Abstract
Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.
Keywords: Wheat, durum, stem rust, resistance gene, Ug99
Stem rust caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn. (Pgt) is a devastating fungal disease of both common (Triticum aestivum L., 2n = 6x = 42, AABBDD) and durum wheat (Triticum turgidum ssp. durum (Desf.) Husnot, 2n = 4x = 28, AABB), and can culminate in significant yield losses worldwide (Singh et al. 2015). This disease has been the culprit behind several famines and epidemics around the world (Bushnell and Roelfs 1984; Kolmer et al. 2007; Park 2007). It destroyed 43% of the spring wheat crop, mostly durum, in North Dakota (Peturson 1958) in 1954 and 56% in 1935 (Leonard and Szabo 2005). Since then, this disease has been effectively controlled globally by deploying multiple sources of resistance (Kolmer et al. 1991). Near eradication of barberry has also prevented the emergence of virulent races and severe epidemics in the US (Leonard and Szabo 2005). However, the identification of race TTKSK (Ug99) in Africa, which rendered the widely deployed stem rust resistance gene Sr31 and several other Sr genes ineffective, has raised serious concerns (Jin et al. 2007; Pretorius et al. 2000). This race has spread throughout East Africa, Yemen, Iran, and South Africa (Nazari et al. 2009; Jin et al. 2008; Pretorius et al. 2010; Singh et al. 2015; Patpour et al. 2016) and is projected to spread further. Race TTKSK has evolved continuously, giving rise to at least 13 different variants, resulting in the defeat of additional stem rust resistance genes (Singh et al. 2015; Fetch et al. 2016; Newcomb et al. 2016). Overall, these new races pose a threat to our food security as 85–95% of wheat cultivars grown around the world are susceptible to at least one of the Ug99 variants (Singh et al. 2011).
Race TTKST is a variant of TTKSK (Ug99) that was first discovered in Kenya in 2006. Race TTKST is virulent to both Sr24 and Sr31 (Jin et al. 2008). In 2007, this race caused severe local epidemics in Kenya. It has since been detected in Tanzania, Ethiopia, Uganda, Eritrea, Rwanda, and Egypt (Jin et al. 2008; Pretorius et al. 2010; Wolday et al. 2011; Hale et al. 2013) and was the most prevalent Pgt race in Kenya from 2007 to 2014 (Newcomb et al. 2016). Races TTTSK, TTKTK, and TTKTT with additional virulences to Sr24, Sr36, and SrTmp (Jin et al. 2009; Newcomb et al. 2016) have substantially increased the vulnerability of wheat to stem rust because of the widespread use of these genes in global wheat breeding.
There is an urgent need to find additional genes that confer resistance to the new races of the Ug99 race group and identify reliable markers that assist breeding programs in combining these genes in desirable germplasm. However, genetic diversity for stem rust resistance in conventional common and durum wheat gene pools is limited (Singh et al. 2011), which has been a major constraint in identifying new genes effective against the Ug99 race group. Tetraploid wheats (T. turgidum ssp.) have contributed stem rust resistance genes such as Sr2, Sr9d, Sr9e, Sr9g, Sr11, Sr12, Sr13, Sr14, and Sr17 (McIntosh 1988; Simons et al. 2011; Singh et al. 2006, 2011). However, Sr13 is the only known Ug99-effective seedling Sr gene present in selected durum cultivars in the US (Simons et al. 2011). Screening wheat lines for seedling resistance against race TTKST led to the identification of a durum line called 8155-B1 that was resistant to race TTKST, but susceptible to race TTKSK. This was the first line known to possess resistance to a variant of TTKSK that is considered to be more virulent than TTKSK. 8155-B1 was also resistant to US race TMLKC and exhibited a phenotype similar to TTKST. However, the basis of this resistance was unknown. The goal of this research was to determine the genetic basis of resistance to races TTKST and TMLKC in the durum line 8155-B1 and to develop KASP (Kompetitive Allele Specific PCR) assay-based SNP markers that can be used to postulate the presence of this gene in uncharacterized germplasm.
Materials and Methods
Plant materials
8155-B1 is a T. turgidum ssp. durum line developed by Norman Williams (USDA-ARS, Fargo, ND) with the pedigree Marruecos 9623//Marruecos 9623/CItr 8155 that was characterized and selected as monogenic for stem rust resistance derived from CItr 8155 (Williams and Gough 1968). Marruecos 9623 (PI 192334) is a stem rust susceptible durum cultivar from Morocco (Williams and Gough 1968). CItr 8155 is a selection of wheat accession PI 59284 that was collected from Ethiopia in 1924. Rusty is a stem rust susceptible durum wheat line (Klindworth et al. 2006). Out of 143 Rusty*2/8155-B1 BC1F2 families, 44 lines that were either susceptible or segregating to race TTKST were employed to initially map the TTKST resistance. Similarly, out of a total of 473 F2 plants derived from Rusty/8155-B1, 152 F2 plants that were clearly resistant or susceptible to race TMLKC (see Results section) were used to map the TMLKC resistance utilizing the 90K Infinium iSelect Custom bead chip SNP genotyping platform. KASP assay-based markers were developed and evaluated on all the 143 BC1F2 families and on a set of 11 durum cultivars from the US. Eleven durum cultivars and five bread wheat genetic stock lines were evaluated with Pgt at the seedling stage and KASP assays to validate mapping results (Supplemental Material, Table S1). Previously, durum cultivar Mountrail (Elias and Miller 2000) was crossed to common wheat variety Choteau (Lanning et al. 2004) and two recombinant inbred line (RIL) populations at both 4× and 6× ploidy were derived composed of 96 and 123 individuals, respectively (Kalous et al. 2015). We assessed the seedling response of these populations to races TTKSK and TTKST in order to map the response to race TTKST using the previously constructed linkage map with SNPs genotyped utilizing the 90K Infinium iSelect Custom bead chip (Kalous et al. 2015).
Stem rust assays
A total of 473 F2 plants along with 8155-B1 and Rusty were evaluated against Pgt race TMLKC (isolate 72-41-Sp2) using a method described by Williams et al. (1992) at the USDA-ARS Cereals Crops Research Unit, Fargo, ND. At a biocontainment facility at the University of Minnesota, 25 BC1F2 plants from each of the 143 families were evaluated against Pgt race TTKST (isolate 06KEN19v3) along with Rusty and 8155-B1. Choteau, Mountrail, and the 4× and 6× Choteau/Mountrail populations were assessed in two biological replicates each for response to races TTKST and TTKSK (Ug99; 04KEN156/04). Inoculation of seedlings was performed according to previously described methods (Rouse et al. 2011). The 11 durum cultivars in addition to 8155-B1 and Rusty were evaluated with TTKSK and its variants, namely TTKST, TTTSK (07KEN24-4), TTKTT (14KEN58-1), and TTKSF+ (09ZIM01-2; race TTKSF with additional virulence to Sr9h [Pretorius et al. 2012; Rouse et al. 2014]). Races TTKSK, TTKST, TTTSK, TTKTT, and TTKSF+ are all members of the Ug99 race group (Newcomb et al. 2016). This panel was also evaluated with races JRCQC (08ETH03-1) and TRTTF (06YEM34-1) at both high (22/25° night/d) and low temperatures (15/18° night/d) with a 16-hr photoperiod in growth chambers. These two races were reported from Yemen and Ethiopia and described as particularly virulent to durum wheat (Olivera et al. 2012). The letters of each race name correspond to reaction patterns of the isolate to four stem rust resistance genes each (Jin et al. 2008). The full avirulence/virulence formulae for the isolates used this study are listed in Table S2.
Seedling evaluations of the biparental populations were conducted in greenhouse conditions (Rouse et al. 2011) and infection types were determined 14 d after inoculation following the 0–4 scale developed by Stakman et al. (1962). There are six categories of infection types in this rating scale: infection type “0” indicates an immune response with no visible symptoms, “;” indicates chlorotic or necrotic hypersensitive reactions without sporulation, “1” indicates small round rust pustules surrounded by chlorosis or necrosis, “2” indicates rust pustules surrounded by “green islands” of host tissue that are surrounded by chlorosis, “3” indicates elongated (not round) rust pustules, and “4” represents large elongated rust pustules without the presence of chlorosis or necrosis. Variation within each infection type class was captured by the use of “+” and “−” symbols that indicate relatively larger or smaller rust pustule sizes, respectively. When multiple infection types were observed on the same leaf, all infection types were listed, with the most common infection type listed first. A “/” symbol was used to separate multiple infection types recorded for a heterogeneous line where different plants within the same line displayed different infection types. Infection types “0” to “2” were classified as “low,” i.e., incompatible interactions indicative of host resistance and pathogen avirulence, whereas infection types “3” and “4” were classified as “high,” i.e., compatible interactions indicative of host susceptibility. Two biological replicates of seedling screening of the cultivar panel were performed. Significant deviation from the expected Mendelian genotypic frequencies was tested using chi-square tests.
SNP genotyping and identification of markers linked to race TTKST resistance
DNA from 22 susceptible and 22 segregating BC1F2 families in response to race TTKST and 152 F2 plants segregating for response to race TMLKC were isolated using a modified CTAB extraction method (Rouse et al. 2012) or an ammonium acetate method (Pallotta et al. 2003) and resuspended in water. Tissue from 10 BC1F2 plants from each family was bulked for extraction of DNA representing each BC1F2 family. DNA isolated from these lines was genotyped at the USDA-ARS Cereal Crops Research Unit, Fargo, ND, with 90,000 gene-based SNPs using a custom Infinium iSelect bead chip array and an iScan following the manufacturer’s instructions (Illumina Inc., Hayward, CA; Wang et al. 2014). Allele calls were performed using the genotyping module of GenomeStudio v2011.1 software (Illumina Inc.) for the BC1F2 population, whereas the polyploidy clustering module of the software was used to score the alleles of the F2 population. The SNP consensus map data (Wang et al. 2014) were imported into GenomeStudio software to assign chromosome positions.
Identification of linked markers and map construction
Pearson correlations were used initially to identify markers associated with the TTKST phenotype in the subset of 44 families belonging to the BC1F2 population (t-tests with P < 0.05). The top 16 SNP markers (P < 0.03) significantly correlated with resistance to race TTKST were converted into KASP assays. Eight of these KASP assays were polymorphic and were evaluated on the 143 BC1F2 lines. These data were used to generate a linkage map using JoinMap version 4.0 (Stam 1993; Van Ooijen 2006). Genetic distances were calculated using the Kosambi mapping function (Kosambi 1944), and linkage groups were formed at logarithm of odds (LOD) value of 5.0 and 40% maximum recombination frequency. The KASP assay-based markers were also screened on the 11 cultivars. The primer sequences designed for the KASP assays are provided in Table 1. For the F2 population, mapping of resistance to TMLKC was performed by calculating a linkage map using MapDisto 1.7.7 (Lorieux 2012). Linkage groups were created using the LOD score and Rmax value of 3.0. Map distances were calculated using the Kosambi mapping function (Kosambi 1944). For the Choteau/Mountrail populations, hexaploid and tetraploid lines were combined into one population for the purpose of mapping. Previously available 90K SNP data (Kalous et al. 2015) were combined with binary resistance data in order to map the loci corresponding to resistance to races TTKSK and TTKST.
Table 1. Primers used for KASP assays for markers derived from the 90K iSelect assay on chromosome arm 6AS.
| KASP Primer | Primer Typea | Primer Sequence |
|---|---|---|
| KASP_6AS_IWB72958 | A1 | GAAGGTGACCAAGTTCATGCTGGCTGCTGCCAACTCCCCA |
| A2 | GAAGGTCGGAGTCAACGGATTGCTGCTGCCAACTCCCCG | |
| C1 | GTACTGTGAGTGTCTCGGATGTTGAT | |
| KASP_6AS_IWB64918 | A1 | GAAGGTGACCAAGTTCATGCTGCACTTGCGACTCGAGGGTT |
| A2 | GAAGGTCGGAGTCAACGGATTGCACTTGCGACTCGAGGGTC | |
| C1 | GGCCCGGAATCCGCCACCAT | |
| KASP_6AS_IWB12224 | A1 | GAAGGTGACCAAGTTCATGCTGTTCTGCGTTGGAAATAATTTCTAGG |
| A2 | GAAGGTCGGAGTCAACGGATTCGTTCTGCGTTGGAAATAATTTCTAGT | |
| C1 | GACTTATCATGTGCTCATCAGGTTAAGTT | |
| KASP_6AS_IWB75264 | A1 | GAAGGTGACCAAGTTCATGCTAACGTGCACATCGCTTACCGC |
| A2 | GAAGGTCGGAGTCAACGGATTGAACGTGCACATCGCTTACCGT | |
| C1 | GGCCGTCGGGAACTCCACAAA | |
| KASP_6AS_IWB43809 | A1 | GAAGGTGACCAAGTTCATGCTGCTGCCAACTCCCCG |
| A2 | GAAGGTCGGAGTCAACGGATTGGCTGCTGCCAACTCCCCA | |
| C1 | GTACTGTGAGTGTCTCGGATGTTGAT | |
| KASP_6AS_IWB1550 | A1 | GAAGGTGACCAAGTTCATGCTAAAGGTGAAAGGAGCTGTTCACAGT |
| A2 | GAAGGTCGGAGTCAACGGATTGGTGAAAGGAGCTGTTCACAGC | |
| C1 | TCTGTCCTTCTCTGTCCTGGCAAT | |
| KASP_6AS_IWB61585 | A1 | GAAGGTGACCAAGTTCATGCTCCGTCAGAGAGATCATCAGAGG |
| A2 | GAAGGTCGGAGTCAACGGATTACCGTCAGAGAGATCATCAGAGA | |
| C1 | TATCTCATCACAAGTTGAGCATACTCAGA | |
| KASP_6AS_IWB10558 | A1 | GAAGGTGACCAAGTTCATGCTGATGGTTGTATACGGGCCTATGG |
| A2 | GAAGGTCGGAGTCAACGGATTGATGGTTGTATACGGGCCTATGA | |
| C1 | CTCAGCTGGCATGTATTTTTGGGGAT |
Primer types A1 and A2 are allele-specific primers, whereas primer type C1 is a common primer for both alleles.
KASP reaction conditions
Each KASP PCR consisted of 50 ng of DNA template, 5 µl of 2× KASP buffer, and 0.14 µl of primer mixture. Thermal cycling conditions were 94° for 15 min, followed by 10 cycles of touch down PCR: 94° for 20 sec, 65–57° for 60 sec (dropping 0.8° per cycle), followed by 36 cycles of regular PCR: 94° for 20 sec, 57° for 60 sec, followed by fluorescence reading at 20°. A total of 3–9 additional cycles of PCR were added to obtain a good separation of clusters, as needed. Both thermal cycling and fluorescence reading were performed on an ABI StepOnePlus Real-Time PCR system. At least two replicates of each KASP assay were performed. If inconsistent results were observed between the two replicates, a third replicate was performed.
Data availability
All data that we used to draw conclusions in this article are represented either within the article, or in the Supplemental Material. Table S1 describes the wheat lines used in this study. Table S2 describes the Pgt isolates used in this study. Table S3 describes the number of Rusty/8155-B1 F2 progeny with specific infection types observed in response to Pgt race TMLKC. Table S4 lists 90K SNP markers identified as correlated with response to Pgt race TTKST in a selection of the BC1F2 population. Table S5 contains the alleles of markers linked to Sr8155B1 in Rusty*2/8155-B1 families. Table S6 contains the alleles of markers linked to Sr8155B1 in Choteau/Mountrail RILs that displayed recombination events near Sr8155B1. Table S7 contains alleles of markers mapped to chromosome 6A in the Rusty/8155-B1 F2 population. Table S8 contains seedling infection types observed on F2 plants from the Rusty/8155-B1 population. Table S9 contains seedling infection types observed on BC1F2 families of Rusty*2/8155-B1. Table S10 contains seedling infection types observed on Choteau/Mountrail RILs in response to races TTKST and TTKSK. Figure S1 displays a range of seedling infection types observed on Rusty/8155-B1 F2 progeny in response to Pgt race TMLKC. Figure S2 displays the genetic linkage map derived from Rusty/8155-B1 F2 progeny. Figure S3 displays the seedling infection types observed on Choteau and Mountrail in response to Pgt race TTKST.
Results
Genetic basis of resistance of 8155-B1 to Pgt races TTKST and TMLKC
The durum line 8155-B1 exhibited an infection type of “0;” to “0;1,” whereas Rusty exhibited an infection type of “3+” to race TTKST (Figure 1) at both high and low temperature regimes. Race TMLKC manifested an infection type of “0;” on 8155-B1 and “3+” to “4” on Rusty (Figure S1). The F2 progeny segregated for resistance to race TMLKC, with 112 plants displaying infection types characteristic of 8155-B1-type resistance (“0;”, “;”, “;1−”, “;1”, “12”, “2;”, and “23;”) and 361 plants not exhibiting this type of resistance (infection types “2”, “23”, “32”, “3”, “43”, and “4”) (Table S3). The presence of hypersensitive reactions “;” and “1” were considered indicative of the presence of resistance derived from 8155-B1. Segregation for resistance among the F2 plants did not deviate from the expected ratio for a single recessive gene (χ2 = 0.44, P = 0.51). Out of the 75 F2 plants with infection type “0;” to “;”, 72 were selected for genotyping. Out of the 84 F2 plants with infection type “4,” 80 with adequate DNA extractions were used for genotyping.
Figure 1.
Race specificity of seedling infection types exhibited by durum line 8155-B1 in response to Puccinia graminis f. sp. tritici races TTKST and TTKSK. (A–C) are lines that were inoculated with race TTKST, whereas (D–F) are lines inoculated with race TTKSK. (A and D) correspond to wheat line Rusty, (B and E) to 8155-B1, and (C and F) to Desert King HP.
The BC1F2 families exhibited infection types (“23−” to “4”) to race TTKST when homozygous, and segregated for resistant infection types (“0;1” to “;13−”) and susceptible infection types (“23−” to “4”) when heterozygous. The segregation of resistance within BC1F2 families classified as heterozygous (865 total plants) did not deviate from the expected ratio for a single recessive gene (χ2 = 0.086, P = 0.79). The ratio of homozygous vs. heterozygous families deviated from the expected 1:1 ratio with χ2 = 16.79 (P = 4.2 × 10−5). The linked KASP assay-based SNP markers also deviated from the expected 1:1 ratio (Table 2), indicating that there was segregation distortion at this locus in the BC1F2 population. The resistance gene was tentatively designated as Sr8155B1.
Table 2. Segregation distortion for response to Puccinia graminis f. sp. tritici race TTKST and closely linked KASP markers among Rusty*2/8155-B1 BC1F2 families.
| Homozygous | ||||
|---|---|---|---|---|
| Marker | Rusty allele | Heterozygous | χ2(1:1) | P |
| TTKST response | 96 | 47 | 16.79 | 4.2 × 10−5 |
| KASP_6AS_IWB64918 | 87 | 46 | 12.64 | 3.8 × 10−4 |
| KASP_6AS_IWB1550 | 93 | 47 | 15.11 | 1.0 × 10−4 |
| KASP_6AS_IWB72598 | 89 | 52 | 9.71 | 0.002 |
| KASP_6AS_IWB43809 | 91 | 50 | 11.92 | 5.5 × 10−4 |
| KASP_6AS_IWB75264 | 86 | 50 | 9.53 | 0.0002 |
| KASP_6AS_IWB10558 | 95 | 43 | 19.59 | 9.6 × 10−6 |
| KASP_6AS_IWB61585 | 93 | 46 | 15.89 | 6.7 × 10−5 |
| KASP_6AS_IWB12224 | 86 | 46 | 12.12 | 5.0 × 10−4 |
Molecular mapping of Sr8155B1
From a total of 21 SNPs significantly correlated with race TTKST resistance in the 44 BC1F2 families (Table S4), eight polymorphic KASP assay-based markers were evaluated on 143 BC1F2 families (Table 1). Seven markers were linked to the TTKST-resistant phenotype, including KASP_6AS_IWB10558 that cosegregated with Sr8155B1 (Figure 2 and Table S5). Markers KASP_6AS_IWB61585 and KASP_6AS_IWB1550 flanked Sr8155B1 at 1.3 cM distal and 1.1 cM proximal, respectively. From the 152 F2 plants, we generated a linkage map of 116 cM (Figure S2). The linkage map clearly positioned Sr8155B1 in the short arm of chromosome 6A, and was tightly linked to three markers that also were linked to Sr8155B1 in the BC1F2 population: IWB64918, IWB43809, and IWB10558. Sr8155B1 was flanked by the SNP markers IWB55188 and IWB35219, being 7.3 cM proximal and 0.7 cM distal to Sr8155B1, respectively. The corresponding positions of these markers in the durum consensus map (Maccaferri et al. 2014) are shown in Table S4. Previously, wheat stem rust resistance gene Sr8, including alleles Sr8a and Sr8b, was mapped to the short arm of chromosome 6A (McIntosh 1972; Singh and McIntosh 1986; Bhavani et al. 2008).
Figure 2.
Genetic linkage map including Sr8155B1 and KASP assay SNP markers on chromosome arm 6AS constructed from Rusty*2/8155-B1 BC1F2 progeny. The values to the left of the marker names are the distances (cM) generated using the Kosambi distance function.
Postulation of Sr8155B1 and Sr13 in durum wheat cultivars
The 11 durum cultivars displayed a range of infection types in response to races TTKST, TTKTT, TTTSK, TTKSF+, TTKSK, TRTTF, and JRCQC (Table 3). A low infection type of “0;” to “;1” in response to race TTKST in combination with a higher infection type in response to race TTKSK was considered indicative of resistance conferred by Sr8155B1. Of the 11 cultivars evaluated, nine were postulated to possess Sr8155B1 (Table 3). The nine cultivars with Sr8155B1 in addition to 8155-B1 exhibited consistently low infection types at both temperature regimes to races TTKTT, TTTSK, TTKSF+, and TRTTF (Table 3), but not necessarily to race JRCQC. A low infection type of “11+” to “22+” in response to race TTKSK at the higher temperature regime was considered indicative of resistance conferred by Sr13 (Roelfs and McVey 1979). Six cultivars were postulated to possess Sr13 (Table 3). Five cultivars were postulated to possess both Sr13 and Sr8155B1: Rugby, Munich, Renville, Grenora, and Alkabo.
Table 3. Seedling infection types of 11 US durum cultivars in addition to 8155-B1 and Rusty in response to Puccinia graminis f. sp. tritici races TTKSK, TTKST, TKTTF, TTTSK, TTKSF+, TRTTF, and JRCQC at low and high temperature regimes.
| 18/15° day/night | 25/22° day/night | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Line | Sr8155B1a | Sr13b | TTKSK | TTKST | TTKTT | TTTSK | TTKSF+ | TRTTF | JRCQC | TTKSK | TTKST | TTKTT | TTTSK | TTKSF+ | TRTTF | JRCQC |
| D.K. HPc | — | — | 3+4d | 3+ | — | 3+ | 3+ | 3+ | 3+ | 3+ | 3+4 | — | 3+ | 3+ | 3+ | 3+ |
| Rugby | + | + | 2+3 | ;1− | 0; | 0;1− | 0; | 0; | 23− | 2− | 0;12− | 0; | 0; | 0;/2− | 0; | 32+ |
| Dilse | + | — | 3+ | 0; | 0; | 0; | 0; | 0; | 3+ | 3+ | 0; | 0; | 0; | 0; | 0; | 33+ |
| Munich | + | + | 1+3 | 0; | 0; | 0; | 0; | 0; | 33+ | 11+ | 0; | 0; | 0; | 0; | 0; | 33+ |
| Renville | + | + | 33+ | 0; | 0; | 0; | 0; | 0; | 3 | 2 | 0; | 0; | 0; | 0; | 0; | 2 |
| Belzer | + | — | 3+ | 0; | 0; | 0; | 0; | 0; | 3+ | 3+ | 0; | 0; | 0; | 0; | 0; | 3+ |
| Grenora | + | + | 32+ | 0; | 0; | 0; | 0; | 0; | 3 | 22+ | 0; | 0; | 0; | 0; | 0; | 32+ |
| Lloyd | + | — | 3+ | 0; | 0;1 | ;1 | ;1/0; | 0; | 3+ | 3+ | 0; | 0;1 | 0; | 0; | 0; | 3+ |
| Divide | + | — | 3+ | 0;1 | 0; | 0;1 | 0; | 0; | 3+ | 3+ | 0; | 0; | 0; | 0; | 0; | 3+ |
| Tioga | — | + | 33+ | 23− | 22+ | 23− | 12− | 12− | 3+ | 22− | 12− | 12− | 2− | 12− | 1 | 3+ |
| Alkabo | + | + | 3 | 0; | 0; | 0; | 0; | 0; | 33− | 22+ | 0; | 0; | 0; | 0; | 0; | 33+ |
| 8155-B1 | + | — | 3+ | ; | 0; | ; | 0; | 0; | 3+ | 3+ | 0;1 | 0; | 0;1 | 0;1 | 0; | 3+ |
| Rusty | — | — | 3+ | 3+ | 3+ | 3+ | 3+ | 3+ | 3+ | 3+ | 3+ | 3+ | 3+ | 3+ | 3+ | 3+ |
Sr8155B1 postulations were made based on low infection type in response to race TTKST, and higher infection type observed in response to race TTKSK.
Sr13 postulations were made based on the presence of an intermediate infection type in response to virulent race TTKSK at the higher temperature regime at which Sr13 is most effective.
Desert King HP.
Stakman et al. (1962) infection types on a “0” to “4” scale are listed, where “0” indicates immunity, “4” indicates compete susceptibility, and “;” indicates a class in between “0” and “1” (see Materials and Methods for a detailed description). Smaller or larger rust pustules within an infection type class are denoted by “−” and “+” symbols, respectively. When multiple infection types were observed on the same leaf, all infection types are listed. A “/” symbol was used to separate infection types observed on different plants of the same heterogeneous line.
Validation of Sr8155B1-linked markers in durum cultivars
To identify potential markers that can discriminate lines with and without Sr8155B1, we evaluated eight KASP assay-based markers on the panel of 11 durum cultivars. The allele calls for these eight markers are shown in Table 4. Of the eight markers tested, three markers were found to predict the presence of Sr8155B1: KASP_6AS_IWB10558 (cosegregated with Sr8155B1), KASP_6AS_IWB72958, and KASP_6AS_IWB61585 (Table 4).
Table 4. Allele calls of eight KASP assay SNP markers linked to Sr8155B1.
| Lines | Sr8155B1a | 1 | 2 | 3 | 4 | 5b | 6 | 7 | 8 |
|---|---|---|---|---|---|---|---|---|---|
| Desert King HP | — | a | a | a | a | b | b | b | b |
| Rugby | + | a | a | a | a | a | a | b | a |
| Dilse | + | a | a | a | a | a | a | b | a |
| Munich | + | a | — | h | a | a | a | b | a |
| Renville | + | a | a | a | a | a | a | a | a |
| Belzer | + | a | a | a | a | a | a | b | a |
| Grenora | + | a | a | a | a | a | a | b | a |
| Lloyd | + | a | a | a | a | a | a | b | a |
| Divide | + | a | a | a | a | a | a | b | a |
| Tioga | — | b | h | b | b | b | — | b | b |
| Alkabo | + | a | b | a | a | a | a | b | a |
| 8155-B1 | + | a | a | a | a | a | a | a | a |
| Rusty | — | b | b | b | b | b | b | b | b |
1: KASP_6AS_IWB12224, 2: KASP_6AS_IWB64918, 3: KASP_6AS_IWB_43809, 4: KASP_6AS_IWB75264, 5: KASP_6AS_IWB10558, 6: KASP_6AS_IWB72958, 7: KASP_6AS_IWB1550 and 8: KASP_6AS_IWB61585.
Sr8155B1 gene postulated based on phenotypic data.
Closest linked marker to Sr8155B1.
Relationship between Sr8155B1 and the Sr8 alleles
The marker KASP_6AS_IWB10558 was also evaluated on the Sr8a-containing lines ISr8a-Ra and SD4279 and the Sr8b-containing lines Barletta Benvenuota and Klein Titan, along with a highly susceptible wheat line, LMPG-6. The results revealed that ISr8a-Ra, SD4279, Barletta Benvenuota, Klein Titan, and LMPG-6 did not have the 8155-B1 allele for KASP_6AS_IWB10558 (Figure 3 and Table 5). ISr8a-Ra is susceptible to races TTKSK and TTKST, but resistant to TRTTF (Olivera et al. 2012), whereas Sr8b lines Klein Titan and Barletta Benvenuota were susceptible to races TTKSK, TTKST, and TRTTF (Table 5). Although 8155-B1 is resistant to TRTTF, it differs from ISr8a-Ra in that it produces an IT of “0;” whereas ISr8a-Ra exhibits an infection type “22−”(Table 5). The race specificity and infection types of ISr8a-Ra, Klein Titan, and Barletta Benvenuota clearly indicate that Sr8155B1 is different from both Sr8a and Sr8b.
Figure 3.
Allelic discrimination plot showing the SNP marker KASP_6AS_IWB10558 alleles. The Y-axis (allele 2) depicts amplification of the resistant-linked allele represented by lines 8155-B1 and Divide, whereas the X-axis (allele 1) represents amplification of the susceptible-linked allele represented by lines Rusty, Barletta Benvenuota (Sr8b), Klein Titan (Sr8b), IsSr8a (Sr8a), and SD4279 (Sr8a). Duplicate reactions are displayed for all the lines described in the figure. Duplicate water negative controls displayed null reactions with no amplification of either allele.
Table 5. Seedling infection types exhibited by lines with Sr8a, Sr8b, and Sr8155B1 in response to Puccinia graminis f. sp. tritici races TRTTF, TTKSK, and TTKST.
| Race | Gene | TRTTF | TTKSK | TTKST |
|---|---|---|---|---|
| 8155-B1 | Sr8155B1 | 0;a | 3+ | 0; |
| ISr8a-Ra | Sr8a | 22− | 4 | 3+ |
| SD4279 | Sr8a + Sr9h | 2 | 22+ | 22+ |
| Klein Titan | Sr8b | 4 | 4 | 4 |
| Barletta Benvenuota | Sr8b | 4 | 4 | 4 |
| LMPG-6 | — | 3+ | 3+ | 3+ |
| Rusty | — | 3+ | 4 | 3+ |
Stakman et al. (1962) infection types on a “0” to “4” scale are listed, where “0” indicates immunity, “4” indicates compete susceptibility, and “;” indicates a class in between “0” and “1” (see Materials and Methods for a detailed description). Smaller or larger rust pustules within an infection type class are denoted by “−” and “+” symbols, respectively. When multiple infection types were observed on the same leaf, all infection types are listed.
Validation of the presence of Sr8155B1 in cultivar Mountrail
Choteau displayed susceptible infection type “3+” in response to races TTKSK and TTKST. Mountrail displayed infection type “2−” in response to race TTKSK, and infection types “0;” to “;” in response to race TTKST (Figure S3). The response of Mountrail to races TTKSK and TTKST is typical of cultivars postulated to possess both Sr13 and Sr8155B1 (Table 3). The RILs derived from Choteau/Mountrail displayed two classes of infection types in response to race TTKSK: a resistant class with a range between “;12−” and “2”, in addition to a susceptible class with a range between “3” and “3+”. Segregation of response to race TTKSK fit a single gene (χ2 = 1.73, P = 0.19), likely Sr13. The response of the RILs to race TTKST included infection types ranging from “0;” to “3+”. Segregation of resistance to race TTKST fit a two-gene model (χ2 = 1.91, P = 0.17), likely Sr13 and Sr8155B1. We classified RILs with resistant TTKST infection types that displayed lower infection types compared to the response to race TTKSK as possessing Sr8155B1 (Table S10). RILs with TTKST infection types that displayed similar infection types to race TTKSK were classified as lacking Sr8155B1 (Table S10). We postulated that 91 RILs possessed Sr8155B1 and 108 lacked the gene, which fit a single gene ratio (χ2 = 1.45, P = 0.23). We were not able to confidently postulate presence or absence of Sr8155B1 in 20 of the 219 RILs (Table S10). We did observe a small quantitative difference between the effect of Sr8155B1 in hexaploid and tetraploid RILs of the Choteau/Mountrail population. The four most common infection types of hexaploid RILs (SXD1 through SXD135) postulated to possess Sr8155B1 were “;1−”, “;1”, “11+”, and “;13−”, but the most common infection types for tetraploid RILs (SXD136 to SXD232) with Sr8155B1 were “0;”, “;”, “;1−”, and “;1” (Table S10).
Both Sr13 and Sr8155B1 were mapped in the Choteau/Mountrail population to chromosome 6A (Figure 4). Sr8155B1 mapped on the distal end of chromosome arm 6AS, whereas Sr13 mapped 150.6 cM away on the distal end of chromosome arm 6AL. Previously, Sr13 was linked to GWM427 in multiple populations (Simons et al. 2010). In Choteau/Mountrail, Sr13 mapped 4.3 cM proximal to GWM427. Sr8155B1 mapped 0.6 cM proximal to KASP_6AS_IWB10558. Markers KASP_6AS_IWB1550 and KASP_6AS_IWB61585 were not polymorphic in the Choteau/Mountrail population. Only two RILs possessed recombination events between Sr8155B1 and KASP_6AS_IWB10558 (SXD100 and SXD128; Table S6), demonstrating their tight linkage and the tractability of KASP_6AS_IWB10558 in another population. These mapping results confirm the presence of both Sr8155B1 and Sr13 in the cultivar Mountrail.
Figure 4.
Genetic linkage map of chromosome 6A including Sr8155B1 and Sr13 using 90K SNP markers and KASP_6AS_IWB10558 from Choteau/Mountrail recombinant inbred lines. The values to the left of the marker names are the distances (cM) generated using the Kosambi mapping function.
Discussion
The search for new effective stem rust resistance genes from diverse germplasm is a continuous process in breeding wheat for resistance to stem rust. The best strategy to control emerging virulent races is to deploy complex rust resistance by adding new genes from diverse sources into a highly durable genetic background (Park et al. 2007, 2008). Monogenic line 8155-B1 line is unique because it is resistant to race TTKST, a variant of TTKSK with increased virulence, but susceptible to race TTKSK. 8155-B1 is also resistant to other variants in the Ug99 race group including TTTSK, TTKSF+, and TTKTT. In addition, 8155-B1 is resistant to TMLKC and TRTTF. Avirulence to Sr8155B1 is found in isolates of the Ug99 race group that vary in their avirulence to resistance genes Sr9h, Sr24, Sr31, Sr36, and SrTmp, and only one isolate has been characterized as virulent to Sr8155B1 (04KEN156/04; TTKSK). Although 04KEN156/04 is the oldest isolate in the Ug99 race group that we tested, we expect that ancestral Ug99 race group isolates are likely avirulent to Sr8155B1 based on the geographic and genetic variability of isolates that we confirmed as avirulent to Sr8155B1 (Newcomb et al. 2016). We hypothesize that virulence to Sr8155B1 is likely conferred by loss or modification of dominant avirulence to Sr8155B1. Pgt avirulence to most wheat stem rust resistance genes tested segregated as single dominant genes (Zambino et al. 2000). Melampsora lini avirulence proteins characterized in the flax-flax rust pathosystem directly interacted with flax resistance genes to induce host resistance (Dodds et al. 2006). We expect Sr8155B1-mediated resistance to similarly be conferred by the presence of a unique resistance-avirulence protein pair. Another possibility is that Sr8155B1 virulence is ancestral in the Ug99 race group, meaning that Sr8155B1 avirulence was acquired. This scenario might be explained by a mutation event that is either coincidental with the diversification of the Ug99 race group or associated with a selective advantage conferred by Sr8155B1 avirulence. If avirulence to Sr8155B1 was acquired, the molecular interactions causing this would be valuable to dissect to improve our understanding of such a phenomenon. Testing multiple isolates of each race for reaction to Sr8155B1 would help elucidate the evolution of virulence to Sr8155B1 in the Ug99 race group.
Segregation of resistance based on genetic analyses of F2 and BC1F2 populations revealed that a single gene, Sr8155B1, conferred resistance to race TTKST. Segregation of resistance fit the inheritance of a recessive gene in both populations, but it was difficult to determine whether Sr8155B1 is truly recessive or incompletely dominant (Williams and Gough 1968) without careful testing of F1 plants derived from Rusty/8155-B1. Testing of 8155-B1 and several Sr8155B1-possessing cultivars at two temperature regimes indicated that Sr8155B1 is stable at high and low temperatures, in contrast to Sr13 and Sr21 (Table 3; Chen et al. 2015). Testing hexaploid and tetraploid RILs of the Choteau/Mountrail population indicated that Sr8155B1 was more effective in tetraploid wheat, similar to findings for other Sr genes including Sr13 and Sr21 (Chen et al. 2015; Simons et al. 2010). Resistance to races TTKST and TMLKC mapped to the short arm of chromosome 6A and cosegregated with SNP marker IWB10558 in both the F2 and BC1F2 progeny, suggesting that the same gene conditions resistance against both races. The only other characterized gene from durum wheat that confers seedling resistance to race TTKST is Sr13, which is effective against all known races in the Ug99 race group and was mapped to the long arm of chromosome 6A (McIntosh 1972; Simons et al. 2011). To date, no known gene(s) on chromosome 6AS have been described to confer seedling resistance against race TTKST. However, the short arm of chromosome 6A harbors the Sr8 alleles, Sr8a and Sr8b (McIntosh 1972; Singh and McIntosh 1986), neither of which confers resistance to race TTKST. A gene in line SD4279 presumed to be Sr8a was recently mapped using the 9K SNP chip (Guerrero-Chavez et al. 2015), while another allele described as Sr_TRTTF was mapped in the Canadian wheat cultivar Harvest (Hiebert et al. 2017). The SNP markers IWB64918 (RFL_contig5170_330) and IWB6327 (BS00011010_51), which were linked to Sr8155B1 in our study, were also reported by Hiebert et al. (2017) to be linked to Sr_TRTTF, which was predicted to be Sr8a. IWB64918, closely linked to Sr8155B1, mapped 3.3 cM from Sr_TRTTF, and IWB6327 mapped 30.2 cM away from Sr_TRTTF (Hiebert et al. 2017). Allelism tests are needed to confirm the relationship between Sr8155B1 and Sr8. Even though our data do not elucidate whether or not resistance in 8155-B1 is conferred by an allele at the Sr8 locus, our phenotypic data do indicate that Sr8155B1 is distinct from both Sr8a and Sr8b. Therefore, Sr8155B1 is either a new allele at the Sr8 locus or a new stem rust resistance gene.
The SNP marker KASP 6AS_IWB10558 not only cosegregated with Sr8155B1 in both populations derived from 8155-B1, but also predicted the presence/absence of this gene in unknown cultivars (Table 4). The robustness of this test would have been improved by including additional cultivars, especially susceptible cultivars. The KASP assay-based SNP marker developed for Sr8155B1 in this study could be used in selecting for stem rust resistance in combination with other Ug99 resistance genes in durum wheat, such as Sr13. We deposited a hexaploid line from the Choteau/Mountrail population that possesses both Sr13 and Sr8155B1. Hexaploid line “SXD 43,” deposited as PI 681713, was selected based on having gluten strength similar to Choteau, as well as solid stems related to wheat stem sawfly (Cephus cinctus Nort.) resistance inherited from Choteau (Lanning et al. 2004). SXD 43 could be used as a source of both Sr8155B1 and Sr13 for breeding common wheat varieties with resistance to race TTKST.
Races TTKST, TMLKC, TTKTT, and TTTSK exhibited low infection types of “0;” to “0;1” on 8155-B1, suggesting that the same gene in this monogenic line conditioned resistance against all these races. Although Sr8155B1 confers susceptibility to race TTKSK, it conferred resistance to the three other races of the Ug99 race group tested. The specificity of Sr8155B1 has implications for field stem rust screening in Africa. The international stem rust screening nursery in Njoro, Kenya, has been dominated by Sr8155B1-avirulent races TTKST and TTKTT (Newcomb et al. 2016), whereas the screening nursery in Debre Zeit, Ethiopia, has been dominated by the Sr8155B1-virulent race TTKSK, in addition to the presence of race JRCQC that is virulent to Sr9e, Sr13 (Olivera et al. 2012), and Sr8155B1 (Table 3). Gene Sr9e was thought to be common in North American durum (Klindworth et al. 2007; Olivera et al. 2012). It is possible that resistance postulated as Sr9e is, in fact, conferred by Sr8155B1, although further studies are needed to test this hypothesis. The observation that durum lines from North America that were resistant in Njoro became susceptible when tested in Debre Zeit (Olivera et al. 2012) may be a result of the presence of virulence to both Sr13 and Sr8155B1 in Debre Zeit.
The susceptibility of 8155-B1 to race TTKSK limits the value of Sr8155B1 in protecting wheat cultivars from the Ug99 race group. However, the value of Sr8155B1 lies in the high frequency of this gene in durum cultivars adapted to the Northern Great Plains of North America. For example, we postulated both Divide and Alkabo to possess Sr8155B1, and these two cultivars were the most widely planted durum varieties in North Dakota in 2015 and the first and third most widely planted durum varieties in North Dakota in 2016 (USDA National Agricultural Statistics Service). Going forward, we recommend the combination of both Sr8155B1 and Sr13, such as in durum varieties Alkabo, Grenora, Mountrail, Munich, Renville, and Rugby in order to provide the maximum immediate protection of the durum crop in the Northern Great Plains of North America.
Supplementary Material
Supplemental material is available online at www.g3journal.org/lookup/suppl/doi:10.1534/g3.117.300209/-/DC1.
Acknowledgments
Funding for this research was provided by USDA-ARS Appropriated Project 5062-21220-021-00, the USDA-ARS National Plant Disease Recovery System, USAID Feed the Future, the Durable Rust Resistance in Wheat project, and the National Research Initiative Competitive Grants 2011-68002-30029 (Triticeae-CAP) and 2016-06708 (IWYP) from the USDA National Institute of Food and Agriculture. We acknowledge the University of Minnesota Supercomputing Institute for computational support. Mention of trademark, proprietary product, or vendor does not constitute a guarantee or warranty of the product by the USDA, and does not imply its approval to the exclusion of other products and vendors that might also be suitable.
Footnotes
Communicating editor: S. Scofield
Literature Cited
- Bhavani S., Bansal U. K., Hare R., Bariana H. S., 2008. Genetic mapping of stem rust resistance in durum wheat cultivar ‘Arrivato’. Int. J. Plant Breed. 2: 23–26. [Google Scholar]
- Bushnell W. R., Roelfs A. P. (Editors), 1984. The Cereal Rusts, Vol. 1. Origins, Specificity, Structure, and Physiology. Academic Press, Orlando, FL. [Google Scholar]
- Chen S., Rouse M. N., Zhang W., Jin Y., Akhunov E., et al. , 2015. Fine mapping and characterization of Sr21, a temperature-sensitive diploid wheat resistance gene effective against the Puccinia graminis f. sp. tritici Ug99 race group. Theor. Appl. Genet. 128: 645–656. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dodds P. N., Lawrence G. J., Catanzariti A. M., The T., Wang C. I., et al. , 2006. Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc. Natl. Acad. Sci. USA 103: 8888–8893. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Elias E. M., Miller J. D., 2000. Registration of ‘Mountrail’ durum wheat. Crop Sci. 40: 1499–1500. [Google Scholar]
- Fetch T., Zegeye T., Park R. F., Hodson D., Wanyera R., 2016. Detection of wheat stem rust races TTHSK and PTKTK in the Ug99 race group in Kenya in 2014. Plant Dis. 100: 1495. [Google Scholar]
- Guerrero-Chavez R., Glover K. D., Rouse M. N., Gonzalez-Hernandez J. L., 2015. Mapping of two loci conferring resistance to wheat stem rust pathogen races TTKSK (Ug99) and TRTTF in the elite hard red spring wheat line SD4279. Mol. Breed. 35: 8. [Google Scholar]
- Hale I. L., Mamuya I., Singh D., 2013. Sr31-virulent races (TTKSK, TTKST, and TTTSK) of the wheat stem rust pathogen Puccinia graminis f. sp. tritici are present in Tanzania. Plant Dis. 97: 557. [DOI] [PubMed] [Google Scholar]
- Hiebert C. W., Rouse M. N., Nirmala J., Fetch T., 2017. Genetic mapping of stem rust resistance to Puccinia graminis f. sp. tritici race TRTTF in the Canadian wheat cultivar Harvest. Phytopathology 107: 192–197. [DOI] [PubMed] [Google Scholar]
- Jin Y., Singh R. P., Ward R. W., Wanyera R., Kinyua M., et al. , 2007. Characterization of seedling infection types and adult plant infection responses of monogenic Sr gene lines to race TTKS of Puccinia graminis f. sp. tritici. Plant Dis. 91: 1096–1099. [DOI] [PubMed] [Google Scholar]
- Jin Y., Szabo L. J., Pretorius Z. A., Singh R. P., Ward R., et al. , 2008. Detection of virulence to resistance gene Sr24 within race TTKS of Puccinia graminis f. sp tritici. Plant Dis. 92: 923–926. [DOI] [PubMed] [Google Scholar]
- Jin Y., Szabo L. J., Rouse M. N., Fetch T., Jr., Pretorius Z. A., et al. , 2009. Detection of virulence to resistance gene Sr36 within the TTKS race lineage of Puccinia graminis f. sp. tritici. Plant Dis. 93: 367–370. [DOI] [PubMed] [Google Scholar]
- Kalous J. R., Martin J. M., Sherman J. D., Heo H.-Y., Blake N. K., et al. , 2015. Impact of the D genome and quantitative trait loci on traits in a spring durum by spring bread wheat cross. Theor. Appl. Genet. 128: 1799–1811. [DOI] [PubMed] [Google Scholar]
- Klindworth D. L., Miller J. D., Xu S. S., 2006. Registration of ‘Rusty’ durum wheat. Crop Sci. 46: 1012–1013. [Google Scholar]
- Klindworth D. L., Miller J. D., Jin Y., Xu S. S., 2007. Chromosomal locations of genes for stem rust resistance in monogenic lines derived from tetraploid wheat accession ST464. Crop Sci. 47: 1441–1450. [Google Scholar]
- Kolmer J. A., Dyck P. L., Roelfs A. P., 1991. An appraisal of stem and leaf rust resistance in North American hard red spring wheats and the probability of multiple mutations in populations of cereal rust fungi. Phytopathology 81: 237–239. [Google Scholar]
- Kolmer J. A., Jin Y., Long D. L., 2007. Wheat leaf and stem rust in the United States. Aust. J. Agric. Res. 58: 631–638. [Google Scholar]
- Kosambi D. D., 1944. The estimation of map distances from recombination values. Ann. Eugen. 12: 172–175. [Google Scholar]
- Lanning S. P., Carlson G. R., Nash D., Wichman D. M., Kephart K. D., et al. , 2004. Registration of ‘Choteau’ wheat. Crop Sci. 44: 2264–2265. [Google Scholar]
- Leonard K. J., Szabo L. J., 2005. Stem rust of small grains and grasses caused by Puccinia graminis. Mol. Plant Pathol. 6: 99–111. [DOI] [PubMed] [Google Scholar]
- Lorieux M., 2012. MapDisto: fast and efficient computation of genetic linkage maps. Mol. Breed. 30: 1231–1235. [Google Scholar]
- Maccaferri M., Ricci A., Salvi S., Milner S. G., Noli E., et al. , 2014. A high density, SNP-based consensus map of tetraploid wheat as a bridge to integrate durum and bread wheat genomics and breeding. BMC Genomics 15: 873. [DOI] [PubMed] [Google Scholar]
- McIntosh R. A., 1972. Cytogenetical studies in wheat VI. Chromosome location and linkage studies involving Sr13 and Sr8 for reaction to Puccinia graminis f. sp. tritici. Aust. J. Biol. Sci. 25: 765–773. [Google Scholar]
- McIntosh R. A., 1988. The role of specific genes in breeding for durable stem rust resistance in wheat and triticale in Breeding Strategies for Resistance to the Rusts of Wheat, edited by Simmonds N. W., Rajaram S. CIMMYT, Mexico. [Google Scholar]
- Nazari K., Yahyaoui A., Singh R. P., Park R. F., 2009. Detection of wheat stem rust (Puccinia graminis f.sp. tritici) race TTKSK (Ug99) in Iran. Plant Dis. 93: 317. [DOI] [PubMed] [Google Scholar]
- Newcomb N., Olivera P. D., Rouse M. N., Szabo L. J., Johnson J., et al. , 2016. Kenyan isolates of Puccinia graminins f. sp. tritici from 2008 to 2014: virulence to SrTmp in the Ug99 race group and inplications for breeding programs. Phytopathology 106: 729–736. [DOI] [PubMed] [Google Scholar]
- Olivera P. D., Jin Y., Rouse M. N., Badebo A., Fetch T., et al. , 2012. Races of Puccinia graminis f. sp. tritici with combined virulence to Sr13 and Sr9e in a field stem rust screening nursery in Ethiopia. Plant Dis. 96: 623–628. [DOI] [PubMed] [Google Scholar]
- Pallotta M. A., Warner P., Fox R. L., Kuchel H., Jefferies S. J., et al. , 2003. Marker assisted wheat breeding in the southern region of Australia, pp. 789–791 in Proceedings of the 10th International Wheat Genetics Symposium, edited by Pogna N. E., Romano M., Pogna E. A., Galterio Z. Instituto Sperimentale per la Cerealicoltura, Paestum, Italy, 1–6 September, 2003. [Google Scholar]
- Park R. F., 2007. Stem rust of wheat in Australia. Aust. J. Agric. Res. 58: 558–566. [Google Scholar]
- Park R. F., 2008. Breeding cereals for rust resistance in Australia. Plant Pathol. 57: 591–602. [Google Scholar]
- Patpour M., Hovmøller M. S., Shahin A. A., Newcomb M., Olivera P., et al. , 2016. First report of the Ug99 race group of wheat stem rust, Puccinia graminis f. sp. tritici, in Egypt in 2014. Plant Dis. 100: 863. [Google Scholar]
- Peturson B., 1958. Wheat rust epidemics in western Canada in 1953, 1954, and 1955. Can. J. Plant Sci. 38: 16–28. [Google Scholar]
- Pretorius Z. A., Singh R. P., Wagoire W. W., Payne T. S., 2000. Detection of virulence to wheat stem rust resistance gene Sr31 in Puccinia graminis f. sp tritici in Uganda. Plant Dis. 84: 203. [DOI] [PubMed] [Google Scholar]
- Pretorius Z. A., Bender C. M., Visser B., Terefe T., 2010. First report of a Puccinia graminis f. sp. tritici race virulent to the Sr24 and Sr31 wheat stem rust resistance genes in South Africa. Plant Dis. 94: 784. [DOI] [PubMed] [Google Scholar]
- Pretorius Z. A., Szabo L. J., Boshoff W. H. P., Herselman L., Visser B., 2012. First report of a new TTKSF race of wheat stem rust (Puccinia graminis f. sp. tritici) in South Africa and Zimbabwe. Plant Dis. 96: 590. [DOI] [PubMed] [Google Scholar]
- Roelfs A. P., McVey D. V., 1979. Low infection types produced by Puccinia graminis f. sp. tritici and wheat lines with designated genes for resistance. Phytopathology 69: 722–730. [Google Scholar]
- Rouse M. N., Wanyera R., Njau P., Jin Y., 2011. Sources of resistance to stem rust race Ug99 in spring wheat germplasm. Plant Dis. 95: 762–766. [DOI] [PubMed] [Google Scholar]
- Rouse M. N., Nava I. C., Chao S., Anderson J. A., Jin Y., 2012. Identification of markers linked to the race Ug99 effective stem rust resistance gene Sr28 in wheat (Triticum aestivum L.). Theor. Appl. Genet. 125: 877–885. [DOI] [PubMed] [Google Scholar]
- Rouse M. N., Nirmala J., Jin Y., Chao S., Fetch T. G., Jr., et al. , 2014. Characterization of Sr9h, a wheat stem rust resistance allele effective to Ug99. Theor. Appl. Genet. 127: 1681–1688. [DOI] [PubMed] [Google Scholar]
- Simons K., Abate Z., Chao S., Zhang W., Rouse M., et al. , 2010. Genetic mapping of the stem rust resistance gene Sr13 in tetraploid wheat Triticum turgidum ssp. durum L. Theor. Appl. Genet. 122: 649–658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Simons K., Abate Z., Chao S., Zhang W., Rouse M. N., et al. , 2011. Genetic mapping of stem rust resistance gene Sr13 in tetraploid wheat (Triticum turgidum ssp. durum L.). Theor. Appl. Genet. 122: 649–658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Singh R. P., McIntosh R. A., 1986. Cytogenetical studies in wheat XIV. Sr8b for resistance to Puccinia graminis tritici. Can. J. Genet. Cytol. 28: 189–197. [Google Scholar]
- Singh R. P., Hodson D. P., Jin Y., Huerta-Espino J., Kinyua M. G., et al. , 2006. Current status, likely migration and strategies to mitigate the threat to wheat production from race Ug99 (TTKS) of stem rust pathogen. CAB Rev. Perspect. Agric. Vet. Sci. Nutr. Nat. Resour. 1: 1–13. [Google Scholar]
- Singh R. P., Hodson D. P., Huerta-Espino J., Jin Y., Bhavani S., et al. , 2011. The emergence of Ug99 races of the stem rust fungus is a threat to world wheat production. Annu. Rev. Phytopathol. 49: 465–481. [DOI] [PubMed] [Google Scholar]
- Singh R. P., Hodson D. P., Jin Y., Lagudah E. S., Ayliffe M. A., et al. , 2015. Emergence and spread of new races of wheat stem rust fungus: continued threat to food security and prospects of genetic control. Phytopathology 105: 872–884. [DOI] [PubMed] [Google Scholar]
- Stakman E. C., Stewart D. M., Loegering W. Q., 1962. Identification of Physiologic Races of Puccinia graminis var. tritici. United States Department of Agriculture, Agricultural Research Service E-617, Washington, DC [Google Scholar]
- Stam P., 1993. Construction of integrated linkage maps by means of a new computer package: JoinMap. Plant J. 3: 739–744. [Google Scholar]
- Van Ooijen J. W., 2006. JoinMap 4.0: Software for the Calculation of Genetic Linkage Maps in Experimental Populations. Kyazma B.V., Wageningen, The Netherlands. [Google Scholar]
- Wang S., Wong D., Forrest K., Allen A., Chao S., et al. , 2014. Characterization of polyploid wheat genomic diversity using a high-density 90,000 single nucleotide polymorphism array. Plant Biotechnol. J. 12: 787–796. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Williams N. D., Gough F. J., 1968. Inheritance of stem rust resistance of tetraploid wheats, pp. 239–244 in Proceedings of the 3rd International Wheat Genetics Symposium, edited by Finley K. W., Shepherd K. W. Australian Academy of Science, Canberra, Australia, 5–9 August, 1968. [Google Scholar]
- Williams N. D., Miller J. D., Klindworth D. L., 1992. Induced mutations of a genetic suppressor of resistance to wheat stem rust. Crop Sci. 32: 612–616. [Google Scholar]
- Wolday A., Fetch T., Hodson D. P., Cao W., Briere S., 2011. First report of Puccinia graminis f. sp. tritici races with virulence on wheat stem rust resistance genes Sr31 and Sr24 in Eritrea. Plant Dis. 95: 1591. [DOI] [PubMed] [Google Scholar]
- Zambino P. J., Kubelik A. R., Szabo L., 2000. Gene action and linkage of avirulence genes to DNA markers in the rust fungus Puccinia gramins. Phytopathology 90: 819–826. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data that we used to draw conclusions in this article are represented either within the article, or in the Supplemental Material. Table S1 describes the wheat lines used in this study. Table S2 describes the Pgt isolates used in this study. Table S3 describes the number of Rusty/8155-B1 F2 progeny with specific infection types observed in response to Pgt race TMLKC. Table S4 lists 90K SNP markers identified as correlated with response to Pgt race TTKST in a selection of the BC1F2 population. Table S5 contains the alleles of markers linked to Sr8155B1 in Rusty*2/8155-B1 families. Table S6 contains the alleles of markers linked to Sr8155B1 in Choteau/Mountrail RILs that displayed recombination events near Sr8155B1. Table S7 contains alleles of markers mapped to chromosome 6A in the Rusty/8155-B1 F2 population. Table S8 contains seedling infection types observed on F2 plants from the Rusty/8155-B1 population. Table S9 contains seedling infection types observed on BC1F2 families of Rusty*2/8155-B1. Table S10 contains seedling infection types observed on Choteau/Mountrail RILs in response to races TTKST and TTKSK. Figure S1 displays a range of seedling infection types observed on Rusty/8155-B1 F2 progeny in response to Pgt race TMLKC. Figure S2 displays the genetic linkage map derived from Rusty/8155-B1 F2 progeny. Figure S3 displays the seedling infection types observed on Choteau and Mountrail in response to Pgt race TTKST.




