Auraptene Attenuates Malignant Properties of Esophageal Stem-Like Cancer Cells

Saffiyeh Saboor-Maleki; Fatemeh B Rassouli; Maryam M Matin; Mehrdad Iranshahi

doi:10.1177/1533034616650119

. 2016 May 20;16(4):519–527. doi: 10.1177/1533034616650119

Auraptene Attenuates Malignant Properties of Esophageal Stem-Like Cancer Cells

Saffiyeh Saboor-Maleki ¹, Fatemeh B Rassouli ^1,^2,^✉, Maryam M Matin ^1,², Mehrdad Iranshahi ³

PMCID: PMC5616061 PMID: 27207438

Abstract

The high incidence of esophageal squamous cell carcinoma has been reported in selected ethnic populations including North of Iran. Low survival rate of esophageal carcinoma is partially due to the presence of stem-like cancer cells with chemotherapy resistance. In the current study, we aimed to determine the effects of auraptene, an interesting dietary coumarin with various biological activities, on malignant properties of stem-like esophageal squamous cell carcinoma, in terms of sensitivity to anticancer drugs and expression of specific markers. To do so, the half maximal inhibitory concentration values of auraptene, cisplatin, paclitaxel, and 5-fluorouracil were determined on esophageal carcinoma cells (KYSE30 cell line). After administrating combinatorial treatments, including nontoxic concentrations of auraptene + cisplatin, paclitaxel, or 5-fluorouracil, sensitivity of cells to chemical drugs and also induced apoptosis were assessed. In addition, quantitative real-time polymerase chain reaction was used to study changes in the expression of tumor suppressor proteins 53 and 21 (P53 and P21), cluster of differentiation 44 (CD44), and B cell-specific Moloney murine leukemia virus integration site 1 (BMI-1) upon treatments. Results of thiazolyl blue assay revealed that auraptene significantly (P < .05) increased toxicity of cisplatin, paclitaxel, and 5-fluorouracil in KYSE30 cells, specifically 72 hours after treatment. Conducting an apoptosis assay using flow cytometry also confirmed the synergic effects of auraptene. Results of quantitative real-time polymerase chain reaction revealed significant (P < .05) upregulation of P53 and P21 upon combinatorial treatments and also downregulation of CD44 and BMI-1 after auraptene administration. Current study provided evidence, for the first time, that auraptene attenuates the properties of esophageal stem-like cancer cells through enhancing sensitivity to chemical agents and reducing the expression of CD44 and BMI-1 markers.

Keywords: auraptene, esophageal cancer, stem-like cancer cells, synergic effects

Introduction

Esophageal squamous cell carcinoma (ESCC), the most common type of esophageal cancer, is malignant transformation of epithelial cells lining the esophagus. Different geographical distribution has been reported for ESCC incidence; the highest rates belong to countries located on the “esophageal cancer belt,” extending from Northern Iran to North-Central China.¹ The mortality of ESCC mainly depends on nonspecific symptoms of the disease in early stages, and similar to other cancers of the digestive tract, development of drug-resistant cells negatively affects the outcome of conventional therapeutic modalities.^2,3 To design more effective strategies for cancer treatment, attention has been focused on identification of cancer stem cells (CSCs) in recent years, since accumulative evidence suggests that CSCs are responsible for cancer initiation, metastasis, and therapy resistance in a wide range of human malignancies.⁴ Characterization of CSCs in different human tumors revealed that they could be detected by distinct molecular markers. In ESCC, for instance, CSCs have been introduced as cells positive for CD44, CD15,⁵ CD133, CXCR4,⁶ and CD90⁷ antigens.

Auraptene (AUR), also known as 7-geranyloxycoumarin, is a natural prenyloxycoumarin found in plants belonging to Rutaceae and Apiaceae families. Various biological properties have been introduced for AUR including antibacterial, antiprotozoal, antifungal, antigenotoxic, anti-inflammatory, antioxidative, and immunomodulatory activities.⁸ Importantly, dietary supplementation of AUR induced cancer chemopreventive effects in animal models of oral,⁹ colon,^10–12 esophagus,¹³ liver,^14,15 breast,¹⁶ prostate,¹⁷ and skin¹⁸ cancers. Induction of glutathione S transferase activity, lipid peroxidation, modulation of inflammation, and suppression of superoxide generation have been introduced as mechanisms underlying AUR chemopreventive actions.^9,11,12,18 In addition, studies have demonstrated anticancer effects of AUR in a number of human cancer cell lines, except esophageal cancer cells or CSCs. For instance, AUR induced apoptosis in colon,¹⁹ gastric,²⁰ and leukemia²¹ cells; inhibited progression of renal²² and breast²³ carcinoma cells; and prevented the reemergence of colon CSCs.²⁴

Recent reports have demonstrated the importance of CSCs in the progression of esophageal cancers.^25–28 Nevertheless, current knowledge on natural or synthetic compounds that could selectively eliminate esophageal CSCs or attenuate their unfavorable properties is very limited. Accordingly, the aim of present study was to determine the effects of AUR on the characteristics of esophageal CSCs, including sensitivity to anticancer agents and expression of specific markers. To do so, KYSE30 cell line, highly enriched in stem-like cancer cells,⁵ was used to evaluate the synergic effects of AUR on cisplatin, paclitaxel, and 5-fluorouracil (5-FU). Moreover, expression of apoptosis mediators, tumor suppressor proteins 53 and 21 (P53 and P21), as well as CSC markers, cluster of differentiation 44 (CD44) and B cell-specific Moloney murine leukemia virus integration site 1 (BMI-1), was evaluated upon AUR or combinatorial treatments.

Materials and Methods

Preparation of AUR

Auraptene was synthesized as described previously.²⁹ Briefly, the reaction was carried out between 7-hydroxycoumarin (1 mol/L) and transgeranyl bromide (1.5 mol/L) in acetone at room temperature and in the presence of 1, 8-diazabicyclo [5.4.0] undec-7-ene (2 mol/L). Then, AUR was purified by column chromatography (petroleum ether/ethyl acetate 9:1 v/v) as white crystals (mp = 62.7°C-63.4°C). To prepare various concentrations of AUR, 2 mg of the crystal powder was dissolved in 100 µL dimethylsulfoxide (DMSO; Merck, Germany) and diluted with complete culture medium before experiments. To eliminate the effects of the solvent, equal amount of DMSO in all AUR concentrations (0.4% DMSO) was considered as the control treatment.

Culture of Cells

KYSE30 cells, obtained from Pasteur Institute (Tehran, Iran), were grown in Roswell Park Memorial Institute (RPMI) 1640/Ham F12 medium (Biowest, France) supplemented with 10% fetal bovine serum (FBS; Biowest, France), while HFF3 cells, purchased from Pasteur Institute, were cultured in Dulbecco’s modified Eagle medium (Gibco, Scotland) supplemented with 10% FBS. Both cell lines were incubated at 37°C in a humidified atmosphere of 5% CO₂ in air, and subcultured, when required, by 0.25% trypsin–1 mmol/L EDTA (Biowest, France).

In vitro cytotoxicity Assay

The thiazolyl blue (MTT) assay was used to determine the half maximal inhibitory concentration (IC₅₀) of AUR in both cell lines as well as the IC₅₀ values of cisplatin, paclitaxel, and 5-FU in KYSE30 cells. To do so, cells were seeded, at a density of 5000 cell/well for KYSE30 cells and 8000 cell/well for HFF3 cells, in 96-well tissue culture plates (Falcon Becton–Dickinson, USA). After 24 hours, both cell types were incubated with increasing concentrations of AUR (10, 20, 40, and 80 µg/mL) and the relevant DMSO control, for 24, 48, and 72 hours. In addition, KYSE30 cells were treated with cisplatin (Mylan, UK, 2, 4, and 8 µg/mL), paclitaxel (Actavis, France, 2, 4, 8, and 16 µg/mL), and 5-FU (Ebewe Pharma, Austria, 2.5, 5, 10, and 20 µg/mL) for 24, 48, and 72 hours.

To study the synergy of AUR and anticancer agents, KYSE30 cells were treated with combinations of AUR and each drug: AUR (5, 10, and 20 µg/mL) + cisplatin (1, 2, and 4 µg/mL), + paclitaxel (1, 2, and 4 µg/mL), or +5-FU (2.5, 5, and 10 µg/mL) for 24, 48, and 72 hours. To note, the effect of each combination was evaluated using its relevant control (0.4% DMSO + drug).

For cytotoxicity assay, the MTT dye (ATOCEL, Austria) was dissolved in phosphate-buffered saline (5 mg/mL) and added to each well (20 µL/well), and the plates were incubated for 4 hours at 37°C. The reaction was then stopped by the addition of DMSO (150 µL/well) and optic densities of the wells were measured spectrophotometrically at 570 nm using an enzyme-linked immunosorbent assay plate reader (Awareness, USA).

Measurement of Apoptosis

Apoptosis was assessed in KYSE30 cells using fluorescein isothiocyanate (FITC) annexin V apoptosis detection kit with propidium iodide (BioLegend, USA) according to the manufacturer’s instruction. Briefly, following each combinatorial treatment, cells were collected, washed, and resuspended in a staining buffer. Then, samples were stained with FITC-annexin V and propidium iodide for 15 minutes at room temperature in the dark, followed by the addition of binding buffer. Finally, the cells were analyzed by flow cytometry (BD FACSCalibur, USA) using FL1 and FL2 filters.

RNA Extraction, Complementary DNA Synthesis, and Quantitative Real-Time Polymerase Chain Reaction

Using RNX-plus (Cinnagen, Iran), the total cellular RNA was extracted from untreated cells and also KYSE30 cells treated with 20 µg/mL AUR (and its relevant DMSO control) as well as cells treated with combination of 20 µg/mL AUR + 1 µg/mL cisplatin, +1 µg/mL paclitaxel, or +2.5 µg/mL 5-FU (and their corresponding DMSO controls). To avoid DNA contamination, extracted RNAs were treated with RNase-free DNase I (Thermo Scientific, USA) followed by heat inactivation with EDTA. For complementary DNA (cDNA) synthesis, oligo-dT, deoxyribonucleoside triphosphates, RNase inhibitor, and M-MuLV reverse transcriptase (Thermo Scientific, USA) were used according to the manufacturer’s protocol. The fidelity of amplified cDNAs was then confirmed by polymerase chain reaction (PCR) using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers, and final products were loaded on 1.5% agarose gel (Invitrogen, USA) for electrophoresis. Quantitative real-time polymerase chain reaction (QRT-PCR) was conducted in iQ5 real-time PCR detection system (Bio-Rad, USA) using SYBR green mix (Pars Toos, Iran). To note, GAPDH transcripts were used as internal control, and PCR efficiencies were calculated for all used primers from the given slopes of standard curves. The PCR cycling conditions were 95°C for 4 minutes (95°C for 15 s, 55°C for 15 s, 72°C for 15 s; 50 cycles) for P53 and P21 primers and 95°C for 4 min (95°C for 30 s, 59°C for 30 s, 72°C for 30 s; 40 cycles) for CD44 and BMI-1 primers. The primer sequences used are shown in Table 1.

Table 1.

List of Primers, Their Sequence, and Product Length Used in the Current Study.

Gene Name	Forward (5’-3’)	Reverse (5’-3’)	Product Size, bp
GAPDH	GACCACTTTGTCAAGCTCATTTCC	GTGAGGGTCTCTCTCTTCCTCTTGT	151
P53	GTTCCGAGAGCTGAATGAGG	TTATGGCGGGAGGTAGACTG	123
P21	GGAAGACCATGTGGACCTGT	GGCGTTTGGAGTGGTAGAAA	146
CD44	CGGACACCATGGACAAGTTT	GAAAGCCTTGCAGAGGTCAG	176
BMI-1	CTGCAGCTCGCTTCAAGATG	CACACACATCAGGTGGGGAT	192

Open in a new tab

Abbreviation: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; P53 and P21, tumor suppressor proteins 53 and 21; CD44, cluster of differentiation 44; BMI-1, B cell-specific Moloney murine leukemia virus integration site 1.

Statistical Analyses

Significant level was ascertained by one-way analysis of variance, followed by Tukey multiple comparison tests using SPSS 19.0 software. Values were expressed as mean ± standard error of the mean, and P < .05 was considered to be statistically significant.

Results

Auraptene Enhanced Toxicity of Cisplatin, Paclitaxel, and 5-FU

To study AUR effects on KYSE30 cells, it was first necessary to determine the IC₅₀ of this coumarin during 3 consecutive days. In this regard, cells were treated with increasing concentrations of AUR for 24, 48, and 72 hours, and the IC₅₀ values were calculated, as summarized in Table 2. Worth to mention, toxicity of AUR was also examined on human foreskin fibroblasts (HFF3 cell line), and the determined IC₅₀ values were more than 80 µg/mL at all 3 time points (data not shown).

Table 2.

The IC₅₀ Values of AUR, Cisplatin, Paclitaxel, and 5-FU During 3 Consecutive Days.

Treatments	IC₅₀, µg/mL
Treatments	24 h	48 h	72 h
AUR	80	72	76
Cisplatin	7.7	4.9	4.3
Paclitaxel	7.5	6	3.6
5-FU	>20	18	17

Open in a new tab

Abbreviations: AUR, auraptene; 5-FU, 5-fluorouracil; IC₅₀, half maximal inhibitory concentration.

To assess the synergic effects of AUR on cisplatin, paclitaxel, and 5-FU, the IC₅₀ values of each drug was also determined on KYSE30 cells after 24, 48, and 72 hours (Table 2). Later on, KYSE30 cells were treated with combination of AUR (5, 10, and 20 µg/mL) + cisplatin (1, 2, and 4 µg/mL), + paclitaxel (1, 2, and 4 µg/mL), or + 5-FU (2.5, 5, and 10 µg/mL), all in concentrations lower that their IC₅₀, for 3 continuous days. As presented in Figure 1, the results of MTT test indicated that nontoxic AUR significantly (P < .05) enhanced the cytotoxicity of anticancer drugs, specifically in the lowest concentration of each drug, and these effects were improved as time passed during combinatorial treatments. In case of AUR + cisplatin treatments, the highest synergic effect belonged to 20 µg/mL AUR, which increased the toxicity of 1 µg/mL cisplatin up to 22% and 32%, after 48 and 72 hours, respectively. To note, toxicity of 2 µg/mL cisplatin was also increased by 20 µg/mL AUR up to 15% and 26%, after 48 and 72 hours, respectively (Figure 1A). Evaluating synergic effects of AUR on paclitaxel revealed the same results; 72 hours after combinatorial treatments, 20 µg/mL AUR improved toxicity of 1 and 2 µg/mL paclitaxel up to 26% and 27%, respectively (Figure 1B). Furthermore, our results revealed that after 72 hours, the cytotoxicity of 2.5 and 5 µg/mL 5-FU increased by 20 µg/mL AUR up to 19% and 24%, respectively (Figure 1C).

Figure 1. — Effects of auraptene (AUR; 5, 10 and 20 µg/mL) and relevant dimethyl sulfoxide (DMSO) controls on the cytotoxicity of cisplatin (A), paclitaxel (B), and 5-fluorouracil (5-FU) (C) 24, 48, and 72 hours after combinatorial treatments.

Synergic Effects of AUR Increased Apoptosis Induced by Anticancer Agents

To further study synergic effects of AUR on anticancer drugs, we evaluated apoptotic cells 72 hours after administration of our best combinatorial treatments: 20 µg/mL AUR + 1 µg/mL cisplatin, + 1 µg/mL paclitaxel, or + 5 µg/mL 5-FU. Figure 2 shows the effect of each combination on the percentage of alive and necrotic cells as well as early and late apoptotic cells in comparison with its relevant control (0.4% DMSO + drug). As presented, combination of AUR + cisplatin increased the percentage of early and late apoptotic cells up to 34.7%. In addition, 26.8% increase was observed in the percentage of early and late apoptotic cells upon coadministration of AUR + 5-FU. These observations support the results obtained from MTT assay. In case of AUR + paclitaxel treatment, despite experiments were repeated several times, changes in the percentage of apoptotic cells were not considerable (6%) in comparison with control treatment.

Figure 2. — Apoptosis detected by fluorescein isothiocyanate (FITC)-annexin V and propidium iodide 72 hours after combinatorial treatments. Flow cytometry analysis differentiated alive and necrotic cells from early and late apoptotic cells. In comparison with relevant dimethyl sulfoxide (DMSO) controls, considerable increase was observed in the percentage of early and late apoptotic cells in auraptene (AUR) + cisplatin and AUR + 5-fluorouracil (5-FU) treatments.

Overexpression of P53 and P21 in Combinatorial Treatments

To better elucidate the molecular mechanism of synergic activity, we studied the expression of P53 and P21, genes involved in apoptosis induced by cisplatin, paclitaxel, and 5-FU. In this regard, KYSE30 cells were treated with combinations of AUR and each drug, using concentrations determined by MTT test and confirmed by apoptosis assay. Figure 3A shows relative fold changes in the expression of P53 and P21 over corresponding control treatments. As presented, the expression of P21 significantly (P < .05) increased in all our combinatorial treatments. However, significant enhancement in P53 expression was only observed in cells treated with AUR + 5-FU.

Figure 3. — Quantitative real-time polymerase chain reaction (QRT-PCR) analysis of tumor suppressor proteins 53 and 21 (*P53* and *P21*) expression upon combinatorial treatments (A). To note, normalized values were plotted as relative fold change over relevant control treatments, including 0.4% dimethyl sulfoxide (DMSO) + 1 µg/mL cisplatin (for auraptene [AUR] + cisplatin), + 1 µg/mL paclitaxel (for AUR + paclitaxel), or + 5 µg/mL 5-fluorouracil (5-FU; for AUR + 5-FU). Expression pattern of cluster of differentiation 44 (*CD44*) and B cell-specific Moloney murine leukemia virus integration site 1 (*BMI-1*) in untreated KYSE30 cells (B). Changes induced by AUR (20 µg/mL) in the expression of *CD44* and *BMI-1*, after 48 and 72 hours (C). To note, normalized values were plotted as relative fold-change over relevant controls (0.4% DMSO for 48 and 72 hours, respectively).

Auraptene Downregulated the Expression of CSC Markers CD44 and BMI-1

To study the effects of AUR on the expression of CD44 and BMI-1 in messenger RNA level, it was necessary to first determine the expression profile of these CSC markers in untreated KYSE30 cells. As presented in Figure 3B, we detected high level of CD44 and BMI-1 expression in KYSE30 cells by the use of specific primers. After administration of 20 µg/mL AUR for 48 and 72 hours, QRT-PCR analysis revealed significant (P < .05) downregulation of CD44 after 48 hours as well as decrease in BMI-1 expression at both time points (Figure 3C).

Conclusion

Cancers of the digestive tract are among the top 10 life-threatening malignancies worldwide. The high incidence of ESCC has been reported in selected ethnic populations including Caspian littoral region in Iran.¹ Despite advances in ESCC treatment, including surgical techniques, chemotherapy, and radiotherapy, the survival rate of ESCC is still very low. This is mainly due to the late detection of the disease, metastasis of malignant cells, and innate or acquired resistance to chemoradiotherapy. Progress in cancer cell biology suggests that achieving novel therapeutics and avoiding recurrence of malignant cells would be possible by targeting CSCs in many tumor types such as ESCC.²⁵ Accordingly, we examined the effects of AUR, the most abundant natural prenyloxycoumarin, on sensitivity of ESCC stem-like cells to anticancer drugs, as well as the expression of CSC markers involved in malignant properties, for the first time.

Auraptene is well characterized for its interesting and valuable pharmacological properties such as chemopreventive and anticancer effects. In vitro studies have suggested several mechanisms of action for AUR; it induced apoptosis in gastric cancer cells via suppression of mechanistic target of rapamycin (mTOR) pathways²⁰ and in leukemia cells through stimulation of caspase cascade.²¹ Moreover, AUR inhibited progression of renal carcinoma cells by suppression of mitochondrial respiration²² and controlled proliferation of breast cancer cells by modulating estrogen receptors³⁰ and changing the expression of genes related to cell cycle.²³ Among other key targets of AUR are matrix metalloproteinases³¹ and P-glycoprotein³² involved in metastasis and drug resistance of malignant cells, respectively. Nevertheless, current study is the only report indicating AUR effects on characteristics of esophageal stem-like cancer cells.

Results of MTT test revealed that nontoxic AUR significantly (P < .05) increased sensitivity of KYSE30 cells to cisplatin, paclitaxel, and 5-FU, drugs routinely used for ESCC treatment.³³ In addition, flow cytometrically detecting apoptotic cells confirmed the synergic effects of AUR on cisplatin and 5-FU. Previously, it has been reported that AUR enhanced tumor suppressive effects of all-trans retinoic acid in xenograft model of human skin cancer.³⁴ The present study, however, provides new evidence for synergic effects of AUR on anticancer agents using ESCC stem-like cells. One explanation for AUR activity, specifically when used in combination with paclitaxel, includes interaction with P-glycoprotein, due to the fact that AUR competitively interacts at the drug-binding site of this efflux pump.³² Moreover, since cisplatin and 5-FU are substrates of other drug transporters, such as MRP2 and MRP5, respectively,^35,36 different mechanisms must be involved in synergy of AUR with these drugs.

To better evaluate the effects of AUR in combinatorial treatments, we examined the expression of genes involved in apoptosis induced by cisplatin, paclitaxel, and 5-FU. P53, a tumor-suppressor gene, acts as a sequence-specific DNA-binding transcription factor implicated in cellular responses to DNA damage.³⁷ P21, which is regulated by P53-dependent and independent pathways, encodes a multifunctional protein involved in cell cycle regulation, programmed death, and differentiation.³⁸ Studying the expression of P53 and P21 upon administration of AUR + drug combinations indicated significant (P < .05) upregulation of both genes in comparison with control treatments. Not only these results are in agreement with a previous study, which reported increased P53 and P21 expression in KYSE30 cells after cisplatin treatment,³⁹ but these results also confirm the effects of AUR on enhanced toxicity of anticancer drugs in these cells. Published studies have reported significant growth suppression in ESCC cell lines upon infection with P53⁴⁰ or P21⁴¹ recombinant adenoviral vectors. Accordingly, it is presumable that improved activity of anticancer drugs in our study might be, to some extent, due to enhanced expression of P53 and P21 in KYSE30 cells.

Due to the importance of CSC markers in the maintenance of stem-like cancer cell properties, the effect of nontoxic AUR was also examined on the expression of CD44 and BMI-1, 2 common markers for gastrointestinal CSCs. CD44 is a transmembrane protein that integrates and transduces microenvironmental signals and, thus, affects regulation of genes involved in cell migration, proliferation, differentiation, and survival.⁴¹ Reports have indicated the importance of CD44 as a prognostic marker in human malignancies, including esophageal cancers; CD44 expression has been correlated with clinicopathological features of ESCC and esophageal adenocarcinoma (EAC).^42–45 BMI-1, a polycomb group family member, acts as an oncoprotein regulating cell cycle events during tumorigenesis.⁴⁶ The elevated expression of BMI-1 was associated with advanced pathological stage, grade, and lymph node metastasis in ESCC and EAC.^47–49 Accordingly, CD44 and BMI-1 are considered as potential markers for esophageal cancer diagnosis as well as therapeutic targets for designing novel approaches.

We have previously introduced KYSE30 cells as a suitable model for studying ESCC stem-like cells highly positive for CD44 and CD15 markers.⁵ In the present work, we detected high level of CD44 and BMI-1 transcripts in untreated KYSE30 cells and reported significant (P < .05) decrease in both markers upon AUR treatment. Similarly, downregulation of CSC markers, CD44 and CD166, has been reported in drug-resistant colon CSCs by AUR.²⁴ Interestingly, there are several reports indicating the importance of CD44 and BMI-1 in resistance of cancer cells to cisplatin, paclitaxel, and 5-FU. It has been revealed that downregulation of CD44 in ovarian cancer cells increased chemosensitivity to cisplatin and paclitaxel,^50–52 and silencing BMI-1 expression in CD44⁺ nasopharyngeal stem-like cancer cells enhanced sensitivity to cisplatin.⁵³ In addition, BMI-1 knockdown enhanced chemosensitivity to cisplatin in glioblastoma,⁵⁴ osteosarcoma,⁵⁵ lung,⁵⁶ and ovarian⁵⁷ cancer cells and effectively reversed resistance to 5-FU in gastric CSCs,⁵⁸ nasopharyngeal carcinoma cells,⁵⁹ and breast cancer cells.⁶⁰ In line with these reports, we observed enhanced toxicity of cisplatin, paclitaxcel, and 5-FU, as well as downregulation of CD44 and BMI-1, in ESCC stem-like cells upon administration of nontoxic AUR. These results indicate great pharmaceutical value of AUR that could be used, in combination or alone, to negatively affect malignant properties of CSCs.

In summary, we reported enhanced chemosensitivity of ESCC stem-like cells upon administration of nontoxic AUR in combination with cisplatin, paclitaxel, and 5-FU. Detection of apoptotic cells, as well as overexpression of P53 and P21, confirmed increased activity of anticancer agents mediated by AUR. Furthermore, decreased expression of CSC markers CD44 and BMI-1 in KYSE30 cells indicated attenuated malignant properties of these cells and could be considered as another proof for synergic effects of AUR. Based on current results and all studies reviewed here, it seems that AUR could gain enough validity to be used in vivo as a great candidate for ESCC combinatorial treatment and/or CSC-based therapy. However, to improve our knowledge about underlying mechanisms of AUR actions, and also introduce this coumarin as a suitable candidate for clinical studies, it is necessary to deeply understand the link between synergic effects of AUR, cell cycle control, and apoptosis. In addition, further investigations are required to determine AUR effects on other CSC properties of ESCC cells, such as radioresistance and metastasis.

Acknowledgments

The authors would like to thank Mrs Saeinasab, Mrs Sodagar, and Mr Mirahmadi for their help and technical advices.

Abbreviations

AUR: auraptene
CSC: cancer stem cell
DBU: 1, 8-diazabicyclo [5.4.0] undec-7-ene
DMEM: Dulbecco’s modified Eagle medium
DMSO: dimethylsulfoxide
EAC: esophageal adenocarcinoma
ESCC: esophageal squamous cell carcinoma
FBS: fetal bovine serum
FITC: fluorescein isothiocyanate
RPMI: Roswell Park Memorial Institute
5-FU: 5-fluorouracil
QRT-PCR: quantitative real-time polymerase chain reaction
MTT: thiazolyl blue.

Footnotes

Declaration of Conflicting Interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported with a grant from Ferdowsi University of Mashhad (No. 31548).

References

1. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87–108. [DOI] [PubMed] [Google Scholar]
2. Lim B, Jiang Y. Current and emerging systemic therapy in gastro-esophageal cancer “the old and new therapy for metastatic disease, the role of adjuvant and neoadjuvant therapy for localized disease”. Curr Clin Pharmacol. 2015;10(4):267–278. [DOI] [PubMed] [Google Scholar]
3. Facompre N, Nakagawa H, Herlyn M, Basu D. Stem-like cells and therapy resistance in squamous cell carcinomas. Adv Pharmacol. 2012;65:235–265. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Rassouli FB, Matin MM, Saeinasab M. Cancer stem cells in human digestive tract malignancies. Tumour Biol. 2016;37(1):7–21. [DOI] [PubMed] [Google Scholar]
5. Rassouli FB, Matin MM, Bahrami AR, et al. Evaluating stem and cancerous biomarkers in CD15+CD44+ KYSE30 cells. Tumour Biol. 2013;34(5):2909–2920. [DOI] [PubMed] [Google Scholar]
6. Lu C, Xu F, Gu J, et al. Clinical and biological significance of stem-like CD133+CXCR4+ cells in esophageal squamous cell carcinoma. J Thorac Cardiovasc Surg. 2015;150(2):386–395. [DOI] [PubMed] [Google Scholar]
7. Tang KH, Dai YD, Tong M, et al. A CD90(+) tumor-initiating cell population with an aggressive signature and metastatic capacity in esophageal cancer. Cancer Res. 2013;73(7):2322–2332 [DOI] [PubMed] [Google Scholar]
8. Genovese S, Epifano F. Auraptene: a natural biologically active compound with multiple targets. Curr Drug Targets. 2011;12(3):381–386. [DOI] [PubMed] [Google Scholar]
9. Tanaka T, Kawabata K, Kakumoto M, et al. Chemoprevention of 4-nitroquinoline 1-oxide-induced oral carcinogenesis by citrus auraptene in rats. Carcinogenesis. 1998;19(3):425–431. [DOI] [PubMed] [Google Scholar]
10. Hayashi K, Suzuki R, Miyamoto S, et al. Citrus auraptene suppresses azoxymethane-induced colonic preneoplastic lesions in C57BL/KsJ-db/db mice. Nutr Cancer. 2007;58(1):75–84. [DOI] [PubMed] [Google Scholar]
11. Kohno H, Suzuki R, Curini M, et al. Dietary administration with prenyloxycoumarins, auraptene and collinin, inhibits colitis-related colon carcinogenesis in mice. Int J Cancer. 2006;118(12):2936–2942. [DOI] [PubMed] [Google Scholar]
12. Tanaka T, de Azevedo MB, Durn N, et al. Colorectal cancer chemoprevention by 2 beta-cyclodextrin inclusion compounds of auraptene and 4’-geranyloxyferulic acid. Int J Cancer. 2010;126(4):830–840. [DOI] [PubMed] [Google Scholar]
13. Kawabata K, Tanaka T, Yamamoto T, et al. Suppression of N-nitrosomethylbenzylamine-induced rat esophageal tumorigenesis by dietary feeding of 1’-acetoxychavicol acetate. Jpn J Cancer Res. 2000;91(2):148–155. [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Sakata K, Hara A, Hirose Y, et al. Dietary supplementation of the citrus antioxidant auraptene inhibits N, N-diethylnitrosamine-induced rat hepatocarcinogenesis. Oncol. 2004;66(3):244–252. [DOI] [PubMed] [Google Scholar]
15. Hara A, Sakata K, Yamada Y, et al. Suppression of beta-catenin mutation by dietary exposure of auraptene, a citrus antioxidant, in N, N-diethylnitrosamine-induced hepatocellular carcinomas in rats. Oncol Rep. 2005;14(2):345–351. [PubMed] [Google Scholar]
16. Krishnan P, Yan KJ, Windler D, et al. Citrus auraptene suppresses cyclin D1 and significantly delays N-methyl nitrosourea induced mammary carcinogenesis in female Sprague-Dawley rats. BMC Cancer. 2009;9:259. [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Tang M, Ogawa K, Asamoto M, et al. Effects of citrus nobiletin and auraptene in transgenic rats developing adenocarcinoma of the prostate (TRAP) and humane prostate carcinoma cells. Cancer Sci. 2007;98(4):471–477. [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Murakami A, Kuki W, Takahashi Y, et al. Auraptene, a citrus coumarin, inhibits 12-O-tetradecanoylphorbol-13-acetate-induced tumor promotion in ICR mouse skin, possibly through suppression of superoxide generation in leukocytes. Jpn J Cancer Res. 1997;88(5):443–452. [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Mori H, Niwa K, Zheng Q, Yamada Y, Sakata K, Yoshimi N. Cell proliferation in cancer prevention; effects of preventive agents on estrogen-related endometrial carcinogenesis model and on an in vitro model in human colorectal cells. Mutat Res. 2001;480-481:201–207. [DOI] [PubMed] [Google Scholar]
20. Moon JY, Kim H, Cho SK. Auraptene, a major compound of supercritical fluid extract of phalsak (Citrus Hassaku Hort ex Tanaka), induces apoptosis through the suppression of mTOR pathways in human gastric cancer SNU-1 cells. Evid Based Complement Alternat Med. 2015;2015:402385. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Jun DY, Kim JS, Park HS, et al. Apoptogenic activity of auraptene of Zanthoxylum schinifolium toward human acute leukemia Jurkat T cells is associated with ER stress-mediated caspase-8 activation that stimulates mitochondria-dependent or -independent caspase cascade. Carcinogenesis. 2007;28(6):1303–1313. [DOI] [PubMed] [Google Scholar]
22. Jang Y, Han J, Kim SJ, et al. Suppression of mitochondrial respiration with auraptene inhibits the progression of renal cell carcinoma: involvement of HIF-1α degradation. Oncotarget. 2015;6(35):38127–38138. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Krishnan P, Kleiner-Hancock H. Effects of auraptene on IGF-1 stimulated cell cycle progression in the human breast cancer cell line, MCF-7. Int J Breast Cancer. 2012;2012:502092. [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Epifano F, Genovese S, Miller R, Majumdar AP. Auraptene and its effects on the re-emergence of colon cancer stem cells. Phytother Res. 2013;27(5):784–786. [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Islam F, Gopalan V, Wahab R, Smith RA, Lam AK. Cancer stem cells in oesophageal squamous cell carcinoma: Identification, prognostic and treatment perspectives. Crit Rev Oncol Hematol. 2015;96(1):9–19. [DOI] [PubMed] [Google Scholar]
26. Rassouli FB, Matin MM, Bahrami AR, et al. SOX2 expression in gastrointestinal cancers of Iranian patients. Int J Biol Markers. 2015;30(3):e315–e320. doi:10.5301/jbm.5000137. [DOI] [PubMed] [Google Scholar]
27. Forghanifard MM, Ardalan Khales S, Javdani-Mallak A, Rad A, Farshchian M, Abbaszadegan MR. Stemness state regulators SALL4 and SOX2 are involved in progression and invasiveness of esophageal squamous cell carcinoma. Med Oncol. 2014;31(4):922–927. [DOI] [PubMed] [Google Scholar]
28. Wang Z, Qiao Q, Chen M, et al. miR-625 down-regulation promotes proliferation and invasion in esophageal cancer by targeting SOX2. FEBS Lett. 2014;588(6):915–921 [DOI] [PubMed] [Google Scholar]
29. Askari M, Sahebkar A, Iranshahi M. Synthesis and purification of 7-prenyloxycoumarins and herniarin as bioactive natural coumarins. Iran J Basic Med Sci. 2009;12(2):63–69. [Google Scholar]
30. de Medina P, Genovese S, Paillasse MR, et al. Auraptene is an inhibitor of cholesterol esterification and a modulator of estrogen receptors. Mol Pharmacol. 2010;78(5):827–836. [DOI] [PubMed] [Google Scholar]
31. Kawabata K, Murakami A, Ohigashi H. Citrus auraptene targets translation of MMP-7 (matrilysin) via ERK1/2-dependent and mTOR-independent mechanism. FEBS Lett. 2006;580(22):5288–5294. [DOI] [PubMed] [Google Scholar]
32. Nabekura T, Yamaki T, Kitagawa S. Effects of chemopreventive citrus phytochemicals on human P-glycoprotein and multidrug resistance protein 1. Eur J Pharmacol. 2008;600(1-3):45–49. [DOI] [PubMed] [Google Scholar]
33. Ilson DH. Cancer of the gastroesophageal junction: current therapy options. Curr Treat Options Oncol. 2006;7(5):410–423. [DOI] [PubMed] [Google Scholar]
34. Kleiner-Hancock HE, Shi R, et al. Effects of ATRA combined with citrus and ginger-derived compounds in human SCC xenografts. BMC Cancer. 2010;10:394. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Sprowl JA, Ness RA, Sparreboom A. Polymorphic transporters and platinum pharmacodynamics. Drug Metab Pharmacokinet. 2013;28(1):19–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Wang WB, Yang Y, Zhao YP, Zhang TP, Liao Q, Shu H. Recent studies of 5-fluorouracil resistance in pancreatic cancer. World J Gastroenterol. 2014;20(42):15682–15690. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Pflaum J, Schlosser S, Muller M. p53 Family and cellular stress responses in cancer. Front Oncol. 2014;4:285. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Kreis NN, Louwen F, Yuan J. Less understood issues: p21(Cip1) in mitosis and its therapeutic potential. Oncogene. 2015;34(14):1758–1767. [DOI] [PubMed] [Google Scholar]
39. Ji J, Wu K, Wu M, Zhan Q. p53 functional activation is independent of its genotype in five esophageal squamous cell carcinoma cell lines. Front Med China. 2010;4(4):412–418. [DOI] [PubMed] [Google Scholar]
40. Shimada H, Ochiai T. Gene therapy for esophageal squamous cell carcinoma. Front Biosci. 2008;13:3364–3372. [DOI] [PubMed] [Google Scholar]
41. Fujii T, Kato S, Yamana H, Tanaka Y, Fujita H, Shirouzu K, Morimatsu M. Expression of G1 cell cycle markers and the effect of adenovirus-mediated overexpression of p21Waf-1 in squamous cell carcinoma of the esophagus. Int J Oncol. 2001;18(1):157–163. [PubMed] [Google Scholar]
42. Yan Y, Zuo X, Wei D. Concise review: emerging role of CD44 in cancer stem cells: a promising biomarker and therapeutic target. Stem Cells Transl Med. 2015;4(9):1033–1043. [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Le Bras GF, Allison GL, Richards NF, Ansari SS, Washington MK, Andl CD. CD44 upregulation in E-cadherin-negative esophageal cancers results in cell invasion. PLoS One. 2011;6(11):e27063. [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Du Q, Yan W, Burton VH, et al. Validation of esophageal squamous cell carcinoma candidate genes from high-throughput transcriptomic studies. Am J Cancer Res. 2013;3(4):402–410. [PMC free article] [PubMed] [Google Scholar]
45. Minato T, Yamamoto Y, Seike J, et al. Aldehyde dehydrogenase 1 expression is associated with poor prognosis in patients with esophageal squamous cell carcinoma. Ann Surg Oncol. 2013;20(1):209–217. [DOI] [PubMed] [Google Scholar]
46. Siddique HR, Saleem M. Role of BMI1, a stem cell factor, in cancer recurrence and chemoresistance: preclinical and clinical evidences. Stem Cells. 2012;30(3):372–378. [DOI] [PubMed] [Google Scholar]
47. He XT, Cao XF, Ji L, et al. Association between Bmi1 and clinicopathological status of esophageal squamous cell carcinoma. World J Gastroenterol. 2009;15(19):2389–2394. [DOI] [PMC free article] [PubMed] [Google Scholar]
48. Liu WL, Guo XZ, Zhang LJ, et al. Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma. BMC Cancer. 2010;10:467. [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Hwang CC, Nieh S, Lai CH, et al. A retrospective review of the prognostic value of ALDH-1. Bmi-1 and Nanog stem cell markers in esophageal squamous cell carcinoma. PLoS One. 2014;9:e105676. [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Cheng W, Liu T, Wan X, Gao Y, Wang H. MicroRNA-199a targets CD44 to suppress the tumorigenicity and multidrug resistance of ovarian cancer-initiating cells. FEBS J. 2012;279(11):2047–2059. [DOI] [PubMed] [Google Scholar]
51. Gao Y, Foster R, Yang X, et al. Up-regulation of CD44 in the development of metastasis, recurrence and drug resistance of ovarian cancer. Oncotarget. 2015;6(11):9313–9326. [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Shah V, Taratula O, Garbuzenko OB, Taratula OR, Rodriguez-Rodriguez L, Minko T. Targeted nanomedicine for suppression of CD44 and simultaneous cell death induction in ovarian cancer: an optimal delivery of siRNA and anticancer drug. Clin Cancer Res. 2013;19(22):6193–6204. [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Xu XH, Liu Y, Li DJ, et al. Effect of shRNA-mediated gene silencing of Bmi-1 expression on chemosensitivity of CD44+ nasopharyngeal carcinoma cancer stem-like cells [published online August 20, 2015]. Technol Cancer Res Treat. 2015; pii:1533034615599461. [DOI] [PubMed] [Google Scholar]
54. Hong Y, Shang C, Xue YX, Liu YH. Silencing of Bmi-1 gene enhances chemotherapy sensitivity in human glioblastoma cells. Med Sci Monit. 2015;21:1002–1007. [DOI] [PMC free article] [PubMed] [Google Scholar]
55. Wu Z, Min L, Chen D, et al. Overexpression of BMI-1 promotes cell growth and resistance to cisplatin treatment in osteosarcoma. PLoS One. 2011;6(2):e14648. [DOI] [PMC free article] [PubMed] [Google Scholar]
56. Mao N, He G, Rao J, Lv L. Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism. Nan Fang Yi Ke Da Xue Xue Bao. 2014;34(7):1000–10004. [PubMed] [Google Scholar]
57. Wang E, Bhattacharyya S, Szabolcs A, et al. Enhancing chemotherapy response with Bmi-1 silencing in ovarian cancer. PLoS One. 2011;6:e17918. [DOI] [PMC free article] [PubMed] [Google Scholar]
58. Xu ZY, Tang JN, Xie HX, et al. 5-Fluorouracil chemotherapy of gastric cancer generates residual cells with properties of cancer stem cells. Int J Biol Sci. 2015;11(3):284–294. [DOI] [PMC free article] [PubMed] [Google Scholar]
59. Qin L, Zhang X, Zhang L, et al. Downregulation of BMI-1 enhances 5-fluorouracil-induced apoptosis in nasopharyngeal carcinoma cells. Biochem Biophys Res Commun. 2008;371(3):531–535. [DOI] [PubMed] [Google Scholar]
60. Yin J, Zheng G, Jia X, et al. A Bmi1-miRNAs cross-talk modulates chemotherapy response to 5-fluorouracil in breast cancer cells. PLoS One. 2013;8(9):e73268. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

[bibr1-1533034616650119] 1. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87–108. [DOI] [PubMed] [Google Scholar]

[bibr2-1533034616650119] 2. Lim B, Jiang Y. Current and emerging systemic therapy in gastro-esophageal cancer “the old and new therapy for metastatic disease, the role of adjuvant and neoadjuvant therapy for localized disease”. Curr Clin Pharmacol. 2015;10(4):267–278. [DOI] [PubMed] [Google Scholar]

[bibr3-1533034616650119] 3. Facompre N, Nakagawa H, Herlyn M, Basu D. Stem-like cells and therapy resistance in squamous cell carcinomas. Adv Pharmacol. 2012;65:235–265. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr4-1533034616650119] 4. Rassouli FB, Matin MM, Saeinasab M. Cancer stem cells in human digestive tract malignancies. Tumour Biol. 2016;37(1):7–21. [DOI] [PubMed] [Google Scholar]

[bibr5-1533034616650119] 5. Rassouli FB, Matin MM, Bahrami AR, et al. Evaluating stem and cancerous biomarkers in CD15+CD44+ KYSE30 cells. Tumour Biol. 2013;34(5):2909–2920. [DOI] [PubMed] [Google Scholar]

[bibr6-1533034616650119] 6. Lu C, Xu F, Gu J, et al. Clinical and biological significance of stem-like CD133+CXCR4+ cells in esophageal squamous cell carcinoma. J Thorac Cardiovasc Surg. 2015;150(2):386–395. [DOI] [PubMed] [Google Scholar]

[bibr7-1533034616650119] 7. Tang KH, Dai YD, Tong M, et al. A CD90(+) tumor-initiating cell population with an aggressive signature and metastatic capacity in esophageal cancer. Cancer Res. 2013;73(7):2322–2332 [DOI] [PubMed] [Google Scholar]

[bibr8-1533034616650119] 8. Genovese S, Epifano F. Auraptene: a natural biologically active compound with multiple targets. Curr Drug Targets. 2011;12(3):381–386. [DOI] [PubMed] [Google Scholar]

[bibr9-1533034616650119] 9. Tanaka T, Kawabata K, Kakumoto M, et al. Chemoprevention of 4-nitroquinoline 1-oxide-induced oral carcinogenesis by citrus auraptene in rats. Carcinogenesis. 1998;19(3):425–431. [DOI] [PubMed] [Google Scholar]

[bibr10-1533034616650119] 10. Hayashi K, Suzuki R, Miyamoto S, et al. Citrus auraptene suppresses azoxymethane-induced colonic preneoplastic lesions in C57BL/KsJ-db/db mice. Nutr Cancer. 2007;58(1):75–84. [DOI] [PubMed] [Google Scholar]

[bibr11-1533034616650119] 11. Kohno H, Suzuki R, Curini M, et al. Dietary administration with prenyloxycoumarins, auraptene and collinin, inhibits colitis-related colon carcinogenesis in mice. Int J Cancer. 2006;118(12):2936–2942. [DOI] [PubMed] [Google Scholar]

[bibr12-1533034616650119] 12. Tanaka T, de Azevedo MB, Durn N, et al. Colorectal cancer chemoprevention by 2 beta-cyclodextrin inclusion compounds of auraptene and 4’-geranyloxyferulic acid. Int J Cancer. 2010;126(4):830–840. [DOI] [PubMed] [Google Scholar]

[bibr13-1533034616650119] 13. Kawabata K, Tanaka T, Yamamoto T, et al. Suppression of N-nitrosomethylbenzylamine-induced rat esophageal tumorigenesis by dietary feeding of 1’-acetoxychavicol acetate. Jpn J Cancer Res. 2000;91(2):148–155. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr14-1533034616650119] 14. Sakata K, Hara A, Hirose Y, et al. Dietary supplementation of the citrus antioxidant auraptene inhibits N, N-diethylnitrosamine-induced rat hepatocarcinogenesis. Oncol. 2004;66(3):244–252. [DOI] [PubMed] [Google Scholar]

[bibr15-1533034616650119] 15. Hara A, Sakata K, Yamada Y, et al. Suppression of beta-catenin mutation by dietary exposure of auraptene, a citrus antioxidant, in N, N-diethylnitrosamine-induced hepatocellular carcinomas in rats. Oncol Rep. 2005;14(2):345–351. [PubMed] [Google Scholar]

[bibr16-1533034616650119] 16. Krishnan P, Yan KJ, Windler D, et al. Citrus auraptene suppresses cyclin D1 and significantly delays N-methyl nitrosourea induced mammary carcinogenesis in female Sprague-Dawley rats. BMC Cancer. 2009;9:259. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr17-1533034616650119] 17. Tang M, Ogawa K, Asamoto M, et al. Effects of citrus nobiletin and auraptene in transgenic rats developing adenocarcinoma of the prostate (TRAP) and humane prostate carcinoma cells. Cancer Sci. 2007;98(4):471–477. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr18-1533034616650119] 18. Murakami A, Kuki W, Takahashi Y, et al. Auraptene, a citrus coumarin, inhibits 12-O-tetradecanoylphorbol-13-acetate-induced tumor promotion in ICR mouse skin, possibly through suppression of superoxide generation in leukocytes. Jpn J Cancer Res. 1997;88(5):443–452. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr19-1533034616650119] 19. Mori H, Niwa K, Zheng Q, Yamada Y, Sakata K, Yoshimi N. Cell proliferation in cancer prevention; effects of preventive agents on estrogen-related endometrial carcinogenesis model and on an in vitro model in human colorectal cells. Mutat Res. 2001;480-481:201–207. [DOI] [PubMed] [Google Scholar]

[bibr20-1533034616650119] 20. Moon JY, Kim H, Cho SK. Auraptene, a major compound of supercritical fluid extract of phalsak (Citrus Hassaku Hort ex Tanaka), induces apoptosis through the suppression of mTOR pathways in human gastric cancer SNU-1 cells. Evid Based Complement Alternat Med. 2015;2015:402385. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr21-1533034616650119] 21. Jun DY, Kim JS, Park HS, et al. Apoptogenic activity of auraptene of Zanthoxylum schinifolium toward human acute leukemia Jurkat T cells is associated with ER stress-mediated caspase-8 activation that stimulates mitochondria-dependent or -independent caspase cascade. Carcinogenesis. 2007;28(6):1303–1313. [DOI] [PubMed] [Google Scholar]

[bibr22-1533034616650119] 22. Jang Y, Han J, Kim SJ, et al. Suppression of mitochondrial respiration with auraptene inhibits the progression of renal cell carcinoma: involvement of HIF-1α degradation. Oncotarget. 2015;6(35):38127–38138. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr23-1533034616650119] 23. Krishnan P, Kleiner-Hancock H. Effects of auraptene on IGF-1 stimulated cell cycle progression in the human breast cancer cell line, MCF-7. Int J Breast Cancer. 2012;2012:502092. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr24-1533034616650119] 24. Epifano F, Genovese S, Miller R, Majumdar AP. Auraptene and its effects on the re-emergence of colon cancer stem cells. Phytother Res. 2013;27(5):784–786. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr25-1533034616650119] 25. Islam F, Gopalan V, Wahab R, Smith RA, Lam AK. Cancer stem cells in oesophageal squamous cell carcinoma: Identification, prognostic and treatment perspectives. Crit Rev Oncol Hematol. 2015;96(1):9–19. [DOI] [PubMed] [Google Scholar]

[bibr26-1533034616650119] 26. Rassouli FB, Matin MM, Bahrami AR, et al. SOX2 expression in gastrointestinal cancers of Iranian patients. Int J Biol Markers. 2015;30(3):e315–e320. doi:10.5301/jbm.5000137. [DOI] [PubMed] [Google Scholar]

[bibr27-1533034616650119] 27. Forghanifard MM, Ardalan Khales S, Javdani-Mallak A, Rad A, Farshchian M, Abbaszadegan MR. Stemness state regulators SALL4 and SOX2 are involved in progression and invasiveness of esophageal squamous cell carcinoma. Med Oncol. 2014;31(4):922–927. [DOI] [PubMed] [Google Scholar]

[bibr28-1533034616650119] 28. Wang Z, Qiao Q, Chen M, et al. miR-625 down-regulation promotes proliferation and invasion in esophageal cancer by targeting SOX2. FEBS Lett. 2014;588(6):915–921 [DOI] [PubMed] [Google Scholar]

[bibr29-1533034616650119] 29. Askari M, Sahebkar A, Iranshahi M. Synthesis and purification of 7-prenyloxycoumarins and herniarin as bioactive natural coumarins. Iran J Basic Med Sci. 2009;12(2):63–69. [Google Scholar]

[bibr30-1533034616650119] 30. de Medina P, Genovese S, Paillasse MR, et al. Auraptene is an inhibitor of cholesterol esterification and a modulator of estrogen receptors. Mol Pharmacol. 2010;78(5):827–836. [DOI] [PubMed] [Google Scholar]

[bibr31-1533034616650119] 31. Kawabata K, Murakami A, Ohigashi H. Citrus auraptene targets translation of MMP-7 (matrilysin) via ERK1/2-dependent and mTOR-independent mechanism. FEBS Lett. 2006;580(22):5288–5294. [DOI] [PubMed] [Google Scholar]

[bibr32-1533034616650119] 32. Nabekura T, Yamaki T, Kitagawa S. Effects of chemopreventive citrus phytochemicals on human P-glycoprotein and multidrug resistance protein 1. Eur J Pharmacol. 2008;600(1-3):45–49. [DOI] [PubMed] [Google Scholar]

[bibr33-1533034616650119] 33. Ilson DH. Cancer of the gastroesophageal junction: current therapy options. Curr Treat Options Oncol. 2006;7(5):410–423. [DOI] [PubMed] [Google Scholar]

[bibr34-1533034616650119] 34. Kleiner-Hancock HE, Shi R, et al. Effects of ATRA combined with citrus and ginger-derived compounds in human SCC xenografts. BMC Cancer. 2010;10:394. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr35-1533034616650119] 35. Sprowl JA, Ness RA, Sparreboom A. Polymorphic transporters and platinum pharmacodynamics. Drug Metab Pharmacokinet. 2013;28(1):19–27. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr36-1533034616650119] 36. Wang WB, Yang Y, Zhao YP, Zhang TP, Liao Q, Shu H. Recent studies of 5-fluorouracil resistance in pancreatic cancer. World J Gastroenterol. 2014;20(42):15682–15690. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr37-1533034616650119] 37. Pflaum J, Schlosser S, Muller M. p53 Family and cellular stress responses in cancer. Front Oncol. 2014;4:285. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr38-1533034616650119] 38. Kreis NN, Louwen F, Yuan J. Less understood issues: p21(Cip1) in mitosis and its therapeutic potential. Oncogene. 2015;34(14):1758–1767. [DOI] [PubMed] [Google Scholar]

[bibr39-1533034616650119] 39. Ji J, Wu K, Wu M, Zhan Q. p53 functional activation is independent of its genotype in five esophageal squamous cell carcinoma cell lines. Front Med China. 2010;4(4):412–418. [DOI] [PubMed] [Google Scholar]

[bibr40-1533034616650119] 40. Shimada H, Ochiai T. Gene therapy for esophageal squamous cell carcinoma. Front Biosci. 2008;13:3364–3372. [DOI] [PubMed] [Google Scholar]

[bibr41-1533034616650119] 41. Fujii T, Kato S, Yamana H, Tanaka Y, Fujita H, Shirouzu K, Morimatsu M. Expression of G1 cell cycle markers and the effect of adenovirus-mediated overexpression of p21Waf-1 in squamous cell carcinoma of the esophagus. Int J Oncol. 2001;18(1):157–163. [PubMed] [Google Scholar]

[bibr42-1533034616650119] 42. Yan Y, Zuo X, Wei D. Concise review: emerging role of CD44 in cancer stem cells: a promising biomarker and therapeutic target. Stem Cells Transl Med. 2015;4(9):1033–1043. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr43-1533034616650119] 43. Le Bras GF, Allison GL, Richards NF, Ansari SS, Washington MK, Andl CD. CD44 upregulation in E-cadherin-negative esophageal cancers results in cell invasion. PLoS One. 2011;6(11):e27063. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr44-1533034616650119] 44. Du Q, Yan W, Burton VH, et al. Validation of esophageal squamous cell carcinoma candidate genes from high-throughput transcriptomic studies. Am J Cancer Res. 2013;3(4):402–410. [PMC free article] [PubMed] [Google Scholar]

[bibr45-1533034616650119] 45. Minato T, Yamamoto Y, Seike J, et al. Aldehyde dehydrogenase 1 expression is associated with poor prognosis in patients with esophageal squamous cell carcinoma. Ann Surg Oncol. 2013;20(1):209–217. [DOI] [PubMed] [Google Scholar]

[bibr46-1533034616650119] 46. Siddique HR, Saleem M. Role of BMI1, a stem cell factor, in cancer recurrence and chemoresistance: preclinical and clinical evidences. Stem Cells. 2012;30(3):372–378. [DOI] [PubMed] [Google Scholar]

[bibr47-1533034616650119] 47. He XT, Cao XF, Ji L, et al. Association between Bmi1 and clinicopathological status of esophageal squamous cell carcinoma. World J Gastroenterol. 2009;15(19):2389–2394. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr48-1533034616650119] 48. Liu WL, Guo XZ, Zhang LJ, et al. Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma. BMC Cancer. 2010;10:467. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr49-1533034616650119] 49. Hwang CC, Nieh S, Lai CH, et al. A retrospective review of the prognostic value of ALDH-1. Bmi-1 and Nanog stem cell markers in esophageal squamous cell carcinoma. PLoS One. 2014;9:e105676. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr50-1533034616650119] 50. Cheng W, Liu T, Wan X, Gao Y, Wang H. MicroRNA-199a targets CD44 to suppress the tumorigenicity and multidrug resistance of ovarian cancer-initiating cells. FEBS J. 2012;279(11):2047–2059. [DOI] [PubMed] [Google Scholar]

[bibr51-1533034616650119] 51. Gao Y, Foster R, Yang X, et al. Up-regulation of CD44 in the development of metastasis, recurrence and drug resistance of ovarian cancer. Oncotarget. 2015;6(11):9313–9326. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr52-1533034616650119] 52. Shah V, Taratula O, Garbuzenko OB, Taratula OR, Rodriguez-Rodriguez L, Minko T. Targeted nanomedicine for suppression of CD44 and simultaneous cell death induction in ovarian cancer: an optimal delivery of siRNA and anticancer drug. Clin Cancer Res. 2013;19(22):6193–6204. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr53-1533034616650119] 53. Xu XH, Liu Y, Li DJ, et al. Effect of shRNA-mediated gene silencing of Bmi-1 expression on chemosensitivity of CD44+ nasopharyngeal carcinoma cancer stem-like cells [published online August 20, 2015]. Technol Cancer Res Treat. 2015; pii:1533034615599461. [DOI] [PubMed] [Google Scholar]

[bibr54-1533034616650119] 54. Hong Y, Shang C, Xue YX, Liu YH. Silencing of Bmi-1 gene enhances chemotherapy sensitivity in human glioblastoma cells. Med Sci Monit. 2015;21:1002–1007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr55-1533034616650119] 55. Wu Z, Min L, Chen D, et al. Overexpression of BMI-1 promotes cell growth and resistance to cisplatin treatment in osteosarcoma. PLoS One. 2011;6(2):e14648. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr56-1533034616650119] 56. Mao N, He G, Rao J, Lv L. Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism. Nan Fang Yi Ke Da Xue Xue Bao. 2014;34(7):1000–10004. [PubMed] [Google Scholar]

[bibr57-1533034616650119] 57. Wang E, Bhattacharyya S, Szabolcs A, et al. Enhancing chemotherapy response with Bmi-1 silencing in ovarian cancer. PLoS One. 2011;6:e17918. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr58-1533034616650119] 58. Xu ZY, Tang JN, Xie HX, et al. 5-Fluorouracil chemotherapy of gastric cancer generates residual cells with properties of cancer stem cells. Int J Biol Sci. 2015;11(3):284–294. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bibr59-1533034616650119] 59. Qin L, Zhang X, Zhang L, et al. Downregulation of BMI-1 enhances 5-fluorouracil-induced apoptosis in nasopharyngeal carcinoma cells. Biochem Biophys Res Commun. 2008;371(3):531–535. [DOI] [PubMed] [Google Scholar]

[bibr60-1533034616650119] 60. Yin J, Zheng G, Jia X, et al. A Bmi1-miRNAs cross-talk modulates chemotherapy response to 5-fluorouracil in breast cancer cells. PLoS One. 2013;8(9):e73268. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

PERMALINK

Auraptene Attenuates Malignant Properties of Esophageal Stem-Like Cancer Cells

Saffiyeh Saboor-Maleki, MSc

Fatemeh B Rassouli, PhD

Maryam M Matin, PhD

Mehrdad Iranshahi, PhD

Abstract

Introduction