ABSTRACT
The conserved PYR/PYL/RCAR family acts as abscisic acid (ABA) receptors for land plants to adapt to terrestrial environments. Our recent study reported that the exogenous overexpression of poplar PtPYRL1 and PtPYRL5, the PYR/PYL/RCAR orthologs, promoted the sensitivity of transgenic Arabidopsis to ABA responses. Here, we surveyed the PtPYRL family in poplar, and revealed that although the sequence and structure are relatively conserved among these receptors, PtPYRL members have differential expression patterns and the sensitivity to ABA or drought treatment, suggesting that PtPYRLs might be good candidates to a future biotechnological use to enhance poplar resistance to water-stress environments.
KEYWORDS: ABA signaling, abscisic acid (ABA), dehydration tolerance, poplar, PYR/PYL/RCAR receptors
Land plants evolved the tolerance to cellular dehydration as one of the key solutions to survival on terrestrial environmental stresses such as desiccation, salinity, and freezing. Abscisic acid (ABA), which is known to be a phytohormone that plays a critical role in regulating stress tolerance, plant growth and development, is involved in developing cellular dehydration tolerance under stress conditions.1 ABA is transiently synthesized and binds to the receptor PYR1 (Pyrabactin Resistance 1)/PYL(PYR-Like)/RCAR (Regulatory Component of ABA Receptor) family (PYR/PYL/RCAR for short) to trigger the ABA signaling pathway for higher plants to adapt to biotic and abiotic stress.1-3
The PYR/PYL/RCARs encode small proteins homologous to the START (steroidogenic acute regulatory-related lipid transfer) superfamily members, sharing a conserved hydrophobic ligand-binding pocket.3,4 In the absence of ABA, PYR/PYL/RCARs leave group A protein phosphatase 2C (PP2C) to interact with SNF1-related protein kinase 2 (SnRK2) and to inactivate their kinase activity. Once binding with ABA, however, PYR/PYL/RCARs break the interaction of group A PP2C and SnRK2, leading to the inhibition of group A PP2C and facilitating SnRK2 activation to phosphorylate the downstream factors.2,3 It is evident that PYR/PYL/RCAR-PP2C-SnRK2 complex is a core component in inducing of ABA signaling in plants.5,6
As initial factors in the induction of ABA signaling, the development of PYR/PYL/RCARs is supposed to be a critical event in the evolution from aquatic to terrestrial plants.6 PYR/PYL/RCARs do not exist in aquatic algae Chlamydomonas. However, the numbers of PYR/PYL/RCAR family members are increased from mosses, ferns, to angiosperms.6 For example, component numbers of Physcomitrella patens, Selaginella moellendorffii and Arabidopsis thaliana, the representatives for bryophyte, lycophyte and angiosperm, increase from 4, 10, to 14, respectively. In general, the numbers of PYR/PYL/RCARs are more than those of group A PP2C, indicating the receptors are specific and overlapping to interact with group A PP2C, and thus to form a complex ABA signaling network. This complex network might function specifically and redundantly in cellular regulation, conferring plants to survive in the harsh, changing terrestrial environments.
Poplar (Polulus) is one of the most widely distributed wood plants in the earth, including the drought, high salinity, and low temperature areas, indicating specific poplar species have high tolerance to survive in these areas. Considering that PYR/PYL/RCARs play potential roles in the tolerance to cellular dehydration, we recently reported that Polulus trichocarpa genome has 14 PYR/PYL/RCAR orthologs (14 PtPYRLs) through a blast search against Arabidopsis thaliana AtPYR1 protein (At4G17870.1) sequence, indicating poplar might have multiple ABA signaling networks.7 14 PtPYRLs are classified into 3 subclasses, same as those in Arabidopsis.2,3,7 We used PtPYL1 and PtPYRL5, the genes encoding the closest and the lowest amino acid sequence to AtPYR1, respectively, to transiently express in Arabidopsis thaliana, and found that overexpression of PtPYRL1 or PtPYRL5 decreased germination rates in transgenic Arabidopsis seeds. Furthermore, PtPYRL1 and PtPYRL5 enhanced stomatal closure but reduced transpiration rate in transgenic Arabidopsis seedlings, leading to improving drought resistance in these plants. All these results indicate that PtPYRL1 and PtPYRL5 confer transgenic Arabidopsis seedlings more sensitive to ABA responses.7 However, whether PtPYRL1 and PtPYRL5 play the similar functions in poplar remains further study.
Like PYR/PYL/RCAR proteins in Arabidopsis, all of PtPYRLs proteins are composed of a highly similar helix-grip structure that is characterized by a 7-stranded β-sheet that is flanked by 2 α-helices (Fig. 1A). The PtPYRL proteins ranges from 186 to 231 amino acid residues in length, with molecular weight (MW) of 20.83 to 25.33 kDa and isoelectric point (pI) of 5.14 to 9.32, sharing the general properties of START superfamily of ubiquitous Bet v 1-fold domain proteins.4,8 Among the 14 PtPYRL proteins, the percentage of negatively charged residues (Asp and Glu) and positively charged residues (Arg and Lys) ranges from 7.2 to 15.26 %, and from 8.4 to 13.16 %, respectively (Table 1). Furthermore, the members PtPYRL2 to PtPYRL8 contain only one exon without intron, while other PtPYRLs are comprised of three exons and have the similar exon-intron structures, except for PtPYRL1 consisted of two exons and one intron (Fig. 1B). These results indicate that the gene structure is significantly conserved among the members in each subclass of PtPYRL family.
Figure 1.
Amino acid sequence alignment of AtPYR1 and putative poplar orthologous ABA receptors (A) and phylogenetic tree and gene structures (B) of members in PtPYRL family. A. The predicted secondary structure of the poplar proteins was depicted taking the crystallographic structure of AtPYR1 (Protein DataBank Code 3K90) as model and using Espript interface (http://espript.ibcp.fr/). Boxes indicate the position of the gate and latch loops. Black asterisks mark residues K59, A89, E94, R116, Y120, S122, and E141 of PYR1 involved in ABA binding. B. Phylogenetic tree and exon-intron structure of PtPYRL1–14 from Populus trichocarpa (Pt). Blue indicates the untranslated upstream/downstream regions; yellow indicates exons; black indicates introns.
Table 1.
The AtPYR1-Like genes identified from the P. trichocarpa.
| Gene name | Gene ID | Chromo-some | Start | End | gDNA (bp) | mRNA (bp) | Protein (aa) | MW (kDa) | pI | n.c.r (%) | p.c.r. (%) |
|---|---|---|---|---|---|---|---|---|---|---|---|
| PtPYRL1 | 18094169 | 01 | 11506203 | 11508026 | 1824 | 1251 | 203 | 22647.40 | 5.51 | 13.3 | 10.34 |
| PtPYRL2 | 18096970 | 03 | 11883722 | 11884385 | 664 | 664 | 203 | 22336.01 | 5.14 | 13.79 | 9.35 |
| PtPYRL3 | 7463747 | 18 | 5721480 | 5722323 | 844 | 844 | 189 | 20950.77 | 5.62 | 12.7 | 9.5 |
| PtPYRL4 | 7470707 | 06 | 24114812 | 24115539 | 728 | 728 | 191 | 21248.02 | 5.43 | 13.6 | 9.4 |
| PtPYRL5 | 7464619 | 10 | 18106430 | 18107759 | 1330 | 1330 | 214 | 23276.36 | 7.67 | 7.9 | 8.4 |
| PtPYRL6 | 7487337 | 06 | 8028132 | 8029238 | 1107 | 1107 | 221 | 24059.16 | 8.73 | 7.2 | 9 |
| PtPYRL7 | 7472448 | 08 | 4559774 | 4560455 | 682 | 682 | 231 | 25330.73 | 9.32 | 7.36 | 10.8 |
| PtPYRL8 | 7488718 | 16 | 12848361 | 12849431 | 1071 | 1071 | 221 | 24013.91 | 7.68 | 8.14 | 8.6 |
| PtPYRL9 | 7497243 | 02 | 12836745 | 12839568 | 2824 | 1310 | 186 | 20834.74 | 6.05 | 13.4 | 11.29 |
| PtPYRL10 | 7492771 | 14 | 7581021 | 7585127 | 4107 | 2158 | 186 | 21000.84 | 6.44 | 13.44 | 12.36 |
| PtPYRL11 | 7453841 | 15 | 1490063 | 1492691 | 2629 | 1079 | 191 | 21343.24 | 5.55 | 14.66 | 11 |
| PtPYRL12 | 7465313 | 03 | 15687453 | 15689921 | 2469 | 1123 | 190 | 21527.63 | 6.06 | 15.26 | 13.16 |
| PtPYRL13 | 7485222 | 12 | 98906 | 101864 | 2959 | 1408 | 191 | 21369.16 | 5.78 | 15.18 | 11.52 |
| PtPYRL14 | 7472711 | 01 | 7292621 | 7295221 | 2601 | 1180 | 190 | 21454.54 | 6.24 | 14.73 | 13.16 |
Multiple conserved residues in PYR/PYL/RCAR receptors are response for binding agonist ABA and allow the receptors to dock into their downstream group A PP2C.9 We found that the key conserved residues response for binding the agonists, such as Leu 87 and Leu 117 of the β3–β4 and β5–β6 loops and Asn 151 before the α4-helix, are conserved in all PtPYRL family members (Fig. 1A). Meanwhile, the key residues locate in the β3–β4 loop that play a critical role in the protein interaction among agonists, receptors and group A PP2C are also conserved among PtPYRLs. PtPYRLs have Ile 38, Val 45, Arg 50, and Lys 59 (Fig. 1A), the amino acid residues are supposed to control the access of the ligand to the lower part of the cavity of receptors.10 We also used MEME software to analyze the conserved motifs of PtPYRLs with motif specific sequences (Fig. 2B). The number of conserved motifs in each PtPYRL varied between 6 and 8. Among the detected motifs, motif 1, 2, 3, 4, 6, and 13 exist in most PtPYRLs (Fig. 2A). One of them, motif 1 contains the highly conserved gate-like and latch-like loops (Fig. 2A), the key structures in binding agonists.9 These results suggest partial functional similarities among PtPYRL members.
Figure 2.
The conserved protein motifs of members in PtPYRL family. A. The conserved motifs identified using MEME software. B. Motif sequences identified by MEME.
Our previous study showed that PtPYRL1 and PtPYRL5 strongly expressed in the leaves, and had low level in stems and roots.7 We further analyzed the spatial and temporal expression profiles of all PtPYRLs in the tissues including the leaves grown in the early stage (old leaves) or the late stage (young leaves), stems, shoot tips, and roots of 2-month-old poplar with the gene-specific primers (Table 2). All PtPYRLs had relatively higher expression level in leaves. Interestingly, their levels in young leaves are much higher than those in old ones (Fig. 3), indicating that young leaves have higher synthesis or lower degradation of PtPYRLs than old leaves. Ten PtPYRLs (1, 2, 5, 6, and 8 to 13) were highly expressed in shoot tips. Noticeably, PtPYRL2 showed the highest expression level compared with others. Additionally, three PtPYRLs (1, 2, and 5) were expressed in stems. Moreover, the expression of most PtPYRLs was absent in the roots, except for PtPYRL2 and PtPYRL4. These 2 PtPYRLs might play potential functions in in root tissue since ABA signaling is required to maintain root system architecture.1,11 Taken together, the overlapping and preferential expression patterns of these PtPYRLs might confer poplar to conduct distinct ABA responses in specific tissues.
Table 2.
List of primers used in this study.
| Names | Sequences (5′ to 3′) | Purposes |
|---|---|---|
| PtPYRL1-RT-F | CCCACCACGTCACAATCCCACCTAG | PtPYRL1 qRT-PCR |
| PtPYRL1-RT-R | GCCACGCTGCAGCTCTTGATGAAG | |
| PtPYRL5-RT-F | GCCGCCATCCCTACCACAACAAC | PtPYRL5 qRT-PCR |
| PtPYRL5-RT-R | CGGTGGAGACTGGTGCATTGATGG | |
| EF1β-RT-F | GACAAGAAGGCAGCGGAGGAGAG | EF1β qRT-PCR |
| EF1β-RT-R | CAATGAGGGAATCCACTGACACAAG | |
| PtPYRL2-RT-F | CCACCACATCACCATCCCAT | PtPYRL2 qRT-PCR |
| PtPYRL2-RT-R | ACCTGCGCTGATTCTGTAGG | |
| PtPYRL3-RT-F | AGCTTTAGGGTTGTTGGGGG | PtPYRL3 qRT-PCR |
| PtPYRL3-RT-R | TTCACCTGTATTGCCCCCTG | |
| PtPYRL4-RT-F | ATGGATGCTAATCACGCCCC | PtPYRL4 qRT-PCR |
| PtPYRL4-RT-R | CTGGCGCATCAATACGTTGG | |
| PtPYRL6-RT-F | ATGCGTCACCCACAGGTA | PtPYRL6 qRT-PCR |
| PtPYRL6-RT-R | TGCGTCTATTCTTGTTCTCCG | |
| PtPYRL7-RT-F | ACAAACCACCGTGAACACAT | PtPYRL7 qRT-PCR |
| PtPYRL7-RT-R | GGTGGCAACTGGCGCA | |
| PtPYRL8-RT-F | TGGGCACTCTCCGTGAAATC | PtPYRL8 qRT-PCR |
| PtPYRL8-RT-R | GGTCCCCACCAACAACACTA | |
| PtPYRL9-RT-F | CATTTGTGAGCAGGTGCGTT | PtPYRL9 qRT-PCR |
| PtPYRL9-RT-R | TCTTGACCCCAAGGATGTGC | |
| PtPYRL10-RT-F | CATCAAAGCTCCTGCACACC | PtPYRL10 qRT-PCR |
| PtPYRL10-RT-R | CACACCTGCTCACAAATGGC | |
| PtPYRL11-RT-F | CATCAGCAGGTGTGTTGTGC | PtPYRL11 qRT-PCR |
| PtPYRL11-RT-R | GTGATCCCCGCCAACTATCC | |
| PtPYRL12-RT-F | TTGTAAGCAGGTGTGTTGTGC | PtPYRL12 qRT-PCR |
| PtPYRL12-RT-R | CCATCAGGCACATCCACAATAA | |
| PtPYRL13-RT-F | GGGACCCTGGTGATTGAGTC | PtPYRL13 qRT-PCR |
| PtPYRL13-RT-R | ATGGGCTCAGTTCGGTCCTG | |
| PtPYRL14-RT-F | CGCAGGGTGACCTTCAGATT | PtPYRL14 qRT-PCR |
| PtPYRL14-RT-R | CAACGTACCTGGTCGCTCAT |
Figure 3.
Tissue-specific expression of PtPYRL genes. Tissue-specific expression of PtPYRLs were analyzed by quantitative real-time PCR in young leaves, old leaves, shoot tips, stems, and roots of 2-month-old poplars. The relative expression level for PtPYRLs was normalized relative to the value of old leaves, which was set as 1. Quantitative real-time PCR was performed in triplicate and the fold change was analyzed via the 2−ΔΔCT method using the poplar EF1β gene as an internal control. Values represent the mean ± SD of 3 biologic replicates. Error bars indicate SD (n = 3).
To determine whether the expression of PtPYRLs are sensitive to ABA, 2-month-old hybrid poplars were treated with 50 μM ABA for 0, 1, 2, and 3 h. The transcriptional levels of 14 PtPYRLs were analyzed using qRT-PCR with the gene-specific primers (Table 2). After ABA treatment, the expression of most PtPYRLs such as PtPYRL1 to PtPYRL10, and PtPYRL12 was downregulated or was not significantly affected (Fig. 4A). On the other hand, the expression of PtPYRL11, PtPYRL13 and PtPYRL14 was upregulated. Additionally, PtPYRL11 displayed the most inducible by ABA, especially in 3 h after treatment. To further study whether PtPYRLs are involving in drought tolerance, a key function of ABA in plants, we analyzed the expression levels of these receptors under the drought stress, and found that they displayed the differential sensitivity to this stress (Fig. 4B). The expression of PtPYRL6 and PtPYRL12 was decreased, and that of PtPYRL3, and PtPYRL8 to PtPYRL10 was not changed, while the rest were induced by drought treatment, especially PtPYRL7, implying that not all PtPYRLs function in drought tolerance. These findings suggest that PtPYRLs members might play diverse roles in sensing the ABA signal for poplar to adapt to variable stresses.
Figure 4.
The sensitivity of PtPYRL to ABA or drought treatment. A. Expression level of PtPYRLs in leaves of 2-month-old poplars sprayed with 50 μM ABA for 0, 1, 2, or 3 h. The relative expression level was normalized to the value of poplars sprayed with 50 μM ABA for 0 h, which was set as 1. B. Expression patterns of PtPYRLs in leaves detached from 2-month-old poplars exposed in the air for 0, or 7 h. The relative expression level was normalized to the ratio of the value of leaves exposed in the air for 7 h to that of leaves exposed in the air for 0 h. The fold change of relative expression level was analyzed via the 2−ΔΔCT method using the poplar EF1β gene as an internal control. Values are means ± standard deviation (SD) (n = 3 independent experiments).
In summary, PYR/PYL/RCARs act as ABA receptors for land plants to adapt to water-stress terrestrial environments. In the present study, we surveyed PYR/PYL/RCARs orthologs, PtPYRLs in poplar, and revealed that although the sequence and structure are relatively conserved among these receptors, PtPYRL members have differential expression patterns and ABA sensitivity. These results, taken together with the previous data of the positive roles of two PtPYRLs in enhancing ABA sensitivity in transgenic Arabidopsis,7 suggest that PtPYRLs might be good candidates to a future biotechnological use to enhance poplar resistance to water-stress environments.
Disclosure of potential conflicts of interest
No potential conflicts of interest were disclosed.
Acknowledgments
We thank Jiangsu Collaborative Innovation Center for Modern Crop Production for technical support. This study was supported by the National Natural Science Foundation of China grant (31271626) and Natural Science Foundation of Jiangsu Province of China (BK2012306).
References
- 1.Finkelstein R. Abscisic acid synthesis and response. Arabidopsis Book. 2013;11:e0166. doi: 10.1199/tab.0166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ma Y, Szostkiewicz I, Korte A, Moes D, Yang Y, Christmann A, Grill E. Regulators of PP2C phosphatase activity function as abscisic acid sensors. Science. 2009;324(5930):1064–8. doi: 10.1126/science.1172408. [DOI] [PubMed] [Google Scholar]
- 3.Park SY, Fung P, Nishimura N, Jensen DR, Fujii H, Zhao Y, Lumba S, Santiago J, Rodrigues A, Chow TF, et al.. Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. Science. 2009;324(5930):1068–71. doi: 10.1126/science.1173041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Iyer LM, Koonin EV, Aravind L. Adaptations of the helix-grip fold for ligand binding and catalysis in the START domain superfamily. Proteins. 2001;43(2):134–44. doi: 10.1002/1097-0134(20010501)43:2%3c134::AID-PROT1025%3e3.0.CO;2-I. [DOI] [PubMed] [Google Scholar]
- 5.Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR. Abscisic acid: Emergence of a core signaling network. Annu Rev Plant Biol. 2010;61:651–79. doi: 10.1146/annurev-arplant-042809-112122. [DOI] [PubMed] [Google Scholar]
- 6.Umezawa T, Nakashima K, Miyakawa T, Kuromori T, Tanokura M, Shinozaki K, Yamaguchi-Shinozaki K. Molecular basis of the core regulatory network in ABA responses: Sensing, signaling and transport. Plant Cell Physiol. 2010;51(11):1821–39. doi: 10.1093/pcp/pcq156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Yu J, Yang L, Liu X, Tang R, Wang Y, Ge H, Wu M, Zhang J, Zhao F, Luan S, et al.. Overexpression of poplar pyrabactin resistance-like abscisic acid receptors promotes abscisic acid sensitivity and drought resistance in transgenic Arabidopsis. PLoS One. 2016;11(12):e0168040. doi: 10.1371/journal.pone.0168040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Nishimura N, Hitomi K, Arvai AS, Rambo RP, Hitomi C, Cutler SR, Schroeder JI, Getzoff ED. Structural mechanism of abscisic acid binding and signaling by dimeric PYR1. Science. 2009;326(5958):1373–9. doi: 10.1126/science.1181829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Mosquna A, Peterson FC, Park SY, Lozano-Juste J, Volkman BF, Cutler SR. Potent and selective activation of abscisic acid receptors in vivo by mutational stabilization of their agonist-bound conformation. Proc Natl Acad Sci U S A. 2011;108(51):20838–43. doi: 10.1073/pnas.1112838108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Santiago J, Dupeux F, Round A, Antoni R, Park SY, Jamin M, Cutler SR, Rodriguez PL, Márquez JA. The abscisic acid receptor PYR1 in complex with abscisic acid. Nature. 2009;462(7273):665–8. doi: 10.1038/nature08591. [DOI] [PubMed] [Google Scholar]
- 11.Duan L, Dietrich D, Ng CH, Chan PM, Bhalerao R, Bennett MJ, Dinneny JR. Endodermal ABA signaling promotes lateral root quiescence during salt stress in Arabidopsis seedlings. Plant Cell. 2013;25(1):324–41. doi: 10.1105/tpc.112.107227. [DOI] [PMC free article] [PubMed] [Google Scholar]