Abstract
Background
Efficient gene editing is a critical tool for investigating molecular mechanisms of cellular processes and engineering organisms for numerous purposes ranging from biotechnology to medicine. Recently developed RNA-guided CRISPR/Cas9 technology has been used for efficient gene editing in various organisms, but has not been tested in a model filamentous fungus, Neurospora crassa.
Findings
In this report, we demonstrate efficient gene replacement in a model filamentous fungus, Neurospora crassa, with the CRISPR/Cas9 system. We utilize Cas9 endonuclease and single crRNA:tracrRNA chimeric guide RNA (gRNA) to: (1) replace the endogenous promoter of clr-2 with the β-tubulin promoter, and (2) introduce a codon optimized fire fly luciferase under the control of the gsy-1 promoter at the csr-1 locus. CLR-2 is one of the core transcription factors that regulate the expression of cellulases, and GSY-1 regulates the conversion of glucose into glycogen. We show that the β-tubulin promoter driven clr-2 strain shows increased expression of cellulases, and gsy-1-luciferase reporter strain can be easily screened with a bioluminescence assay.
Conclusion
CRISPR/Cas9 system works efficiently in Neurospora crassa, which may be adapted to Neurospora natural isolates and other filamentous fungi. It will be beneficial for the filamentous fungal research community to take advantage of CRISPR/Cas9 tool kits that enable genetic perturbations including gene replacement and insertions.
Electronic supplementary material
The online version of this article (doi:10.1186/s40694-015-0015-1) contains supplementary material, which is available to authorized users.
Keywords: Neurospora crassa, CRISPR/Cas9, Genome editing, Homologous recombination, Biofuel, Cellulase
Findings
Genetic engineering of organisms of interest are critical tools to elucidate molecular and cellular processes or to engineer organisms with new characteristics or traits. Clustered regularly interspaced short palindromic repeats (CRISPR)-associated RNA-guided DNA endonuclease, Cas9, has been driving the latest gene editing technology by taking advantage of the simple design of a single crRNA:tracrRNA chimeric guide RNA (gRNA). gRNA includes 20 base pairs of target sequences that causes double strand breaks by Cas9 at the target locus, which triggers gene replacement by homologous recombination (HR) [1–3] (reviewed by Hsu et al. [4]). CRISPR/Cas9 system has been utilized for gene editing ranging from yeast to human cells including filamentous fungi [5–8].
A model filamentous fungus, Neurospora crassa, has been used to elucidate fundamental molecular mechanisms including the one gene-one enzyme hypothesis, cell fusion, circadian rhythms, and epigenetics among others [9]. Gene editing by HR was a difficult task in N. crassa until the discovery of highly efficient gene replacement in Neurospora strains lacking mus-51 (NCU08290) or mus-52 (NCU00077), which are deficient in non-homologous end-joining [10]. This finding facilitated the high-throughput generation of single gene deletion knockout (KO) collection of N. crassa [11]. However, one has to backcross Neurospora transformants to wild type in order to eliminate mus-51 or mus-52 KO background, which may take anywhere between one to three months. More importantly, there are numerous Neurospora natural isolates that are difficult to generate initial mus-51 or mus-52 KO, which make gene editing difficult. Therefore, it is critical to establish an alternative gene editing technology for the Neurospora system.
The design of the CRISPR/Cas9 system consists of Cas9 DNA endonuclease and a guide RNA (gRNA) (Figure 1a). Cas9 is fused to the trpC (AN0648) promoter from the Aspergillus nidulans followed by both SV40 nuclear localization signal (NLS) domain and the trpC terminator sequence from the A. nidulans (Figure 1b) [12]. gRNA is fused to Small Nucleolar RNA 52 (SNR52) promoter from the Saccharomyces cerevisiae [13] and includes specific 20 base pair target sequences followed by gRNA structural component and SUP4 flanking region (Figure 1b). The promoter of SNR52 has been used to express gRNA in S. cerevisiae [14]. We designed target sequences for clr-2 (NCU08042) and csr-1 (NCU00726) loci followed by protospacer adjacent motif (PAM) (Figure 1c), which is required for target recognition.
Cas9 and gRNA were constructed using PCR and yeast recombination (Additional file 1: Figure S1), and both Cas9 and gRNA were transiently transfected with a donor vector/plasmid. Donor plasmids were constructed using PCR and yeast recombination (Additional file 1: Figure S1, Figure 2a). We designed two separate constructs to: (1) drive the expression of clr-2 with β-tubulin (NCU04054) promoter, and (2) drive the expression of codon optimized fire fly luciferase [15] with the glycogen synthase-1 (gsy-1: NCU06687) promoter. CLR-2 is a zinc binuclear cluster transcription factor that regulates a large number of cellulases in N. crassa [16], and Glycogen Synthase-1 (GSY-1) is an enzyme that converts glucose into glycogen [17]. β-tubulin-clr-2 and gsy-1-luciferase sequences were followed by the bar gene for selection using Ignite® (glufosinate), and they were targeted to its endogenous locus and csr-1 locus, respectively. csr-1 is a commonly used locus for transformation in N. crassa. Gene replacement of the csr-1 gene, which encodes the cyclosporin A-binding protein, leads to resistance to cyclosporin A [18]. The strains used in this study are listed in Table 1.
Table 1.
Strain | FGSC# or reference | Mating type | Genotype |
---|---|---|---|
74-OR23-1V A | 987 | A | Wild type (WT) |
328-4 | Belden et al. [20] | a | ras-1 bd |
mus-51 KO | 20277 | a | Δmus-51 |
As a proof of principle, we set out to test overexpression of cellulases with the β-tubulin promoter-driven expression of clr-2, and efficient selection of luciferase reporters with a bioluminescence assay. 5 μg of β-tubulin-clr-2 circular donor plasmids were transformed into wild type N. crassa (74-OR23-1 V A) along with different concentrations of Cas9 and gRNA circular plasmids (Figure 2b). Transformations were performed as previously described [19]. Dose-dependent increase of the number of transformants of β-tubulin-clr-2 was obtained by addition of Cas9 and gRNA (Figure 2b; Cas9 and gRNA plasmids: 0 µg: 1.0 ± 0.6; 1 µg: 0.8 ± 0.5; 2.5 µg: 42.0 ± 29.7; 5 µg 141.8 ± 92.9; n = 3, p < 0.01; Tukey’s method). We utilized optimal concentrations (5 µg) of Cas9 and gRNA with gsy-1-luciferase::csr-1 donor plasmid to transform the ras-1 bd N. crassa strain [20] (Figure 2c). gsy-1-luciferase::csr-1 that targets csr-1 locus enables double selection for both Ignite® and cyclosporine A as previously described [21]. As expected, we observed an efficient number of transformants of gsy-1-luciferase::csr-1 with optimized concentrations (Figure 2c; Cas9 and gRNA plasmids: 0 µg: 3.7 ± 1.9; 1 µg: 364.0 ± 33.1; n = 3, p < 0.01; Student’s t test). The transformants produced with the CRISPR/Cas9 system successfully express the transgene. The transformed conidia were plated onto luciferin containing plates, and in vivo luciferase activities were monitored with a charge-coupled device camera. We observed 57 luciferase positive colonies out of 1,092 total colonies with CRISPR/Cas9 system, but no positive colonies were observed with non-CRISPR/Cas9 method of transformation [11, 19] (Figure 2d–f). The reason for low number of positive colonies with bioluminescence assay is due to the small sizes of other colonies, which do not produce detectable signals.
Next, we assessed the efficiency of HR in 74-OR23-1V A with the CRISPR/Cas9 system versus mus-51 KO with the traditional method [10]. We observed efficient transformations with both methodologies (Figure 3a; mus-51 KO: 23 ± 56; CRISPR/Cas9: 66 ± 103; n = 4). Successful transformants at the clr-2 locus were validated through polymerase-chain reaction (PCR) analysis (see Table 2 for primers used in this study). The transformants were grown in liquid culture media, and we did not observe any differences of growth between the transformants from both methodologies. The genomic DNA was extracted from the transformants with either 74-OR23-1V A or mus-51 KO background, and quantitative PCR (qPCR) analysis was performed to count the number of transgenes in the genome. Similar number of transformants showed more than one clr-2 in their genome from both methods (CRISPR/Cas9: 6/20; mus-51 KO: 7/20; Figure 3b). As a control, we tested the number of gh6-2 in each genome and confirmed that none of the transformants had more than one gh6-2 (Figure 3c). The transformants with single clr-2 in their genome were further validated by PCR to confirm the β-tubulin promoter fused to clr-2 gene (Figure 3d). Interestingly, we observed three transformants from each method that exhibit the correct HR events at the clr-2 locus (CRISPR/Cas9: 3/14; mus-51 KO: 3/13; Figure 3e).
Table 2.
Primer name | Sequence 5′-3′ | Used for |
---|---|---|
β-tubulin-p F | TGCGACCAGGTTCAGGAGAGC | Genomic PCR (Figure 3e) |
actin F | GTCCCCGTCATCATGGTATC | qRT-PCR (Figure 4) |
actin R | CTTCTCCATGTCGTCCCAGT | qRT-PCR (Figure 4) |
clr-2 F | GCACCATCAATGTCGATACCTAC | qPCR, qRT-PCR (Figures 3b; 4a) |
clr-2 R1 | CATTGGCCACATGGTTGTTGACC | qPCR (Figure 3b, e) |
clr-2 R2 | CCATCACACCGAATCTTTCGTCT | qRT-PCR (Figure 4a) |
cbh-1 F | CTGCGTTGATGGTGCTGAGTAC | qRT-PCR (Figure 4b) |
cbh-1 R | GAGCTCGAAGCCCTGGTAGG | qRT-PCR (Figure 4b) |
gh5-1 F | CTCCTGCTAGCACCACCACTG | qPCR, qRT-PCR (Figures 3b, c; 4c) |
gh5-1 R1 | CAAGGCGCTCCATGGCGAAG | qPCR (Figure 3b, c) |
gh5-1 R2 | CTGCGGAGAGTCTGGATGGTG | qRT-PCR (Figure 4c) |
gh6-2 F | GCTCTGCCTGGAGCCAGTG | qPCR, qRT-PCR (Figures 3c; 4d) |
gh6-2 R1 | GTGGTGGTAACCTGAGCGCC | qPCR (Figure 3c) |
gh6-2 R2 | CTTGCTGGTGGTGCTAGAG | qRT-PCR (Figure 4d) |
Lastly, we tested the expression of cellulases in N. crassa carrying a targeted insertion of the β-tubulin promoter-regulated clr-2 (transformant #14 from the right panel of Figure 3e). We observed approximately two hundred-fold increase of clr-2 mRNA expression in the β-tubulin-clr-2 strain compared to wild type in 2% glucose as a sole carbon source, which indicates successful overexpression of clr-2 using the β-tubulin promoter (Figure 4a; 188.2 ± 52.8-fold; n = 3, p < 0.01; Student’s t-test). Increased expression was found for cbh-1 (NCU07340), gh5-1 (NCU00762), and gh6-2 (NCU09680) mRNA (Figure 4b–d; cbh-1: 68.3 ± 25.5-fold; gh5-1: 1724.3 ± 538.1-fold; gh6-2: 14.6 ± 5.3-fold; n = 3, p < 0.01; Student’s t-test; see Table 2 for primers used in this study). CBH-1 and GH6-2 are exoglucanases, and GH5-1 is an endoglucanase that facilitate degradation of cellulose [22].
In this report, we successfully demonstrated efficient gene replacements utilizing CRISPR/Cas9 technology in a model filamentous fungus, N. crassa. N. crassa did not indicate any problems in expressing functional Cas9 endonuclease under the A. nidulans trpC promoter, and the SNR52 promoter is operational to express gRNA in N. crassa as in S. cerevisiae [14]. These events enabled us to perform efficient knock-in of clr-2 with β-tubulin promoter and target gsy-1-luciferase bioluminescence reporter at the csr-1 locus with relatively simple modifications of template plasmids utilizing PCR and yeast recombination. In contrast to previously established gene editing protocols in Neurospora, CRISPR/Cas9 technology did not require mus-51 or mus-52 mutant backgrounds for efficient HR. This technology will enable efficient gene editing of any Neurospora natural isolates. Recent advancement and ramifications of CRISPR/Cas9 technology created numerous resources including multiplex gene replacements, transcriptional control, and inducible gene regulation [4]. Implementation of this technology in fungal organisms will be highly beneficial for the fungal research community.
Materials and methods
Materials and methods and any associated references are available in the online version of the paper at http://www.fungalbiolbiotech.com/ (Additional file 2).
Additional files
Authors’ contributions
TM designed the experiments. TM, MB, and JK performed experiments. CH and TM supervised the overall experiments and wrote the manuscript. All authors read and approved the final manuscript.
Acknowledgements
We thank Dr. George Church for donating p426-SNR52p-gRNA.CAN1.Y-SUP4t and p415-GalL-Cas9-CYC1t plasmids (Addgene plasmid #43803 and #43804) [14]. This work was supported by the Department of Interior Grant D12AP00005.
Compliance with ethical guidelines
Competing interests The authors declare that they have no competing interests.
Abbreviations
- CRISPR
clustered regularly interspaced short palindromic repeats
- gRNA
single crRNA:tracrRNA chimeric guide RNA
- KO
knockout
- NLS
nuclear localization signal
- SNR52
small nucleolar RNA 52
- PAM
protospacer adjacent motif
- gsy-1
glycogen synthase-1
- HR
homologous recombination
- PCR
polymerase chain reaction
- qPCR
quantitative polymerase chain reaction
- qRT-PCR
quantitative reverse transcription polymerase chain reaction
- SEM
standard error of the mean
- n
number of experiments
Footnotes
Electronic supplementary material
The online version of this article (doi:10.1186/s40694-015-0015-1) contains supplementary material, which is available to authorized users.
Contributor Information
Toru Matsu-ura, Email: toru.matsuura@uc.edu.
Mokryun Baek, Email: baekmn@ucmail.uc.edu.
Jungin Kwon, Email: kwonjungin89@gmail.com.
Christian Hong, Email: christian.hong@uc.edu.
References
- 1.Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337(6096):816–821. doi: 10.1126/science.1225829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 2013;339(6121):819–823. doi: 10.1126/science.1231143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, et al. RNA-guided human genome engineering via Cas9. Science. 2013;339(6121):823–826. doi: 10.1126/science.1232033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hsu PD, Lander ES, Zhang F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 2014;157(6):1262–1278. doi: 10.1016/j.cell.2014.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Sander JD, Joung JK. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 2014;32(4):347–355. doi: 10.1038/nbt.2842. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Vyas VK, Barrasa MI, Fink GR. A CRISPR system permits genetic engineering of essential genes and gene families. Sci Adv. 2015;1(3):e1500248. doi: 10.1126/sciadv.1500248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Liu R, Chen L, Jiang Y, Zhou Z, Zou G (2015) Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discov 1(15007) [DOI] [PMC free article] [PubMed]
- 8.Noedvig CS, Nielsen JB, Mortensen UH. A CRISPR/Cas9 system for genetic engineering of filamentous fungi. Fungal Genet Rep. 2015;60(Suppl):23. doi: 10.1371/journal.pone.0133085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Roche CM, Loros JJ, McCluskey K, Glass NL. Neurospora crassa: looking back and looking forward at a model microbe. Am J Bot. 2014;101(12):2022–2035. doi: 10.3732/ajb.1400377. [DOI] [PubMed] [Google Scholar]
- 10.Ninomiya Y, Suzuki K, Ishii C, Inoue H. Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining. Proc Natl Acad Sci USA. 2004;101(33):12248–12253. doi: 10.1073/pnas.0402780101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Colot HV, Park G, Turner GE, Ringelberg C, Crew CM, Litvinkova L, et al. A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. Proc Natl Acad Sci USA. 2006;103(27):10352–10357. doi: 10.1073/pnas.0601456103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Pall ML, Brunelli JP. A series of six compact fungal transformation vectors containing polylinkers with multiple unique restriction sites. Fungal Genet Newsl. 1933;40:59–62. [Google Scholar]
- 13.Harismendy O, Gendrel CG, Soularue P, Gidrol X, Sentenac A, Werner M, et al. Genome-wide location of yeast RNA polymerase III transcription machinery. EMBO J. 2003;22(18):4738–4747. doi: 10.1093/emboj/cdg466. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.DiCarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 2013;41(7):4336–4343. doi: 10.1093/nar/gkt135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Gooch VD, Mehra A, Larrondo LF, Fox J, Touroutoutoudis M, Loros JJ, et al. Fully codon-optimized luciferase uncovers novel temperature characteristics of the Neurospora clock. Eukaryot Cell. 2008;7(1):28–37. doi: 10.1128/EC.00257-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Coradetti ST, Craig JP, Xiong Y, Shock T, Tian C, Glass NL. Conserved and essential transcription factors for cellulase gene expression in ascomycete fungi. Proc Natl Acad Sci USA. 2012;109(19):7397–7402. doi: 10.1073/pnas.1200785109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.de Paula R, de Azzariti Pinho C, Terenzi HF, Bertolini MC. Molecular and biochemical characterization of the Neurospora crassa glycogen synthase encoded by the gsn cDNA. Mol Genet Genomics. 2002;267(2):241–253. doi: 10.1007/s00438-002-0659-4. [DOI] [PubMed] [Google Scholar]
- 18.Bardiya N, Shiu PK. Cyclosporin A-resistance based gene placement system for Neurospora crassa. Fungal Genet Biol. 2007;44(5):307–314. doi: 10.1016/j.fgb.2006.12.011. [DOI] [PubMed] [Google Scholar]
- 19.Hong CI, Zamborszky J, Baek M, Labiscsak L, Ju K, Lee H, et al. Circadian rhythms synchronize mitosis in Neurospora crassa. Proc Natl Acad Sci USA. 2014;111(4):1397–1402. doi: 10.1073/pnas.1319399111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Belden WJ, Larrondo LF, Froehlich AC, Shi M, Chen CH, Loros JJ, et al. The band mutation in Neurospora crassa is a dominant allele of ras-1 implicating RAS signaling in circadian output. Genes Dev. 2007;21(12):1494–1505. doi: 10.1101/gad.1551707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Chen CH, DeMay BS, Gladfelter AS, Dunlap JC, Loros JJ. Physical interaction between VIVID and white collar complex regulates photoadaptation in Neurospora. Proc Natl Acad Sci USA. 2010;107(38):16715–16720. doi: 10.1073/pnas.1011190107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Schmoll M, Tian C, Sun J, Tisch D, Glass NL. Unravelling the molecular basis for light modulated cellulase gene expression—the role of photoreceptors in Neurospora crassa. BMC Genom. 2012;13:127. doi: 10.1186/1471-2164-13-127. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.