000069919 Hba-a1 5.8219374 21.66464 −1.895771 3.20E-25 1.13E-21
ENSMUSG00000104586 4921539H07Rik 3.2608135 8.8100261 −1.433914 1.10E-24 3.32E-21
ENSMUSG00000001119 Col6a1 2.7857418 7.7819942 −1.482078 4.20E-23 1.11E-19
ENSMUSG00000069917 Hba-a2 4.8539394 17.783574 −1.873317 7.64E-19 1.62E-15
ENSMUSG00000039474 Wfs1 8.5123646 15.002664 −0.817587 8.18E-18 1.57E-14
ENSMUSG00000005672 Kit 3.5255571 6.2890673 −0.834995 9.46E-17 1.67E-13
ENSMUSG00000026504 Sdccag8 9.1889204 16.475959 −0.842395 5.64E-16 8.53E-13
ENSMUSG00000096887 Gm20594 34.423898 76.359394 −1.149395 1.13E-15 1.59E-12
ENSMUSG00000040836 Gpr161 9.6569171 15.784179 −0.708845 2.36E-15 3.12E-12
ENSMUSG00000022602 Arc 9.4851166 15.982332 −0.752741 2.56E-14 2.85E-11
ENSMUSG00000097789 Gm2115 18.661136 32.727853 −0.810482 1.92E-13 1.94E-10
ENSMUSG00000028011 Tdo2 1.2541566 3.4340393 −1.453189 8.43E-13 6.86E-10
ENSMUSG00000032327 Stra6 0.3790327 1.3524839 −1.835217 8.41E-13 6.86E-10
ENSMUSG00000038738 Shank1 7.5127037 11.280538 −0.586432 9.51E-13 7.45E-10
ENSMUSG00000039087 Rreb1 1.6818975 2.7150751 −0.690902 1.06E-12 7.99E-10
ENSMUSG00000029361 Nos1 3.95298 6.2713571 −0.665837 1.67E-12 1.18E-09
ENSMUSG00000028909 Ptpru 3.1446904 5.6113616 −0.835433 2.75E-12 1.87E-09
ENSMUSG00000020866 Cacna1g 2.4304661 4.0903474 −0.75099 3.01E-12 1.99E-09
ENSMUSG00000062372 Otof 0.1484716 0.7338461 −2.305291 1.40E-11 7.23E-09
ENSMUSG00000037428 Vgf 5.4764434 9.2877787 −0.762094 1.68E-11 8.34E-09
ENSMUSG00000022416 Cacna1i 4.5026666 7.0137187 −0.6394 4.79E-11 2.30E-08
ENSMUSG00000021803 Cdhr1 0.7274866 2.4312039 −1.740678 7.98E-11 3.59E-08
ENSMUSG00000037138 Aff3 4.9159226 7.7216196 −0.651441 1.48E-10 6.22E-08
ENSMUSG00000030592 Ryr1 1.8583275 3.1236378 −0.749222 1.61E-10 6.57E-08
ENSMUSG00000027520 Zdbf2 1.0423908 1.7822945 −0.773839 2.32E-10 8.46E-08
ENSMUSG00000033377 Palmd 2.1376507 3.8711601 −0.85674 2.92E-10 1.03E-07
ENSMUSG00000036943 Rab8b 10.890041 16.662915 −0.613631 3.76E-10 1.31E-07
ENSMUSG00000037579 Kcnh3 13.105166 20.217393 −0.625461 5.24E-10 1.79E-07
ENSMUSG00000032500 Dclk3 4.9807473 9.4493604 −0.923854 5.73E-10 1.92E-07
ENSMUSG00000037369 Kdm6a 3.9870515 6.2300865 −0.64393 2.95E-09 9.17E-07
ENSMUSG00000102543 Pcdhgc5 5.3198372 8.0448876 −0.59669 4.11E-09 1.21E-06
ENSMUSG00000036882 Arhgap33 4.5941122 7.9284449 −0.787252 7.84E-09 2.17E-06
ENSMUSG00000039239 Tgfb2 3.4664434 5.4757102 −0.65959 8.32E-09 2.23E-06
ENSMUSG00000038418 Egr1 2.6017263 4.4423229 −0.771845 1.52E-08 3.75E-06
ENSMUSG00000079110 Capn3 1.3940483 2.7705691 −0.990902 1.51E-08 3.75E-06
ENSMUSG00000030703 Gdpd3 0.4099224 1.7892865 −2.125962 1.60E-08 3.90E-06
ENSMUSG00000036777 Anln 2.4000525 4.4271812 −0.883322 2.75E-08 6.43E-06
ENSMUSG00000041577 Prelp 1.124159 2.713794 −1.271465 4.08E-08 9.09E-06
ENSMUSG00000032289 Thsd4 2.2038886 3.3192968 −0.590826 4.26E-08 9.30E-06
ENSMUSG00000037843 Vstm2l 10.550429 18.898041 −0.840935 4.52E-08 9.77E-06
ENSMUSG00000023886 Smoc2 10.293695 16.079821 −0.64349 4.88E-08 1.04E-05
ENSMUSG00000021867 Tmem254b 0.4440248 1.7208204 −1.954384 9.93E-08 2.00E-05
ENSMUSG00000081738 Hmgb1-ps2 0 3.4556435 #NAME? 1.37E-07 2.58E-05
ENSMUSG00000052374 Actn2 1.2598146 2.7926344 −1.148415 2.28E-07 4.03E-05
ENSMUSG00000044393 Dsg2 0.4516196 1.1284631 −1.321179 2.90E-07 4.94E-05
ENSMUSG00000052861 Dnah6 0.5956064 1.1700731 −0.974167 3.15E-07 5.25E-05
ENSMUSG00000043439 E130012A19Rik 2.2828718 5.1288012 −1.167772 3.32E-07 5.45E-05
ENSMUSG00000049892 Rasd1 3.400498 7.5305922 −1.147017 3.40E-07 5.54E-05
ENSMUSG00000020635 Fkbp1b 12.590353 22.269622 −0.822758 5.83E-07 8.92E-05
ENSMUSG00000044783 Hjurp 1.8172029 2.8328347 −0.640527 5.79E-07 8.92E-05
ENSMUSG00000103004 2900002M20Rik 14.525397 33.299838 −1.196938 6.68E-07 0.0001009
ENSMUSG00000052305 Hbb-bs 9.7599188 15.919328 −0.705838 1.25E-06 0.0001663
ENSMUSG00000031785 Adgrg1 6.6330473 9.9878521 −0.590503 1.98E-06 0.0002445
ENSMUSG00000020096 Tbata 1.2678716 2.5992368 −1.035679 2.19E-06 0.0002674
ENSMUSG00000041798 Gck 0.2917662 1.0675203 −1.871379 2.42E-06 0.0002882
ENSMUSG00000030889 Vwa3a 1.5389782 2.6433614 −0.780401 3.24E-06 0.0003721
ENSMUSG00000000805 Car4 7.1546275 11.026463 −0.624022 3.42E-06 0.000386
ENSMUSG00000024998 Plce1 0.7324494 1.1872262 −0.696794 3.41E-06 0.000386
ENSMUSG00000021260 Hhipl1 0.6759403 2.1260714 −1.653222 4.17E-06 0.0004511
ENSMUSG00000073125 Xlr3b 0.0417671 0.3628541 −3.118952 5.40E-06 0.0005611
ENSMUSG00000102465 Gm38198 5.381579 8.3222294 −0.628941 5.89E-06 0.0005935
ENSMUSG00000019817 Plagl1 0.5085594 0.9412472 −0.888157 6.22E-06 0.0006206
ENSMUSG00000078606 Gm4070 0.8009457 1.4839985 −0.889713 6.81E-06 0.0006699
ENSMUSG00000073418 C4b 2.345801 3.7833854 −0.689597 7.94E-06 0.0007536
ENSMUSG00000033730 Egr3 7.7375739 13.22392 −0.773197 9.65E-06 0.0008705
ENSMUSG00000036357 Gpr101 1.6997205 3.0062153 −0.822651 9.67E-06 0.0008705
ENSMUSG00000045868 Gvin1 0.957694 1.7212828 −0.845848 9.86E-06 0.0008831
ENSMUSG00000026072 Il1r1 1.4651284 2.3646069 −0.690573 1.08E-05 0.0009446
ENSMUSG00000032572 Col6a4 0.0624639 0.3461836 −2.470443 1.10E-05 0.0009549
ENSMUSG00000072676 Tmem254a 0.5550245 1.596114 −1.52394 1.12E-05 0.0009697
ENSMUSG00000046215 Rprml 19.080628 29.071677 −0.607506 1.30E-05 0.0011094
ENSMUSG00000030877 4933427G17Rik 0.1766952 1.0163118 −2.524008 1.52E-05 0.0012533
ENSMUSG00000075270 Pde11a 1.7476556 2.903545 −0.732395 1.59E-05 0.001295
ENSMUSG00000038793 Lefty1 1.8650257 4.0304326 −1.111739 1.84E-05 0.0014521
ENSMUSG00000050271 D8Ertd82e 1.0316876 1.6804305 −0.703825 2.06E-05 0.0015863
ENSMUSG00000049577 Zfpm1 3.708777 5.7812023 −0.640426 2.08E-05 0.0015955
ENSMUSG00000097141 Gm10524 3.5140602 6.6409369 −0.918248 2.16E-05 0.0016369
ENSMUSG00000072680 Tmem254c 0.6184067 1.9103469 −1.627207 2.62E-05 0.0019264
ENSMUSG00000074934 Grem1 1.0848422 2.2677239 −1.06376 2.80E-05 0.0020321
ENSMUSG00000022018 Rgcc 12.574418 20.589241 −0.711399 3.26E-05 0.0022636
ENSMUSG00000036856 Wnt4 1.0262968 2.1590117 −1.072923 3.82E-05 0.0025544
ENSMUSG00000050074 Spink8 3.1122839 6.547285 −1.072923 3.82E-05 0.0025544
ENSMUSG00000039706 Ldb2 1.9941852 3.2031902 −0.68371 4.12E-05 0.0027233
ENSMUSG00000078137 Ankrd63 1.5294515 2.7127453 −0.826739 5.82E-05 0.0036436
ENSMUSG00000005958 Ephb3 1.4756735 2.2838844 −0.630116 6.12E-05 0.0037987
ENSMUSG00000078922 Tgtp1 0.1026696 0.6228395 −2.600852 6.68E-05 0.0040471
ENSMUSG00000032925 Itgbl1 0.967797 1.7808684 −0.879805 6.80E-05 0.0040878
ENSMUSG00000051435 Fhad1 0.4853785 1.0374421 −1.095849 7.30E-05 0.004351
ENSMUSG00000075284 Wipf1 0.5486925 1.0620244 −0.952747 7.77E-05 0.0045929
ENSMUSG00000095562 Gm21887 2.5026425 5.490305 −1.133434 8.58E-05 0.0049442
ENSMUSG00000079022 Col22a1 0.3530049 0.7650955 −1.115952 0.000117 0.0064454
ENSMUSG00000001870 Ltbp1 0.5714603 0.9680695 −0.760457 0.0001194 0.0065125
ENSMUSG00000028172 Tacr3 0.2080382 0.8412479 −2.015682 0.0001248 0.0067355
ENSMUSG00000102407 Gm37862 4.6344067 7.2189348 −0.639401 0.0001657 0.0086999
ENSMUSG00000053128 Rnf26 1.2120026 1.8837514 −0.636216 0.0001842 0.0094599
ENSMUSG00000086902 Gm11728 0.8433509 3.1156524 −1.885329 0.0001841 0.0094599
ENSMUSG00000050511 Oprd1 2.724796 4.3070121 −0.660539 0.000186 0.0095277
ENSMUSG00000090066 1110002E22Rik 0.3834034 0.775228 −1.015758 0.000199 0.0100245
ENSMUSG00000002944 Cd36 0.0234352 0.2106132 −3.167848 0.0002368 0.0114672
ENSMUSG00000102386 2900022M07Rik 11.061809 17.201915 −0.636982 0.000263 0.0124171
ENSMUSG00000026890 Lhx6 1.2525381 1.9723975 −0.655096 0.0002755 0.0128412
ENSMUSG00000005716 Pvalb 7.1324289 10.943292 −0.617581 0.0002766 0.0128601
ENSMUSG00000078235 Fam43b 3.7732819 6.0964171 −0.692142 0.0002862 0.0132083
ENSMUSG00000029096 Htra3 0.0149068 0.2277448 −3.933375 0.0002895 0.0132559
ENSMUSG00000032269 Htr3a 3.0070845 5.2358214 −0.80005 0.0003181 0.0142605
ENSMUSG00000050534 Htr5b 1.2638996 2.9076496 −1.201972 0.0003571 0.015611
ENSMUSG00000001103 Sebox 0.825012 1.9771303 −1.260921 0.0004011 0.0170936
ENSMUSG00000036446 Lum 1.1786245 2.6267616 −1.156181 0.0004193 0.0177444
ENSMUSG00000075316 Scn9a 0.3132207 0.5406202 −0.787436 0.0004671 0.0192225
ENSMUSG00000053093 Myh7 0.2539611 0.5751211 −1.179258 0.0004948 0.0201215
ENSMUSG00000085565 Gm15721 0 0.3189092 #NAME? 0.0005046 0.0203497
ENSMUSG00000049493 Pls1 1.399529 2.4514467 −0.808692 0.0005387 0.0213035
ENSMUSG00000005397 Nid1 1.553279 2.4427858 −0.65321 0.000576 0.0226093
ENSMUSG00000021367 Edn1 0.2503885 1.0126457 −2.015889 0.0005889 0.0229472
ENSMUSG00000060402 Chst8 0.7692233 1.2923727 −0.748548 0.0006317 0.0243015
ENSMUSG00000039059 Hrh3 1.2506494 1.916005 −0.615424 0.0006386 0.0245201
ENSMUSG00000036915 Kirrel2 0.360044 0.7909152 −1.13535 0.0006737 0.0254718
ENSMUSG00000055972 2810407A14Rik 0.0505391 0.4087904 −3.015889 0.0007681 0.0286118
ENSMUSG00000021798 Ldb3 0.2229812 0.61547 −1.464766 0.0008079 0.0294995
ENSMUSG00000012296 Tjap1 3.2044151 5.0475271 −0.655516 0.0008417 0.030237
ENSMUSG00000050022 Amz1 0.6373296 1.0685479 −0.74554 0.0008496 0.0304674
ENSMUSG00000023918 Adgrf4 0.3287518 0.8493919 −1.369431 0.0008714 0.0310926
ENSMUSG00000031549 Ido2 0.0470734 0.2820339 −2.582886 0.0009088 0.0318357
ENSMUSG00000040852 Plekhh2 1.235951 1.9532955 −0.660289 0.0009138 0.0319563
ENSMUSG00000100303 2600014E21Rik 0.0949507 0.2986401 −1.653158 0.0009368 0.0325985
ENSMUSG00000024565 Sall3 0.3409566 0.7404627 −1.118839 0.0009501 0.0330088
ENSMUSG00000048200 Cracr2b 0.1215388 0.4733226 −1.961407 0.0009573 0.0330959
ENSMUSG00000001506 Col1a1 0.7759423 1.3439044 −0.792409 0.0009987 0.0343012
ENSMUSG00000086873 Gm15672 0 0.7141694 #NAME? 0.0010036 0.0344168
ENSMUSG00000028885 Smpdl3b 0.73149 1.9282666 −1.398394 0.0010158 0.0347666
ENSMUSG00000042425 Frmpd3 1.1972007 2.1756713 −0.861796 0.0010215 0.0348465
ENSMUSG00000033880 Lgals3bp 0.7918202 1.5451558 −0.964508 0.0010524 0.0354552
ENSMUSG00000032109 Nlrx1 1.4814639 2.4908971 −0.749642 0.0010762 0.0359733
ENSMUSG00000041633 Kctd12b 0.8244747 1.4990826 −0.862533 0.0010905 0.0362858
ENSMUSG00000047419 Cmya5 0.8915644 1.3427781 −0.59081 0.0011048 0.0366969
ENSMUSG00000021943 Gdf10 1.7559262 3.2260986 −0.877558 0.0011217 0.036981
ENSMUSG00000040856 Dlk1 0.0466162 0.1623244 −1.799976 0.0011848 0.038389
ENSMUSG00000074873 AI606181 1.4694749 2.6725563 −0.86292 0.0012829 0.0405048
ENSMUSG00000054453 Sytl5 2.8484561 4.6993022 −0.722266 0.001308 0.0409845
ENSMUSG00000107115 Gm43052 1.4421544 3.0779731 −1.093755 0.0013108 0.0409845
ENSMUSG00000054072 Iigp1 0.62687 1.4365474 −1.196367 0.0013235 0.0411792
ENSMUSG00000000739 Sult5a1 0.0636011 0.4858457 −2.933375 0.0013738 0.0422495
ENSMUSG00000021469 Msx2 0.0486417 0.3715717 −2.933375 0.0013738 0.0422495
ENSMUSG00000042489 Clspn 0.1287045 0.3566211 −1.47033 0.0015953 0.0479824
ENSMUSG00000104860 Gm42510 0.1732834 0.817611 −2.238281 0.0016407 0.0489624
UP-REGULATED GENES
ENSMUSG00000038155 Gstp2 23.757467 3.0826513 2.9461374 8.39E-31 5.91E-27
ENSMUSG00000097451 Rian 40.347123 23.087851 0.8053319 8.45E-30 4.47E-26
ENSMUSG00000058126 Tpm3-rs7 11.240998 2.2541321 2.3181261 1.47E-29 6.23E-26
ENSMUSG00000102657 Gm37899 6.0712625 2.6826188 1.1783545 1.27E-20 2.98E-17
ENSMUSG00000059898 Dsc3 1.4567613 0.1491449 3.2879778 5.06E-16 8.24E-13
ENSMUSG00000070695 Cntnap5a 16.955086 10.682688 0.6664434 6.02E-15 7.49E-12
ENSMUSG00000036907 C1ql2 62.412139 37.84579 0.7216938 1.26E-14 1.48E-11
ENSMUSG00000071793 2610005L07Rik 17.288537 10.092946 0.7764684 3.46E-13 3.33E-10
ENSMUSG00000045573 Penk 15.77819 7.5352583 1.0662028 4.73E-13 4.36E-10
ENSMUSG00000058626 Capn11 1.9167958 0.1538104 3.6394717 5.20E-13 4.58E-10
ENSMUSG00000044071 Fam19a2 34.610743 22.380722 0.6289633 1.62E-12 1.18E-09
ENSMUSG00000052942 Glis3 5.4254751 3.1556836 0.7817969 3.14E-12 2.01E-09
ENSMUSG00000060803 Gstp1 87.486572 50.865489 0.7823745 4.10E-12 2.48E-09
ENSMUSG00000053819 Camk2d 1.4764576 0.8663897 0.7690518 4.91E-12 2.88E-09
ENSMUSG00000029311 Hsd17b11 7.985139 3.8603376 1.0485905 1.69E-11 8.34E-09
ENSMUSG00000062151 Unc13c 2.7838588 1.4295702 0.9615046 6.27E-11 2.95E-08
ENSMUSG00000026278 Bok 13.041501 7.4492831 0.8079364 2.15E-10 8.12E-08
ENSMUSG00000048047 Zbtb33 3.6364606 1.9482001 0.9003931 2.74E-10 9.81E-08
ENSMUSG00000051985 Igfn1 0.4683386 0.0701504 2.7390283 6.59E-09 1.86E-06
ENSMUSG00000024211 Grm8 1.1899464 0.5102175 1.2217123 1.47E-08 3.70E-06
ENSMUSG00000097312 Gm26870 1.0391809 0.1262102 3.0415465 7.45E-08 1.53E-05
ENSMUSG00000042567 Nek10 3.4050952 1.7816123 0.9345117 8.62E-08 1.75E-05
ENSMUSG00000019997 Ctgf 2.0980084 0.7763353 1.4342687 1.23E-07 2.41E-05
ENSMUSG00000021303 Gng4 8.1073368 4.5000252 0.849295 1.26E-07 2.45E-05
ENSMUSG00000035131 Brinp3 2.8082278 1.6059587 0.8062252 1.74E-07 3.18E-05
ENSMUSG00000063954 Hist2h2aa2 63.734222 38.128119 0.7412129 2.39E-07 4.18E-05
ENSMUSG00000097230 Gm26853 15.246984 10.150365 0.5869923 2.89E-07 4.94E-05
ENSMUSG00000096995 2810029C07Rik 8.7791467 4.3730355 1.0054457 3.53E-07 5.70E-05
ENSMUSG00000028648 Ndufs5 39.922194 26.017343 0.6177174 3.69E-07 5.83E-05
ENSMUSG00000059203 I11rap12 1.2364772 0.4273698 1.5326789 7.35E-07 0.0001066
ENSMUSG00000051136 Ghsr 1.6991839 0.5949242 1.5140643 1.07E-06 0.0001478
ENSMUSG00000103914 Gm38073 1.1744307 0.2638432 2.1542089 1.70E-06 0.0002166
ENSMUSG00000040569 Slc26a7 0.3654985 0.0142764 4.6781573 1.76E-06 0.0002218
ENSMUSG00000108088 RP24-385J11.1 14.907757 9.5440336 0.6433922 2.85E-06 0.0003336
ENSMUSG00000078958 Atp6ap1l 0.8108886 0.0331145 4.6139705 3.34E-06 0.0003822
ENSMUSG00000040473 Cfap69 1.7048071 0.9877702 0.7873611 4.14E-06 0.000451
ENSMUSG00000046818 Ddit4l 3.802808 1.8567163 1.0343117 5.84E-06 0.0005935
ENSMUSG00000029622 Arpc1b 1.7264657 0.8850166 0.9640452 8.07E-06 0.0007618
ENSMUSG00000104343 5730408A14Rik 7.8302722 4.0485645 0.951652 8.58E-06 0.0008032
ENSMUSG00000034295 Fhod3 3.7263115 2.1945351 0.7638329 1.59E-05 0.0012951
ENSMUSG00000032323 Cyp11a1 1.1502956 0.4494374 1.3558125 2.00E-05 0.0015485
ENSMUSG00000015217 Hmgb3 4.7493582 2.6051959 0.8663407 2.52E-05 0.0018551
ENSMUSG00000029335 Bmp3 1.1143181 0.5789269 0.944708 2.90E-05 0.0020905
ENSMUSG00000038242 Aox4 0.4190221 0.1062038 1.9801914 2.96E-05 0.0021251
ENSMUSG00000031297 Slc7a3 1.9681051 1.014805 0.9556046 3.18E-05 0.0022151
ENSMUSG00000102760 Gm37258 5.17083 2.2693611 1.1881097 3.38E-05 0.0023297
ENSMUSG00000028883 Sema3a 0.6547767 0.3369588 0.9584308 3.87E-05 0.0025809
ENSMUSG00000010122 Slc47a1 0.7393762 0.1845685 2.0021525 4.90E-05 0.0031498
ENSMUSG00000096401 Gm21811 32.713415 21.552431 0.6020317 4.94E-05 0.0031551
ENSMUSG00000006931 P3h4 5.4143505 2.9267072 0.8875099 6.56E-05 0.0040147
ENSMUSG00000029843 Slc13a4 2.009392 1.0649389 0.9159884 7.91E-05 0.0046565
ENSMUSG00000098900 Gm18190 3.4097591 0.7396174 2.2048188 7.99E-05 0.004663
ENSMUSG00000031654 Cbln1 1.0749988 0.3370022 1.673505 8.23E-05 0.0047601
ENSMUSG00000029687 Ezh2 2.2360547 1.3881729 0.6877682 9.58E-05 0.0054187
ENSMUSG00000030092 Cntn6 1.452663 0.7853919 0.8872153 9.93E-05 0.0055888
ENSMUSG00000063087 Gm10125 1.7129088 0.976673 0.8105008 0.0001025 0.0057534
ENSMUSG00000089714 Gm16092 1.3829571 0.36553 1.9196948 0.0001248 0.0067355
ENSMUSG00000095730 Vmn2r29 2.8288498 1.2710985 1.1541398 0.000137 0.0073028
ENSMUSG00000038252 Ncapd2 2.8972102 1.903396 0.6060886 0.0001432 0.0076141
ENSMUSG00000047904 Sstr2 3.957747 2.476635 0.6762981 0.0001986 0.0100245
ENSMUSG00000035258 Abi3bp 0.5578211 0.1113993 2.3240617 0.0002191 0.0107574
ENSMUSG00000060678 Hist1h4c 41.358725 25.371849 0.704963 0.0002717 0.0127098
ENSMUSG00000038775 Vill 0.3915239 0.1005329 1.9614329 0.0003511 0.0154443
ENSMUSG00000046719 Nxph3 4.8935604 2.6385975 0.8911132 0.0003569 0.015611
ENSMUSG00000107567 RP23-279L13.2 2.4131539 0.5004515 2.2696178 0.0003602 0.015714
ENSMUSG00000084799 Ino80dos 2.7823365 1.5710203 0.8245951 0.0004015 0.0170936
ENSMUSG00000043773 1700048O20Rik 3.6341623 1.6061503 1.178016 0.0004207 0.0177488
ENSMUSG00000036412 Arsi 1.085107 0.3250371 1.7391611 0.0004461 0.0185056
ENSMUSG00000028970 Abcb1b 1.0376385 0.5683707 0.8683997 0.0004955 0.0201215
ENSMUSG00000090272 Mndal 2.0502162 1.1230144 0.8683997 0.0004955 0.0201215
ENSMUSG00000032291 Crabp1 1.4637327 0 Inf 0.0005046 0.0203497
ENSMUSG00000062393 Dgkk 0.1068457 0 Inf 0.0005046 0.0203497
ENSMUSG00000032387 Rbpms2 0.8481075 0.2365363 1.8421857 0.0005304 0.0210926
ENSMUSG00000038257 Glra3 1.0495858 0.4366758 1.2651856 0.0005788 0.0226653
ENSMUSG00000103313 Gm38357 3.2555465 1.6412155 0.9881351 0.0005795 0.0226653
ENSMUSG00000068696 Gpr88 0.5517432 0.1077955 2.3556999 0.0005953 0.0231542
ENSMUSG00000068962 Zfp114 1.1374987 0.5943184 0.936557 0.0006082 0.0235238
ENSMUSG00000042268 Slc26a9 0.4867703 0.1458118 1.7391332 0.0007638 0.0285014
ENSMUSG00000027932 Slc27a3 2.1175637 1.2478491 0.7629619 0.0007765 0.0288737
ENSMUSG00000059852 Kcng2 5.381946 3.579995 0.5881703 0.0008809 0.0313238
ENSMUSG00000073164 2410018L13Rik 0.9635881 0.4768918 1.0147546 0.0009363 0.0325985
ENSMUSG00000053714 4732471J01Rik 2.9049679 1.8600372 0.6431907 0.0009946 0.0342163
ENSMUSG00000027792 Bche 1.2099084 0.6752757 0.8413494 0.001076 0.0359733
ENSMUSG00000016918 Sulf1 0.611746 0.3483563 0.8123692 0.0012599 0.0400929
ENSMUSG00000045996 Polr2k 15.618181 9.8627626 0.6631627 0.0013219 0.0411792
ENSMUSG00000074283 Zfp109 1.9004964 1.1603279 0.7118437 0.0013482 0.0417029
ENSMUSG00000073542 Cep76 3.0731451 1.8779762 0.7105371 0.0015965 0.0479824

Table 3.

Gene Ontology analysis of down-regulated genes under Utx conditional knockout.

ID Name p-Value FDR B&H FDR B&Y Bonferroni Number of genes from input Number of genes in annotation
GO:0007268 Synaptic transmission 1.14E−06 2.95E−04 2.61E−03 4.43E−03 21 680
GO:0043269 Regulation of ion transport 3.42E−06 5.16E−04 4.57E−03 1.33E−02 20 669
GO:0006811 Ion transport 4.10E−06 5.69E−04 5.03E−03 1.59E−02 34 1627
GO:0005509 Calcium ion binding 9.15E−05 2.67E−02 1.92E−01 6.76E−02 18 710
GO:0097458 Neuron part 1.93E−05 1.04E−03 6.80E−03 7.31E−03 31 1552
GO:0043005 Neuron projection 6.97E−05 1.65E−03 1.08E−02 2.64E−02 25 1199
GO:0044456 Synapse part 7.18E−04 1.01E−02 6.57E−02 2.72E−01 16 714
GO:0045202 Synapse 9.14E−04 1.16E−02 7.53E−02 3.47E−01 18 876
GO:0043025 Neuronal cell body 1.44E−03 1.65E−02 1.08E−01 5.45E−01 14 620
GO:0097060 Synaptic membrane 1.59E−03 1.72E−02 1.12E−01 6.01E−01 9 300
GO:0030425 Dendrite 2.70E−03 2.43E−02 1.59E−01 1.00E+00 13 592

We then further examined some of those down-regulated genes relevant for synaptic plasticity and cognition found to be altered by RNA-seq. Using RT-qPCR, we verified that several genes critical for synaptic plasticity, and/or dendrite development including nitric oxide synthase 1 (Nos1), actin filament cross-linker α-Actinin-2 (Actn2), zinc finger transcription factor Egr3, transforming growth factor-β2 (Tgfb2), and Wnt4 were down-regulated in the hippocampus of Utx cKO mice (Figure 7D). Several other essential genes (Gpr88 and Edn1) involved in mental disorder, learning, and memory were also suppressed in the hippocampus of Utx cKO mice (Figure 7D). Amongst the down-regulated genes, we were particularly interested in Htr5b, a functionally unknown serotonin receptor. Serotonin and its receptors have been implicated in dendrite morphology, synaptic transmission and cognition (Wirth et al., 2016). To validate the results from RNA-seq analysis, we conducted qPCR and western blotting analyses and observed that Utx deletion significantly decreased expression of Htr5b in the hippocampus of cKO mice (Figures 7D–F). To further verify whether H3K27me3 enriches on the promoter of Htr5b, we performed ChIP analysis and found that H3K27me3 was enriched in the promoter region of Htr5b (Figure 7G), suggesting that Utx mediated H3K27me3 demethylase activity is required for the alteration in Htr5b in the hippocampus.

Htr5b modulates neuronal morphology, and its gain-of-function rescues the impairment of neuronal morphology in Utx cKO neurons

The serotonergic system is involved in many aspects of neural development, including neurite outgrowth, somatic morphology regulation, synaptogenesis, and control of dendritic spine shape and density (Wirth et al., 2016). To examine a functional relationship between Utx and Htr5b in mediating neural development, newborn hippocampal neurons from WT mice were transfected with lentivirus expressing both GFP and Htr5b shRNA sequences to suppress Htr5b at both mRNA and protein levels (Figures 8A,B). Knockdown of Htr5b resulted in a significant reduction in total dendritic length (Figures 8C,D) and spine density (Figures 8H,I). Given the fact that the expression level of Htr5b is decreased in Utx cKO mice that displayed neuronal morphological abnormalities (Figures 7E,F), we reasoned whether Htr5b gain-of-function could rescue neural development deficits in Utx cKO neurons. To test this assumption, exogenous Htr5b was expressed in Utx cKO newborn hippocampal neurons. Interestingly, Htr5b gain-of-function in cKO neurons was sufficient to restore the dendritic length (Figures 8E–G) and spine density (Figures 8J,K). These results suggest that Htr5b is a functional downstream target of Utx in modulating neuronal growth and morphology.

Figure 8.

Figure 8

Restoring Htr5b in the hippocampal neurons of Utx cKO mice rescues morphological impairment. (A) Htr5b mRNA was decreased in newborn hippocampal neurons infected with Lenti-virus expressing Htr5b shRNA [Three independent experiments; two-tailed t-test: t(4) = 18.03, P < 0.001]. (B) Western blotting for testing Htr5b protein levels in newborn hippocampal neurons infected with Lenti-virus expressing Htr5b shRNA. (C) Representative images of GFP (Green) and Map2 (Red) double positive neurons expressing either GFP or Htr5b shRNA in WT newborn hippocampal neurons (DIV7). Scale bars, 50 μm. (D) Quantification of dendritic length after Htr5b knockdown in WT newborn hippocampal neurons (DIV7) [WT, 56 neurons from 5 mice, cKO, 46 neurons from 4 mice; two-tailed t-test: t(7) = 2.487, P = 0.0418]. (E) Representative images of GFP (Green) and Map2 (Red) double positive neurons expressing either GFP or Htr5b in WT or cKO newborn hippocampal neurons (DIV7). Scale bars, 50 μm. (F) Western blotting for testing Htr5b protein levels in newborn hippocampal neurons infected with Lenti-Htr5b overexpression virus. (G) Htr5b overexpression rescued the deficits of the dendritic length in cKO newborn hippocampal neurons (DIV7) [WT, 56 neurons from 5 mice; cKO, 29 neurons from 3 mice; KO+Htr5b, 44 neurons from 4 mice; One-way ANOVA: F(2, 9) = 14.17, P = 0.0017]. (H) Representative images of spines from Map2 stained secondary dendrites of WT and cKO P0 hippocampal neurons (DIV19) expressing either GFP or Htr5b protein. Scale bars, 2 μm. (I) Htr5b knockdown resulted in the lower dendritic spine density in newborn hippocampal neurons (DIV7). (J) Representative images of spines from Map2 stained secondary dendrites of WT and cKO hippocampal neurons (DIV19) expressing either GFP or exogenous Htr5b protein. Scale bars, 2 μm. (K) Htr5b overexpression reversed the lower dendritic spine density in cKO neurons to similar levels of WT neurons (DIV19). Scale bars, 2 μm. *P < 0.05, **P < 0.01, ***P < 0.001. Error bars, s.e.m.

Discussion

Recent human genetic findings indicate that epigenetic modifications, including histone methylation, are important regulators of neural development (Portela and Esteller, 2010). However, the underlying mechanisms remain largely unknown. Histone H3 lysine 27 demethylase Utx has been identified as a Kabuki syndrome-risk gene in patients with intellectual disability (Lederer et al., 2012; Miyake et al., 2013). Here, we demonstrate for the first time that forebrain deletion of Utx in mice leads to anxiety-like behaviors, spatial learning, and memory impairments. We further demonstrated that Utx deficiency impairs neuronal morphology and hippocampal synaptic transmission, providing novel evidence for the involvement of Utx in neural development and cognitive behaviors.

Regulation of neuronal development, such as dendrite and spine development, in the brain is critically important in a variety of physiological and pathological conditions (Hering and Sheng, 2001; de la Torre-Ubieta and Bonni, 2011). For instance, mental disorders and alterations in learning and memory are frequently accompanied by analogous modifications of dendrite and spine (Beique et al., 2006). In the present study, we provided evidence for the first time both in vivo and in vitro that UTX is involved in the regulation of neuronal morphogenesis, including spine density and dendrite complexity. In particular, specific deletion of Utx in embryonic nervous system or down-regulation of Utx in adult hippocampus caused abnormal behavioral phenotypes, including anxiety-like behaviors and impairments in learning and memory, which may underscore congenital anomalies in Kabuki syndrome patients. Our study might shed new light on the understanding of epigenetic regulation, especially histone modification in neural development and cognitive behaviors. Since Utx is also expressed in other cell types (Smith et al., 2014), it would be interesting to explore if loss of Utx demethylase activity in non-neuronal cells also contributes to impairments in mood and cognition, as observed in Utx cKO mice.

LTP is widely considered to represent a cellular mechanism for the formation of specific types of anxiety-related behaviors, learning, and memory (Lisman and Raghavachari, 2006). Impaired LTP has been found in several anxiety animal models (Bannerman et al., 2014). In agreement with our behavioral results, we found that deletion of Utx significantly impairs LTP at CA3-CA1 synapses in the hippocampus, further confirming that Utx is an important modulator for neuronal behaviors. Cognitive abnormalities are closely correlated with altered synaptic transmission and plasticity in the hippocampus (Bannerman et al., 2014). AMPA-mediated mEPSCs are widely used to determine pre- and/or postsynaptic contribution to synaptic transmission and plasticity (Bekkers and Stevens, 1990). Utx cKO mice showed a decrease in the amplitude, but not the frequency, of mEPSCs, suggesting a postsynaptic defect in hippocampus (Xiao et al., 2007). Consistent with this finding, we observed a significant reduction of PSD-95, a key player in postsynaptic transmission (Beique et al., 2006). Our results suggest that impaired LTP and reduced amplitude of mEPSCs after Utx deletion lead to synaptic dysfunction, which, in turn, causes cognitive deficits in Utx cKO mice.

We observed that a null mutation of Utx caused mid-gestational lethality, which is consistent with the previous reports by others (Shpargel et al., 2012; Welstead et al., 2012). Male Utx-null mice can escape embryonic lethality, suggesting that this is likely due to the expression of Uty, a paralog that lacks H3K27 demethylase activity (Shpargel et al., 2012; Wang et al., 2012). However, the behavioral abnormalities observed in male Utx-null mice appeared not to be associated with Uty since we did not find any changes in Uty expression after Utx deletion in the brain, suggesting that Uty may not functionally compensate for Utx during neural development. In consistent with our observations, a recent study also showed that UTY cannot compensate for certain demethylase-dependent activities of UTX in T cell acute lymphoblastic leukemia (T-ALL) (Van der Meulen et al., 2015). Further studies in molecular and behavioral levels will be required to fully understand why male Utx-null mice can escape embryonic lethality and what functional role of Uty plays in the brain.

The involvement of the serotonin system in neural development has been well-established (Sparta and Stuber, 2014). Most serotonin receptor family members are known for their roles in mediating morphogenic signaling in neurons (Wirth et al., 2016) and cognition (Meneses, 1999). For example, several studies showed that Htr3 promotes neurite outgrowth in thalamic neurons as well as in PC12 cells (Homma et al., 2006). Serotonin 3A receptor is involved in learning, cognition, and emotion (Gatt et al., 2010). Our transcriptional profiling RT-PCR results revealed that expression of Htr5b, a calcium signaling related gene encoding serotonin 5B receptor, is decreased in the hippocampus of Utx cKO mice. While Htr5b is highly expressed in CNS (Meneses, 1999), the signaling pathways regulated by Htr5b in vivo are still not well-understood. This is largely due to the lack of proper receptor ligands (Wirth et al., 2016). More recently, there is evidence showing that Htr5b is a downstream target for transcription factor ATF-7, which mediates abnormal behaviors in mice (Maekawa et al., 2010). In that study, authors observed that ATF-7-deficient mice exhibit abnormal behaviors and increased Htr5b mRNA levels in the dorsal raphe nuclei (Maekawa et al., 2010). In the present study, we observed that knockout of Utx led to down-regulation of Htr5b and displaying anxiety-like behaviors and spatial learning and memory disability, suggesting that a balance in Htr5b expression levels would be critically important for maintaining the functional normality in the nervous system.

In addition to the observations made in vivo, we also found that down-regulation of Htr5b in cultured hippocampal neurons resulted in reduced dendritic length and spine density. Our results reveal a novel functional role of Htr5b in regulation of dendrite morphology development. Specifically, we observed that the deletion of Utx results in a decreased Htr5b associated with an increased H3K27me3 modification. ChIP assay showed high enrichment of H3K27me3 in the promoter region of Htr5b. These results suggest that regulation of Utx in Htr5b expression is likely mediated through demethylation of H3K27me3. Functionally, overexpression of Htr5b in cultured neurons could rescue the impairments in dendritic length and spine density induced by Utx deletion, suggesting that Htr5b is involved in UTX-mediated H3K27me3 de-methylation in regulation of neuronal morphology. Our findings provide a novel mechanism underlying the role of Utx in neural development, synaptic transmission, and cognition. Assessment of behavioral performance by modulating H3k27me3 levels in genetically animal models together with UTX inhibitors would provide more insights into the mechanisms underlying H3K27me3 modification in cognitive function, which remains to be studied.

In summary, we show here that H3K27 demethylase enzyme Utx loss-of-function contributes to impairments in neuronal development and synaptic plasticity, which are responsible for mood and cognitive deficits in Utx cKO mice. Given the fact that behavior changes in Utx loss-of-function mice replicate some symptoms in human Kabuki patients, Utx cKO mouse models like ours therefore provide a valuable means to study the underlying mechanisms of the etiology of Kabuki syndrome, and to develop novel clinical implications.

Significance statement

Trimethylation of histone H3 lysine 27 (H3K27me3) establishes a repressive chromatin state in silencing gene expression. The demethylases UTX mediates the removal of H3K27me2/3 to establish a mechanistic switch to activate large sets of genes. Moreover, defects in UTX cause Kabuki syndrome characterized by congenital anomaly and mental retardation. We discovered that deletion of UTX in the brain results in increased anxiety-like behaviors, impaired spatial learning and memory, and neuronal morphology deficiency in mice. UTX regulates a subset of genes that are associated with dendritic morphology, synaptic transmission, and cognition. This study enhances our understanding the cognitive and developmental deficits in Kabuki syndrome.

Author contributions

GT, ZT, and CL designed research; GT, YZ, and PL performed the majority of the experiments; TM and LY performed the electrophysiological recordings; SZ, SD, QT, YX, HY, and HD contributed to collection and assembly of data; GT, ZT, and CL wrote the paper; CL, FZ, and ZT supervised the research.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

We thank Prof. Chu Chen at Louisiana State University Health Sciences Center for editing the manuscript. This work was supported by grants from the National Science Foundation of China (grant nos. 31571043 to CL. and 81571212 to ZT), the National Key Research and Development Program of China Project (grant no. 2016YFA0101402 to CL), State Key Laboratory of Stem Cell and Reproductive Biology, and the Hundred Talents Program of CAS.

References

  1. Agger K., Cloos P. A., Christensen J., Pasini D., Rose S., Rappsilber J., et al. (2007). UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature 449, 731–734. 10.1038/nature06145 [DOI] [PubMed] [Google Scholar]
  2. Bannerman D. M., Sprengel R., Sanderson D. J., McHugh S. B., Rawlins J. N., Monyer H., et al. (2014). Hippocampal synaptic plasticity, spatial memory and anxiety. Nat. Rev. Neurosci. 15, 181–192. 10.1038/nrn3677 [DOI] [PubMed] [Google Scholar]
  3. Beique J. C., Lin D. T., Kang M. G., Aizawa H., Takamiya K., Huganir R. L. (2006). Synapse-specific regulation of AMPA receptor function by PSD-95. Proc. Natl. Acad. Sci. U.S.A. 103, 19535–19540. 10.1073/pnas.0608492103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bekkers J. M., Stevens C. F. (1990). Presynaptic mechanism for long-term potentiation in the hippocampus. Nature 346, 724–729. 10.1038/346724a0 [DOI] [PubMed] [Google Scholar]
  5. Costall B., Domeney A. M., Kelly M. E., Tomkins D. M., Naylor R. J., Wong E. H., et al. (1993). The effect of the 5-HT3 receptor antagonist, RS-42358-197, in animal models of anxiety. Eur. J. Pharmacol. 234, 91–99. 10.1016/0014-2999(93)90710-Y [DOI] [PubMed] [Google Scholar]
  6. de la Torre-Ubieta L., Bonni A. (2011). Transcriptional regulation of neuronal polarity and morphogenesis in the mammalian brain. Neuron 72, 22–40. 10.1016/j.neuron.2011.09.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Eichenbaum H. (2004). Hippocampus: cognitive processes and neural representations that underlie declarative memory. Neuron 44, 109–120. 10.1016/j.neuron.2004.08.028 [DOI] [PubMed] [Google Scholar]
  8. Etchegaray J. P., Yang X. M., DeBruyne J. P., Peters A. H. F. M., Weaver D. R., Jenuwein T., et al. (2006). The polycomb group protein EZH2 is required for mammalian circadian clock function. J. Biol. Chem. 281, 21209–21215. 10.1074/jbc.M603722200 [DOI] [PubMed] [Google Scholar]
  9. Gatt J. M., Nemeroff C. B., Schofield P. R., Paul R. H., Clark C. R., Gordon E., et al. (2010). Early life stress combined with serotonin 3A receptor and brain-derived neurotrophic factor valine 66 to methionine genotypes impacts emotional brain and arousal correlates of risk for depression. Biol. Psychiatry 68, 818–824. 10.1016/j.biopsych.2010.06.025 [DOI] [PubMed] [Google Scholar]
  10. Greenfield A., Carrel L., Pennisi D., Philippe C., Quaderi N., Siggers P., et al. (1998). The UTX gene escapes X inactivation in mice and humans. Hum. Mol. Genet. 7, 737–742. 10.1093/hmg/7.4.737 [DOI] [PubMed] [Google Scholar]
  11. Hering H., Sheng M. (2001). Dendritic spines: structure, dynamics and regulation. Nat. Rev. Neurosci. 2, 880–888. 10.1038/35104061 [DOI] [PubMed] [Google Scholar]
  12. Homma K., Kitamura Y., Ogawa H., Oka K. (2006). Serotonin induces the increase in intracellular Ca2+ that enhances neurite outgrowth in PC12 cells via activation of 5-HT3 receptors and voltage-gated calcium channels. J. Neurosci. Res. 84, 316–325. 10.1002/jnr.20894 [DOI] [PubMed] [Google Scholar]
  13. Huang D. W., Sherman B. T., Lempicki R. A. (2009). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, 44–57. 10.1038/nprot.2008.211 [DOI] [PubMed] [Google Scholar]
  14. Lederer D., Grisart B., Digilio M. C., Benoit V., Crespin M., Ghariani S. C., et al. (2012). Deletion of KDM6A, a histone demethylase interacting with MLL2, in three patients with Kabuki syndrome. Am. J. Hum. Genet. 90, 119–124. 10.1016/j.ajhg.2011.11.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lee M. G., Villa R., Trojer P., Norman J., Yan K. P., Reinberg D., et al. (2007). Demethylation of H3K27 regulates polycomb recruitment and H2A ubiquitination. Science 318, 447–450. 10.1126/science.1149042 [DOI] [PubMed] [Google Scholar]
  16. Li J., Hart R. P., Mallimo E. M., Swerdel M. R., Kusnecov A. W., Herrup K. (2013). EZH2-mediated H3K27 trimethylation mediates neurodegeneration in ataxia-telangiectasia. Nat. Neurosci. 16, 1745–1753. 10.1038/nn.3564 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Liao D., Hessler N. A., Malinow R. (1995). Activation of postsynaptically silent synapses during pairing-induced LTP in CA1 region of hippocampal slice. Nature 375, 400–404. 10.1038/375400a0 [DOI] [PubMed] [Google Scholar]
  18. Lisman J., Raghavachari S. (2006). A unified model of the presynaptic and postsynaptic changes during LTP at CA1 synapses. Sci. STKE 2006:re11. 10.1126/stke.3562006re11 [DOI] [PubMed] [Google Scholar]
  19. Ma D. K., Marchetto M. C., Guo J. U., Ming G.-L., Gage F. H., Song H. (2010). Epigenetic choreographers of neurogenesis in the adult mammalian brain. Nat. Neurosci. 13, 1338–1344. 10.1038/nn.2672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Maekawa T., Kim S., Nakai D., Makino C., Takagi T., Ogura H., et al. (2010). Social isolation stress induces ATF-7 phosphorylation and impairs silencing of the 5-HT 5B receptor gene. EMBO J. 29, 184–195. 10.1038/emboj.2009.318 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Mansour A. A., Gafni O., Weinberger L., Zviran A., Ayyash M., Rais Y., et al. (2012). The H3K27 demethylase Utx regulates somatic and germ cell epigenetic reprogramming. Nature 488, 409–413. 10.1038/nature11272 [DOI] [PubMed] [Google Scholar]
  22. Meneses A. (1999). 5-HT system and cognition. Neurosci. Biobehav. Rev. 23, 1111–1125. 10.1016/S0149-7634(99)00067-6 [DOI] [PubMed] [Google Scholar]
  23. Miyake N., Mizuno S., Okamoto N., Ohashi H., Shiina M., Ogata K., et al. (2013). KDM6A point mutations cause Kabuki syndrome. Hum. Mutat. 34, 108–110. 10.1002/humu.22229 [DOI] [PubMed] [Google Scholar]
  24. Pereira J. D., Sansom S. N., Smith J., Dobenecker M.-W., Tarakhovsky A., Livesey F. J. (2010). Ezh2, the histone methyltransferase of PRC2, regulates the balance between self-renewal and differentiation in the cerebral cortex. Proc. Natl. Acad. Sci. U.S.A. 107, 15957–15962. 10.1073/pnas.1002530107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Plath K., Fang J., Mlynarczyk-Evans S. K., Cao R., Worringer K. A., Wang H. B., et al. (2003). Role of histone H3 lysine 27 methylation in X inactivation. Science 300, 131–135. 10.1126/science.1084274 [DOI] [PubMed] [Google Scholar]
  26. Portela A., Esteller M. (2010). Epigenetic modifications and human disease. Nat. Biotechnol. 28, 1057–1068. 10.1038/nbt.1685 [DOI] [PubMed] [Google Scholar]
  27. Rodgers R. J., Dalvi A. (1997). Anxiety, defence and the elevated plus-maze. Neurosci. Biobehav. Rev. 21, 801–810. 10.1016/S0149-7634(96)00058-9 [DOI] [PubMed] [Google Scholar]
  28. Shpargel K. B., Sengoku T., Yokoyama S., Magnuson T. (2012). UTX and UTY demonstrate histone demethylase-independent function in mouse embryonic development. PLoS Genet 8:e1002964. 10.1371/journal.pgen.1002964 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Smith S. M., Kimyon R. S., Watters J. J. (2014). Cell-type-specific Jumonji histone demethylase gene expression in the healthy rat CNS: detection by a novel flow cytometry method. ASN Neuro 6, 193–207. 10.1042/AN20130050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sparmann A., van Lohuizen M. (2006). Polycomb silencers control cell fate, development and cancer. Nat. Rev. Cancer 6, 846–856. 10.1038/nrc1991 [DOI] [PubMed] [Google Scholar]
  31. Sparta D. R., Stuber G. D. (2014). Cartography of serotonergic circuits. Neuron 83, 513–515. 10.1016/j.neuron.2014.07.030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Tsankova N., Renthal W., Kumar A., Nestler E. J. (2007). Epigenetic regulation in psychiatric disorders. Nat. Rev. Neurosci. 8, 355–367. 10.1038/nrn2132 [DOI] [PubMed] [Google Scholar]
  33. Van der Meulen J., Sanghvi V., Mavrakis K., Durinck K., Fang F., Matthijssens F., et al. (2015). The H3K27me3 demethylase UTX is a gender-specific tumor suppressor in T-cell acute lymphoblastic leukemia. Blood 125, 13–21. 10.1182/blood-2014-05-577270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Van der Meulen J., Speleman F., Van Vlierberghe P. (2014). The H3K27me3 demethylase UTX in normal development and disease. Epigenetics 9, 658–668. 10.4161/epi.28298 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. van Haaften G., Dalgliesh G. L., Davies H., Chen L., Bignell G., Greenman C., et al. (2009). Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer. Nat. Genet. 41, 521–523. 10.1038/ng.349 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. von Schimmelmann M., Feinberg P. A., Sullivan J. M., Ku S. M., Badimon A., Duff M. K., et al. (2016). Polycomb repressive complex 2 (PRC2) silences genes responsible for neurodegeneration. Nat. Neurosci. 19, 1321–1330. 10.1038/nn.4360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Vorhees C. V., Williams M. T. (2006). Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 1, 848–858. 10.1038/nprot.2006.116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wang C. C., Lee J. E., Cho Y. W., Xiao Y., Jin Q. H., Liu C. Y., et al. (2012). UTX regulates mesoderm differentiation of embryonic stem cells independent of H3K27 demethylase activity. Proc. Natl. Acad. Sci. U.S.A. 109, 15324–15329. 10.1073/pnas.1204166109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Welstead G. G., Creyghton M. P., Bilodeau S., Cheng A. W., Markoulaki S., Young R. A., et al. (2012). X-linked H3K27me3 demethylase Utx is required for embryonic development in a sex-specific manner. Proc. Natl. Acad. Sci. U.S.A. 109, 13004–13009. 10.1073/pnas.1210787109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wirth A., Holst K., Ponimaskin E. (2016). How serotonin receptors regulate morphogenic signalling in neurons. Prog. Neurobiol. 151, 35–56. 10.1016/j.pneurobio.2016.03.007 [DOI] [PubMed] [Google Scholar]
  41. Xiao M., Xu L., Laezza F., Yamada K., Feng S., Ornitz D. M. (2007). Impaired hippocampal synaptic transmission and plasticity in mice lacking fibroblast growth factor 14. Mol. Cell. Neurosci. 34, 366–377. 10.1016/j.mcn.2006.11.020 [DOI] [PubMed] [Google Scholar]
  42. Xu J., Deng X. X., Watkins R., Disteche C. M. (2008). Sex-specific differences in expression of histone demethylases Utx and Uty in mouse brain and neurons. J. Neurosci. 28, 4521–4527. 10.1523/JNEUROSCI.5382-07.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Zhang J., Ji F., Liu Y., Lei X., Li H., Ji G., et al. (2014). Ezh2 regulates adult hippocampal neurogenesis and memory. J. Neurosci. 34, 5184–5199. 10.1523/JNEUROSCI.4129-13.2014 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Frontiers in Molecular Neuroscience are provided here courtesy of Frontiers Media SA

RESOURCES