Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Nov 1.
Published in final edited form as: Cell Microbiol. 2017 Jul 14;19(11):10.1111/cmi.12760. doi: 10.1111/cmi.12760

Delivery of Parasite Cdg7_Flc_0990 RNA Transcript into Intestinal Epithelial Cells during Cryptosporidium parvum Infection Suppresses Host Cell Gene Transcription through Epigenetic Mechanisms

Yang Wang 1, Ai-Yu Gong 1, Shibin Ma 1, Xiqiang Chen 1, Juliane K Strauss-Soukup 2, Xian-Ming Chen 1,#
PMCID: PMC5638686  NIHMSID: NIHMS887885  PMID: 28655069

Abstract

Cryptosporidial infection causes dysregulated transcription of host genes key to intestinal epithelial homeostasis, but the underlying mechanisms remain obscure. Previous studies demonstrate that several C. parvum RNA transcripts are selectively delivered into epithelial cells during host cell invasion and may modulate gene transcription in infected cells. We report here that C. parvum infection suppresses the transcription of LRP5, SLC7A8, and IL33 genes in infected intestinal epithelium. Trans-suppression of these genes in infected host cells is associated with promoter enrichment of suppressive epigenetic markers (i.e., H3K9me3). Cdg7_FLc_0990, a C. parvum RNA that has previously demonstrated to be delivered into the nuclei of infected epithelial cells, is recruited to the promoter regions of LRP5, SLC7A8, and IL33 genes. Cdg7_FLc_0990 appears to be recruited to their promoter regions together with G9a, a histone methyltransferase for H3K9 methylation. The PR domain zinc finger protein 1, a G9a-interacting protein, is required for the assembly of Cdg7_FLc_0990 to the G9a complex and gene-specific enrichment of H3K9 methylation. Our data demonstrate that cryptosporidial infection induces epigenetic histone methylations in infected cells through nuclear transfer of parasite Cdg7_Flc_0990 RNA transcript, resulting in transcriptional suppression of the LRP5, SLC7A8, and IL33 genes.

Keywords: Cryptosporidium, cryptosporidiosis, RNA, epigenetic silencing, intestinal epithelium, G9a, PRDM1, Histone methylation

INTRODUCTION

Cryptosporidium, a protozoan parasite, is a long-recognized cause of chronic and life threatening enteric disease in HIV-AIDS patients and among those suffering from immunosuppression due to malignancies or drug treatment associated with transplantation (Chen et al., 2002; Striepen, 2013). After rotavirus, Cryptosporidium is the most common pathogen responsible for moderate-to-severe diarrhea in children younger than 1 year old, particularly in developing regions (Kotloff et al., 2013). Infection with Cryptosporidium shows significant association with mortality in this age group and appears to predispose children to lasting deficits in body growth and cognitive development (Kotloff et al., 2013; Pierce & Kirkpatrick, 2009; Putignani & Menichella, 2010). Despite its significant morbidity, mortality, and cost to society, there is currently no fully effective therapy available (Checkley et al., 2015). The C. parvum and C. hominis species cause the majority of cryptosporidial infections in humans (Chen et al., 2002; Striepen, 2013).

The interactions between Cryptosporidium and host cells may involve exchanges of distinct effector molecules from either side; in particular, parasite-related factors could be transmitted into host cells, playing a role in the pathogenesis of the disease. After excystation in the intestine, infective Cryptosporidium sporozoites attach to the apical membrane of intestinal epithelial cells and establish an intracellular yet extracytoplasmic parasitophorous vacuole for intracellular parasitic development (Chen et al., 2002; O’Donoghue, 1995). At the initial stage of infection, discharge of parasite rhoptry and microneme contents occurs, which presumably facilitates parasite entry and parasitophorous vacuole formation (Sibley, 2004). Several parasite proteins have been demonstrated to be delivered into host epithelial cells and be involved in parasite intracellular development (O’Connor et al., 2007). Cryptosporidial infection causes significant alterations in the gene expression profile in host epithelial cells (Deng et al., 2004; Yang et al., 2009). Follow-up studies evaluating the role of such changes in the pathogenesis of intestinal cryptosporidiosis have been focused on these upregulated genes, such as interleukin 8 (IL8), IL6, nitric oxide synthase 2 (NOS2), C-X-C motif chemokine ligand 2 (CXCL2), intercellular adhesion molecule 1 (ICAM1), and trefoil factor 1 (TFF1), which are mainly associated with host defense responses and cell survival in general (Alcantara et al., 2003; Deng et al., 2004; Laurent et al., 1997; Tarver et al., 1998). In contrast, many of the downregulated genes code effector proteins important for cell proliferation, differentiation, and metabolism, including LDL receptor related protein 5 (LRP5), frizzled class receptor 7 (FZD7), polycomb group ring finger 2 (PCGF2), nuclear receptor subfamily 1 group D member 2 (NR1D2), cyclin D1 (CCND1), and solute carrier family 7 member 8 (SLC7A8) (Deng et al., 2004; Fraga et al., 2005; Goel et al., 2012; Kuhnert et al., 2004; Won et al., 2012). Molecular mechanisms of host gene trans-suppression during cryptosporidial infection remain obscure.

A certain portion of the genomes of most eukaryotic cells is transcribed as non-protein-coding RNAs (ncRNAs) (Prasanth & Spector, 2007; Ulitsky & Bartel, 2013). While once thought of primarily as “junk,” recent studies indicate that many ncRNAs are functional (Guttman et al., 2009; Ulitsky & Bartel, 2013). Many ncRNAs function through specific interactions with other cellular factors, namely proteins, DNA, and other RNA molecules. Known examples include cotranscriptional regulation of gene expression in cis or in trans through recruitment of proteins or molecular complexes to specific gene loci, scaffolding of nuclear or cytoplasmic complexes, titration of RNA-binding proteins (RBPs), and pairing with other RNAs to trigger posttranscriptional regulation (Carpenter et al., 2013; Chu et al., 2011; Gomez et al., 2013; Guttman et al., 2011; Khalil et al., 2009). Recent genomic research has revealed the expression of novel ncRNA genes in the protozoan group of parasites. A total of 164 long ncRNAs was reported in Plasmodium falciparum at the intra-erythrocytic development (Liao et al., 2014). A detailed analysis of a full-length cDNA library constructed from C. parvum identified 118 “orphan” candidate genes with little homology to known annotated protein-coding genes and their RNA transcripts predict no complete open reading frames (Puiu et al., 2004; Yamagishi et al., 2011).

In our previous studies, we demonstrated that several RNA transcripts of C. parvum “orphan” genes are delivered into epithelial cells during C. parvum infection and may modulate gene transcription in infected cells (Wang et al., 2016). The heat-shock protein 70 (HSP70), the most abundant chaperone protein in many mammalian cell types, has been implicated to be hijacked by some RNA viruses for their replication or nuclear import (Manzoor et al., 2014; Nagy, et al., 2011). Several of these C. parvum RNA transcripts were selectively delivered into the nuclei of infected intestinal epithelial cells through an HSP70-mediated nuclear importing mechanism. Overexpression of selected host-cell-imported C. parvum transcripts in intestinal epithelial cells resulted in significant changes in expression levels of specific genes, with significant overlapping with alterations in gene expression profiles detected in host cells following C. parvum infection (Wang et al., 2016). One of the C. parvum “orphan” gene transcripts that is delivered into the nuclei of infected epithelial cells is Cdg7_FLc_0990 (GeneBank ID: FX115678.1) (Puiu et al., 2004; Wang et al., 2016). In this study, we investigated how host gene trans-suppression may be induced by Cdg7_Flc_0990. Our data demonstrate that delivery of Cdg7_Flc_0990 into infected intestinal epithelial cells suppresses transcription of the LRP5, SLC7A8, and IL33 genes through histone modification-mediated epigenetic mechanisms.

RESULTS

C. parvum infection suppresses the transcription of a panel of genes in infected intestinal epithelium

Genome-wide mRNA array analysis in previous studies revealed significant alterations in gene expression profiles in human intestinal HCT-8 epithelial cells after C. parvum infection in vitro (Deng et al., 2004; Yang et al., 2009). Some of these genes code proteins key to epithelial proliferation, differentiation, metabolism or immune response, such as LRP5, SLC7A8, FZD7, PCGF2, and IL33. Our real-time PCR analysis of HCT-8 cells and immature human (H4) intestinal epithelial cells (Hirai et al., 2002) following infection in vitro confirmed the downregulation of those genes (Fig. 1A). Their downregulation was also demonstrated in murine intestinal epithelial cells (IEC4.1) following infection in vitro (Fig. 1A). Consistent with results from previous studies (Deng et al., 2004; Yang et al., 2009), upregulation of NOS2, CXCL2, and ICAM1 was detected in cells following infection (supplemental Fig. S1). Interestingly, downregulation of the above genes appears to be specific to cryptosporidial infection, as it was not detected in cells following infection by the E. coli K12 strain or stimulation by LPS (supplemental Fig. S2), suggesting that this is not a general epithelial cell response to pathogen infection or inflammatory stimulation. The stability of their mRNAs was not altered by infection (supplemental Fig. S3), suggesting their suppression at the transcriptional level. Using a well-documented model of intestinal cryptosporidiosis in neonatal mice through oral administration (Kapel et al., 1996; Lacroix et al., 2001; Novak & Sterling, 1991), we further confirmed the suppression of this panel of genes in ileum epithelium after C. parvum infection in vivo. A mild inflammatory infiltration, with a shorter height of the intestinal villi than that from the non-infected mice, was detected in the ileum epithelium of mice at 48h after C. parvum administration (Fig. 1B). The RNA expression levels of Lrp5, SlcA8, Fzd7, Pcgf2, and Il33 genes in the ileum epithelium from mice after C. parvum infection for 24h were significantly lower than those in the non-infected control mice (Fig. 1C).

Fig. 1. Downregulation of selected host genes in intestinal epithelium following C. parvum infection.

Fig. 1

Open in a new tab

(A) Downregulation of selected genes in intestinal epithelial cells following C. parvum infection in vitro. HCT-8, INT, and IEC4.1 cells were cultured and exposed to C. parvum oocyst infection for 24 and 48h. Expression levels of selected genes were quantified using real-time PCR and compared with that in the non-infected cells as the control (Ctrl). Data are from at least three independent experiments, presented as a ratio to the control as normalized by GAPDH.

(B) Infection of small intestine by C. parvum in neonatal mice. HE staining of ileum from mice at 48h after oral administration of C. parvum oocysts demonstrated C. parvum infection (arrows) and a reduction of height of the villi. Indirect immunofluorescent staining further confirmed the parasite infection (in green) with cell nuclei stained with DAPI in blue. Tissues from mice following oral administration of PBS were used as the control.

(C) Downregulation of selected genes in intestinal epithelium of C. parvum-infected neonatal mice. Ileum epithelium was isolated from mice at 24h after oral administration of C. parvum oocysts. Levels of selected genes in the isolated ileum epithelium were measured using realtime PCR and compared with that of the control (ileum epithelium from mice after oral administration of PBS).

Suppression of LRP5, SLC7A8, and IL33 expression induced by C. parvum infection is HSP70-dependent and mediated by Cdg7_FLc_0990

To test whether nuclear delivery of C. parvum RNAs plays a role in gene trans-suppression in infected host cells, we first measured the effects of HSP70 knockdown on C. parvum-induced gene trans-suppression. HCT-8 cells were transfected with an siRNA to HSP70 and then exposed to C. parvum. Downregulation of LRP5, SLC7A8 and IL33 genes induced by C. parvum was attenuated in cells transfected with the HSP70 siRNA (Fig. 2A). We then cloned the full-lengths of Cdg7_FLc_0990, Cdg6_FLc_0690, Cdg2_FLc_0220, and Cdg2_FLc_0220, which are C. parvum “orphan” RNAs previously identified to be delivered into the nuclei of infected cells through HSP70-mediated nuclear importing mechanism (Wang et al., 2016). HCT-8 cells were transfected with the construct expressing each of the C. parvum RNA transcript, and the expression levels of LRP5, SLC7A8, and IL33 genes were quantified using real-time PCR. Downregulation of LRP5, SLC7A8, and IL33 genes was detected in HCT-8 cells transfected with the full-length of Cdg7_FLc_0990 (Fig. 2B). In contrast, overexpression of Cdg6_FLc_0690, Cdg2_FLc_0150, and Cdg2_FLc_0220 didn’t show obvious effects on the expression of select genes (Fig. 2B). Nuclear delivery of Cdg7_FLc_0990, but not Cdg6_FLc_0730 (a non-nuclear delivered transcript), in the transfected cells was confirmed using real-time PCR and fluorescent in situ hybridization under a Nikon confocal microscope (Fig. 2C and 2D).

Fig. 2. Suppression of LRP5, SLC7A8, and IL33 expression induced by C. parvum is associated with HSP70-dependent nuclear delivery of Cdg7_FLc_0990.

Fig. 2

Open in a new tab

(A) Knockdown of host cell HSP70 blocked the downregulation of LRP5, SLC7A8, and IL33 genes in infected cells. HCT-8 cells were treated with an siRNA to HSP70 for 12h and then exposed to C. parvum (CP) infection for additional 24h. Expression levels of selected genes in the infected cells were quantified using real-time PCR. A non-specific scrambled siRNA (Ctrl-siRNA) was used as the control.

(B) Overexpression of the full-length of Cdg7_FLc_0990 caused downregulation of the LRP5, SLC7A8, and IL33 genes in host cells. HCT-8 cells were transfected with the full-lengths of Cdg7_FLc_0990, Cdg6_FLc_0690, Cdg2_FLc_0220, and Cdg2_FLc_0220, respectively, for 24h and the expression levels of selected genes were quantified using real-time PCR. Cells transfected with the empty vector were used as the control.

(C) and (D) Nuclear delivery of Cdg7_FLc_0990 in cells transfected with the corresponding full-length construct. HCT-8 cells were transfected with the full-length of Cdg7_FLc_0990 for 24h, followed by real-time PCR analysis of the nuclear extracts (C) and fluorescent in situ hybridization (D). Cell nuclei were stained in blue with DAPI and representative confocal images are shown. Cells transfected with the empty vector were used as the control.

Nuclear delivery of Cdg7_FLc_0990 promotes G9a-mediated gene trans-suppression

To explore the underlying mechanisms of Cdg7_FLc_0990-mediated gene suppression, we asked whether nuclear delivery of Cdg7_FLc_0990 can impact the epigenetic suppression induced by infection in infected cells. Histone modifications, such as H3K9 and H3K27 methylations, are generally associated with gene transcriptional suppression (Dong & Weng, 2013). Using chromatin immunoprecipitation (ChIP) analysis with designed PCR primers (Set1–5, Table S1) covering the various regions of regulatory promoters of the genes, we detected a significant increase in H3K9me3, accompanied by a modest increase in H3K27me3, in the gene loci of LRP5, SLC7A8, and IL33 in infected HCT-8 cells (Fig. 3A). ChIP analysis for the euchromatic histone lysine methyltransferase 2 (G9a), a histone methyltransferase for H3K9 methylation (Shinkai & Tachibana, 2011), showed an increased occupancy to these gene loci in infected cells (Fig. 3A). Accordingly, an increased occupancy of G9a and enrichment of H3K9me3 were detected in the gene loci of these genes in HCT-8 cells after transfection of the Full-Cdg7_FLc_0990 (Fig. 3B). In contrast, overexpression of Cdg6_FLc_0730, a non-nuclear-imported C. parvum RNA, showed no obvious effects on the chromatin enrichment of H3K9me3 and G9a to select gene loci (Fig. 3B). We then asked whether Cdg7_FLc_0990 can physically be associated with the G9a complex in the nuclei of infected cells. We used anti-G9a to pull down the G9a complex in HCT-8 cells following C. parvum infection in vitro. Our RIP analysis revealed the presence of Cdg7_FLc_0990 in the G9a complex (Fig. 3C).

Fig. 3. Nuclear delivery of Cdg7_FLc_0990 promotes G9a-mediated gene trans-suppression in host cells.

Fig. 3

Open in a new tab

(A) Increased suppressive H3 methylations and recruitment of G9a to the LRP5, SLC7A8, and IL33 promoter regions in host cells following infection. HCT-8 cells were exposed to C. parvum infection for 24h. Cells were collected and assessed using ChIP assay with anti-H3K9me3, anti-H3K27me3, and anti-G9a, respectively, and with designed PCR primers (Set1–5) covering the various regions of regulatory promoters of the corresponding genes. The non-infected cells were used as the control (Ctrl).

(B) Occupancy of G9a and enrichment of H3K9me3 to the LRP5, SLC7A8, and IL33 gene loci in cells after transfection of the full-length of Cdg7_FLc_0990. HCT-8 cells were transfected with the full-length of Cdg7_FLc_0990 for 24h, followed by ChIP analysis using anti-H3K9me3 or anti-G9a and the same designed PCR primers for each gene. Cells transfected with the empty vector or the full-length of Cdg6_FLc_0730 were used as the control.

(C) Enrichment of Cdg7_FLc_0990 in the G9a complex in cells transfected with the corresponding full-length construct. HCT-8 cells were transfected with the full-lengths of Cdg7_FLc_0990, Cdg6_FLc_0730, or the empty vector for 24h. Nuclear extracts were collected and applied to RIP analysis using an anti-G9a, compared with that using an anti-IgG as the control.

PRDM1 is required for the assembly of Cdg7_FLc_0990 to the G9a complex and gene-specific enrichment of H3K9 methylation

We further questioned whether the RNA-binding elements in the G9a complex may mediate the assembly of Cdg7_FLc_0990. The PR domain zinc finger protein 1 (PRDM1, also known as BLIMP-1) is a G9a-interacting protein (Gyory et al., 2004) and has been implicated in G9a-mediated histone methylation (Shin et al., 2013). Importantly, PRDM1 is an RBP and the PR zinc finger domain mediates specific interactions with RNA molecules (John & Garrett-Sinha, 2009). To test whether PRDM1 is involved in the assembly of Cdg7_FLc_0990 to the G9a complex, we performed Co-IP analysis for PRDM1 and G9a in HCT-8 cells following C. parvum infection. An increased association between PRDM1 and G9a was detected in infected HCT-8 cells (Fig. 4A). Increased occupancy of PRDM1 to the LRP5 and SLC7A8 gene loci was observed by ChIP analysis in infected cells (Fig. 4B). Notably, both PRDM1 and G9a were recruited to the same region of LRP5 and SLC7A8 gene loci in infected cells, as measured using the ChIP analysis (Fig. 4B and Fig. 3). Accordingly, an antibody against PRDM1 for RIP assay pulled down an increased amount of Cdg7_FLc_0990 in the infected cells (Fig. 4C). Knockdown of PRDM1 in HCT-8 cells by an siRNA to PRDM1 significantly decreased the assembly of Cdg7_FLc_0990 to the G9a complex (Fig. 4D). Moreover, a significant inhibition of G9a occupancy and enrichment of H3K9me3 to the LRP5 and SLC7A8 gene loci was measured in infected cells treated with the siRNA to PRDM1 (Fig. 4E).

Fig. 4. PRDM1 is required for the assembly of Cdg7_FLc_0990 to the G9a complex and for the enrichment of H3K9 methylation to selected gene loci in infected cells.

Fig. 4

Open in a new tab

(A) C. parvum infection increased the physical association between PRDM1 and G9a in infected cells. HCT-8 cells were exposed to C. parvum infection for 24h. Nuclear extracts were collected, followed by co-immunoprecipitation (Co-IP) analysis using anti-PRDM1 and anti-G9a. Non-precipitated nuclear extracts were blotted as the input.

(B) Enhanced recruitment of PRDM1 to the promoter regions of LRP5, SLC7A8, and IL33 genes in infected cells. HCT-8 cells were exposed to C. parvum infection for 24h, followed by ChIP analysis using anti-PRDM1 and designed PCR primers (Set1–5) covering the various regions of regulatory promoters of the corresponding genes. The non-infected cells were used as the control (Ctrl).

(C) Assembly of Cdg7_FLc_0990 with PRDM1 in in cells following infection. HCT-8 cells were exposed to C. parvum infection for 24h, followed by RIP analysis using anti-PRDM1 and compared using anti-IgG and non-infected cells as the controls.

(D) Knockdown of PRDM1 decreased the assembly of Cdg7_FLc_0990 to the G9a complex in infected cells. HCT-8 cells were treated with the siRNA to PRDM1 for 12h and exposed to C. parvum infection for additional 24h, followed by RIP analysis using anti-G9a.

(E) Knockdown of PRDM1 inhibited the recruitment of G9a and enrichment of H3K9me3 to the LRP5, SLC7A8, and IL33 gene loci induced by infection. HCT-8 cells were treated with the siRNA to PRDM1 for 12h and exposed to C. parvum infection for an additional 24h, followed by ChIP analysis using anti-G9a or anti-H3K9me3 and designed PCR primer set for each gene as indicated. A non-specific scrambled siRNA (Ctrl-siRNA) was used for control.

Occupancy of Cdg7_FLc_0990 and its association with G9a/PRDM1-mediated trans-suppression of LRP5 and SLC7A8 genes induced by C. parvum infection

To define whether Cdg7_FLc_0990 is recruited to the LRP5 and SLC7A8 gene loci to suppress their transcription in infected cells, we performed chromatin isolation by RNA purification (ChIRP) analysis to measure the occupancy of Cdg7_FLc_0990 to the LRP5 and SLC7A8 genes in cells following infection. A pool of biotinylated tiling oligonucleotide probes with affinity to the Cdg7_FLc_0990 sequence was used to precipitate the chromatin fragments through glutaraldehyde crosslinking and chromatin isolation. The DNA sequences of the precipitated chromatin fragments were identified by PCR using primers specific to various regions of the DNA sequences of the target gene loci (Chu et al., 2011). We detected an increased occupancy of Cdg7_FLc_0990 to the LRP5 and SLC7A8 gene loci in HCT-8 cells after exposure to C. parvum for 24h (Fig. 5A). An increased occupancy of Cdg7_FLc_0990 to the LRP5 and SLC7A8 genes was also detected in HCT-8 cells transfected with the Full-Cdg7_FLc_0990 (supplemental Fig. S4).

Fig. 5. Occupancy of Cdg7_FLc_0990 and its association with G9a/PRDM1-mediated trans-suppression of LRP5, SLC7A8 and IL-33 genes induced by C. parvum infection.

Fig. 5

Open in a new tab

(A) Occupancy of Cdg7_FLc_0990 to the LRP5 and SLC7A8 promoter regions in infected cells. HCT-8 cells were exposed to C. parvum (CP) infection for 24h, followed by ChIRP analysis using a pool of biotinylated tiling probes to target Cdg7_FLc_0990. Chromatin complexes were purified and the resultant genomic DNA fragments were validated using real-time PCR with the same designed primer sets for ChIP assay for LRP5 and SLC7A8 genes. Primer sets designed for LacZ served as the controls.

(B) Knockdown of Cdg7_FLc_0990 delivered into the infected cells through host cell transfection of an siRNA. An siRNA to Cdg7_FLc_0990 was used to treat HCT-8 cells for 24h, followed by exposure to C. parvum for 12h. Nuclear content of Cdg7_FLc_0990 was quantified using real-time PCR. A non-specific scrambled siRNA (Ctrl-siRNA) was used for control.

(C) Knockdown of Cdg7_FLc_0990 attenuated C. parvum-induced gene suppression and H3K9me3 enrichment in infected cells. HCT-8 cells were treated with the siRNA to Cdg7_FLc_0990 for 12h and exposed to C. parvum infection for an additional 24h. Cells were collected for measurement of expression levels of selected genes using real-time PCR or ChIP analysis for the enrichment of H3K9me3 to the associated gene loci. A non-specific scrambled siRNA (Ctrl-siRNA) was used for control.

We then tested the effects of Cdg7_FLc_0990 knockdown on C. parvum-induced H3K9 methylation and gene trans-suppression in host epithelial cells. C. parvum lacks the siRNA machinery (Abrahamsen et al., 2004), so we then developed an approach through transfection of host cells with an siRNA to knockdown Cdg7_FLc_0990 after it is delivered into the host cells. HCT-8 cells were first transfected with a specific siRNA to knockdown Cdg7_FLc_0990. At 24h after siRNA transfection, cells were then exposed to C. parvum infection. A significantly lower level of Cdg7_FLc_0990 was detected in the nuclear extracts from siRNA transfected cells after infection for 24h, compared with non-specific siRNA transfected cells (Fig. 5B). Accordingly, C. parvum-induced suppression of LRP5 and SLC7A8 genes, but not FZD7 and PCGF2, was partially attenuated by pri-transfection of HCT-8 cells with the siRNA to Cdg7_FLc_0990 (Fig. 5C). Increased occupancy of G9a and RPDM1 and enrichment of H3K9me3 at the LRP5 and SLC7A8 gene loci induced by C. parvum were attenuated in cells transfected with Cdg7_FLc_0990 siRNA (Fig. 5C). Taken together, the above data suggest that a C. parvum “orphan” RNA transcript, Cdg7_FLc_0990, can be delivered into the nuclei of infected epithelial cells, where it suppressed the transcription of specific genes through modulation of G9a-mediated epigenetic suppressive mechanisms.

DISCUSSION

Evidence has accumulated that histone modifications are key targets for pathogen manipulation of host gene transcription during microbial infection (Gómez-Díaz et al., 2012; Hamon & Cossart, 2008). The epigenetic modulation of a host’s transcriptional program linked to host defense genes has emerged as a relatively common occurrence of pathogenic viral and bacterial infections (Hamon & Cossart, 2008; Paschos & Allday, 2010). A diverse array of bacterial and viral effectors has been identified that either mimic or inhibit the host cellular machinery, thus facilitating the pathogen’s lifecycle. Parasite-associated epigenetic alterations in the host have been demonstrated in T cells following infection with T. cruzi (Hermann et al., 2010) and in congenital toxoplasmosis (Jamieson et al., 2008). Whether epigenetic trans-suppression is associated with C. parvum-induced alterations of gene expression in host epithelial cells is unclear.

C. parvum infection induces significant alterations in gene expression profiles in infected host epithelial cells, including both up- and downregulation of numerous genes (Deng et al., 2004; Yang et al., 2009). Trans-activation of genes in infected cells is usually associated with the activation of intracellular signaling pathways, such as the TLR4/NF-ĸB and PI-3K pathways (Chen et al., 2001; Chen et al., 2004). Our data suggest that downregulation of LRP5, SLC7A8, and IL33 genes in intestinal epithelial cells after C. parvum infection is HSP70-dependent and is associated with a marked increase of H3K9me3 in their gene loci. Intriguingly, C. parvum-induced suppressive H3K9 methylation within these gene loci depends on G9a, a key methyltransferase for H3K9, and is associated with the nuclear delivery of a C. parvum “orphan” RNA transcript, Cdg7_FLc_0990. Therefore, Cdg7_FLc_0990 may hijack the G9a/PRDM1-mediated regulatory machinery in the host cells, resulting in trans-suppression of the LRP5, SLC7A8, and IL33 genes (Figure 6).

Fig. 6. Schematic representation of the proposed model for transcriptional suppression of host genes in infected cells through nuclear transfer of C. parvum Cdg7_Flc_0990.

Fig. 6

Open in a new tab

C. parvum Cdg7_FLc_0990 transcript is selectively delivered into the nuclei of infected host cells through HSP70-mediated nuclear translocation of RNA cargos. Nuclear transfer of Cdg7_FLc_0990 promotes the recruitment of G9a/PRDM1 to specific gene loci, resulting in H3K9 methylation-mediated transcriptional suppression of the LRP5, SLC7A8, and IL33 genes.

The physical association between Cdg7_FLc_0990 and the G9a/PRDM1 complex in the nuclei of infected host cells suggests that Cdg7_FLc_0990 may function as a scaffold molecule to modulate G9a/PRDM1-mediated H3K9 methylation, similar to long ncRNAs, which are known to act as scaffold molecules through their interactions with RBPs in chromatin-remodeling complexes (Ulitsky & Bartel, 2013). PRDM1 is a G9a-interacting protein (Gyory et al., 2004) and has been implicated in G9a-mediated histone methylation (Shin et al., 2013). We identified an increase of PRDM1 assembly in the G9a complex in cells after infection. Knockdown of Cdg7_FLc_0990 inhibited C. parvum-induced assembly of PRDM1 to the G9a complex. PRDM1 is an RBP, with several Zinc-finger C2H2 domains that can interact with DNA and RNA molecules (John & Garrett-Sinha, 2009). Because knockdown of PRDM1 with an siRNA can inhibit the assembly of Cdg7_FLc_0990 in the G9a complex, it is possible that Cdg7_FLc_0990 is assembled into the G9a complex through its physical interaction with PRDM1. Whether the interactions between Cdg7_FLc_0990 and PRDM1 specify the assembly of other components into the G9a complex is unclear. In addition, long ncRNAs may interact with DNA molecules to form a triple-helical structure (Ulitsky & Bartel, 2013). As such, Cdg7_FLc_0990 may “guide” the initial recruitment of the G9a/PRDM1 complex to the LRP5, SLC7A8, and IL33 gene loci, presumably through direct binding to a specific DNA motif in their promoter regions. Notably, transfection of host cells with a plasmid expressing Cdg7_FLc_0990 induced the recruitment of the G9a/PRDM1 complex to the LRP5, SLC7A8, and IL33 gene loci, resulting in trans-suppression in the transfected cells.

PRDM1 has been shown to be a transcription repressor important to cell differentiation (John & Garrett-Sinha, 2009) and acts as a master regulator of intestinal epithelium maturation (Harper et al., 2011). It is strongly expressed throughout the epithelium of the embryonic gut and orchestrates orderly and extensive reprogramming of the postnatal intestinal epithelium (Harper et al., 2011). When the intestinal epithelium becomes mature after weanling, PRDM1 is absent in the intestinal epithelial cells. Interestingly, adult mice are resistant to C. parvum infection (O’Donoghue, 1995) and PRDM1 is absent in the intestinal epithelial cells of adult mice (Harper et al., 2011). In contrast, neonatal mice, which have a high expression level of PRDM1 in the intestinal epithelial cells (Harper et al., 2011), are susceptible to C. parvum infection (Kapel et al., 1996; Lacroix et al., 2001). The pathogenic role of PRDM1 in C. parvum infection of neonatal mice requires further exploration using conditional PRDM1 knockout mice.

One of the hallmarks of intestinal cryptosporidiosis is the inhibition of epithelial differentiation and disturbances in epithelial metabolism (Sasahara et al., 2003; Savidge et al., 1996). Consequently, a significant decrease in the height of intestinal villi has been reported during C. parvum infection of neonatal mice (Sasahara et al., 2003). Trans-suppression of genes key to epithelial cell differentiation and metabolism, such as LRP5 and SLC7A8, may be an important pathologic factor in C. parvum-induced epithelial disturbances. Pathologically, manipulation of host cell gene transcription by C. parvum may benefit intracellular parasitic development. The intestinal mucosa is a monolayer of rapidly self-renewing epithelial cells. New functional epithelial cells are produced from stem cells in the crypt base, differentiated, and migrated from the crypt base to the luminal surface; hence, the entire intestinal epithelium is replaced every 2–3 days in mice (3–5 days in humans) (Creamber et al., 1961). The complete life cycle of C. parvum infection requires 4–6 days (O’Donoghue, 1995). Inhibition of epithelial turnover would provide an obvious benefit to the parasite for its replication after intracellular internalization, a possibility that merits future investigation.

EXPERIMENTAL PROCEDURES

Ethics statement

This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health under the Assurance of Compliance Number A3348-01. All animal experiments were done in accordance with procedures (protocol number #0959) approved by the Institutional Animal Care and Use Committee of Creighton University.

C. parvum and Cell Lines

C. parvum oocysts of the Iowa strain were purchased from a commercial source (Bunch Grass Farm, Deary, ID). INT cells (FHs 74 Int cells) and HCT-8 cells were purchased from ATCC (Manassas, VA), and a murine intestinal epithelial cell line (IEC4.1) was a kind gift from Dr. Pingchang Yang (McMaster University, Hamilton, Canada).

Infection Models and Infection Assays

Models of intestinal cryptosporidiosis using cultured cell lines were employed as previously described (Chen et al., 2001). Infection was done in culture medium (DMEM-F12 with 100 U/ml penicillin and 100 μg/ml streptomycin) containing viable C. parvum oocysts (oocysts with host cells in a 5:1 ratio). For in vivo infection, we adapted a murine model of intestinal cryptosporidiosis in neonatal mice (Kapel et al., 1996; Lacroix et al., 2001; Novak & Sterling, 1991). Briefly, mice at the age of 7–9 days after birth received C. parvum oocysts by oral gavage (105 oocysts per mice). Mice receiving vehicle (PBS) by oral gavage were used as control. At 24 and 48h after cryptosporidium or vehicle administration, animals were sacrificed and ileum intestine tissues were collected. At least five animals from each group were sacrificed and ileum tissues were obtained for immunohistochemistry and biochemical analyses. Realtime PCR, immunofluorescence microscopy, and immunohistochemistry were used to assay C. parvum infection as previously reported (Chen et al., 2001, Sasahara et al., 2003; Zhou et al., 2009). The intestinal tissues were stained with H&E and villus height was assessed as previously reported (Sasahara et al., 2003).

PCR

For quantitative analysis of mRNA and C. parvum RNA expression, comparative real-time PCR was performed as previously reported (Carpenter et al., 2013) using the SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). Details, including RNA isolation, are described in the Supplementary Methods. The sequences for all the primers described above are listed in supplemental Table S1.

siRNAs and Plasmids

Custom-designed RNA oligos against Cdg7_Flc_0990, HSP70, PRDM1, and a scrambled RNA were synthesized by Integrated DNA Technologies (Coralville, Iowa) and transfected into cells with Lipofectamine RNAimax according to the manufacturer’s protocol (Invitrogen). Sequences of siRNAs are: GCCCUAAUAAGUGGGUUGUUU for Cdg7_Flc_0990; CCGGAGUGTAUUUGGUCAUAUCUUU for PRDM1; GCCCUAAUAAGUGGGUUGUUU for HSP70; and non-specific scrambled sequence UUCUCCGAACGUGUCACGUUU for the control. The Cdg7_Flc_0990 expression vector was generated by RT-PCR amplification of Cdg7_Flc_0990 cDNA, using RNA from C. parvum sporozoites (Iowa strain) and cloned into the pcDNA3.3-TOPO vector according to the manufacturer’s protocol (Life Technologies). The sequences for plasmid generation are listed in supplemental Table S1.

Whole Cell, Cytoplasmic, Nuclear Extracts, Western Blot, and Co-IP

Whole cell extracts were prepared using the M-PER Mammalian Protein Extraction Reagent (Fisher) supplied with cocktail protease inhibitors according to manufacturer instruction. The cell pellet was incubated in the M-PER Mammalian Protein Extraction Reagent on ice for 30 min and centrifuged at 132,000 rpm for 20 min and the supernatants were saved as the whole cell extracts. Cytoplasmic and nuclear extracts were obtained using the standard approach, as previously reported (Abmayr et al., 2006). Briefly, the cell pellet (1✕107) was resuspended in 1 ml of cell lysis buffer A (10 mM Tris-HCl PH7.4, 10 mM NaCl, 3 mM MgCl2, 0.5% NP-40 and cocktail protease inhibitor) on ice for 10 min. After centrifugation at 500g for 5 min, the supernatants were saved as cytoplasm fraction and the nuclei pellets were collected and washed with the lysis buffer A devoid of NP-40. After centrifugation, the nuclei pellets were resuspended in 100 μl of nuclei lysis buffer (10 mM Tris-HCl PH7.4, 400 mM NaCl, 1 mM EDTA, 1 mM DTT and cocktail protease inhibitor plus 10 units of RNase inhibitor) and incubated at 4°C for 30 min with shaking. The nuclear fraction was then supplied with 100 μl buffer C (20 mM HEPES PH7.4, 0.2M NaCl, 0.5% Triton X-100, 10% Glycerol, 1 mM EDTA, 1 mM EGTA, 1 mM DTT and cocktail protease inhibitor plus RNase inhibitor of 10 units) at 4°C for 10 min with shaking. After centrifugation at 132,000 rpm for 20 min, the supernatants were saved as the nuclear extracts. Protein concentration of each fraction or whole cell lysate was determined and subsequently analyzed by Western blot or Co-IP analysis. The following antibodies were used for blotting: Anti-H3K9me3 (Abcam), anti-H3K27me3 (Millipore), anti-PRDM1 (Cell Signaling Technology), and anti-G9a (Sigma).

RNA Stability

RNA stability assay was performed by real-time PCR as previously reported (Subramaniam et al., 2008; Zhou et al., 2009). Briefly, cells were exposed to C. parvum infection for 24h and transcription was then blocked using actinomycin D (10 μg/ml, Sigma); RNAs were isolated at various time points after actinomycin D treatment. Real-time PCR was then performed using 500 ng of template cDNA for each mRNA gene of interest. Each sample was run in triplicate. The relative abundance of each mRNA was calculated using the ∆∆Ct method and normalized to GAPDH. The relative amount of mRNA at 0h following actinomycin D treatment was arbitrarily set to 1. Curve fittings of the resultant data were performed using Microsoft Excel and the half-lives of the RNAs calculated.

RIP, ChIP, and ChIRP Analyses

The formaldehyde crosslinking RIP was performed as described (Niranjanakumari et al., 2002). Briefly, cells in culture were first treated with trypsin, washed once with culture medium containing 10% FBS, washed twice with 10 ml PBS, and resuspended in 10 ml of PBS. Formaldehyde (37% stock solution) was then added to a final concentration of 0.3% (v/v) and incubated at room temperature for 10 min with slow mixing. Crosslinking reactions were quenched by the addition of glycine (pH7.0) to a final concentration of 0.25M followed by incubation at room temperature for 5 min. The cells then were harvested by centrifugation at 3000 rpm (237g) for 4 min followed by two washes with ice-cold PBS. Cell pellets were resuspended in 1 ml of lysis buffer (10 mM Tris–HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.5% NP-40 and cocktail protease inhibitor and RNase inhibitor 100 units). Nuclear extracts were isolated as described above. Solubilization of crosslinked complexes was done by three rounds of mechanical sonication 20s each, using a Branson Sonifier 150 with a microprobe at an amplitude setting of 5 (output, 10W). Insoluble materials were removed by microcentrifugation at 14,000 rpm (16,000g) for 20 min at 4°C. Preclearing lysates with 20 μl of PBS were washed with Magna Protein A+G Magnetic Beads (Millipore, Massachusetts). The precleared lysate (1000 μg protein) was then diluted with WCE buffer to a total volume of 1 ml, mixed with the specific antibody-coated beads, and incubated with rotation at 4°C for 4h, followed by washing 4 times with WCE buffer containing protease and RNase inhibitors. Anti-G9a and anti-PRDM1 were used for the immunoprecipitation. The collected immunoprecipitated RNA-protein complexes and inputs were digested in the digestion buffer (100 mM NaCl, 10 mM TrisCl pH 7.0, 1 mM EDTA, 0.5% SDS) with addition of 100 μg Proteinase K and incubated at 50°C for 45 min with end-to-end shaking at 400 rpm. Formaldehyde cross-links were reversed by incubation at 65°C with rotation for 4h. RNA was extracted from these samples using Trizol according to the manufacturer’s protocol (Invitrogen) and treated with DNA-free DNase Treatment & Removal I kit according to the manufacturer’s protocol (Ambion Inc., Austin, TX). The presence of RNA was measured by quantitative RT-PCR using the CFX Connect Real-Time system (BioRad). Gene-specific PCR primer pairs are listed in Supplementary Table 1.

For ChIP analysis, a commercially available ChIP Assay Kit (Upstate Biotechnologies) was used in accordance with the manufacturer’s instructions. In brief, cells were cultured and the genomic DNA was then sheared to lengths ranging from 200 to 1000 bp by sonication, as previously described (Ma et al., 2016). While one percent of the cell extracts was taken as input, the rest of the extracts were incubated with specific antibodies or control IgG overnight at 4°C, followed by precipitation with protein A agarose beads. The DNA-protein complex was eluted, proteins were digested with proteinase K, and the DNA was detected by real-time quantitative PCR analysis. The following antibodies were used for ChIP analysis: anti-PRDM1 (Cell Signaling Technology), anti-G9a (Sigma), anti-H3K9me3 (Abcam), and anti-H3K27me3 (Millipore). The PCR primers used for ChIP analysis are listed in Table S1.

ChIRP analysis was performed as previously reported (Chu et al., 2011). Briefly, a pool of tiling oligonucleotide probes with affinity specific to the C. parvum RNA sequences was used and glutaraldehyde crosslinked for chromatin isolation. The sequences for each probe are listed in Table S2. The DNA sequences of the chromatin immunoprecipitates were confirmed by realtime PCR using the same primer sets covering the gene promoter regions of interest as for ChIP analysis. A pool of scrambled oligo probes and primers for LacZ were used as controls.

Statistical Analysis

All values are given as mean ± S.E. Means of groups were from at least three independent experiments and compared with Student’s t test (two-tailed and unpaired) or the ANOVA test when appropriate. p values < 0.05 were considered statistically significant.

Supplementary Material

Supplemental Tables

Table S1. Primers for PCR, RIP, ChIP, ChIRP and construct generating

Table S2. ChIRP probe sequences

Fig. S1. Upregulation of selected genes in intestinal epithelium following C. parvum infection

(A), (B), and (C) Upregulation of selected genes in intestinal epithelial cells following C. parvum infection in vitro. HCT-8 (A), INT (B), and IEC4.1 (C) cells were cultured and exposed to C. parvum oocyst infection for 24 and 48h. Expression levels of selected genes were quantified using real-time PCR and compared with that in the non-infected cells as the control (Ctrl). Data are from at least three independent experiments, presented as a ratio to the control as normalized by GAPDH.

(D) Upregulation of selected genes in intestinal epithelium of C. parvum-infected neonatal mice. Ileum epithelium was isolated from mice at 24h after oral administration of C. parvum oocysts. Levels of selected genes in the isolated ileum epithelium were measured using real-time PCR and compared with that of the control (ileum epithelium from mice after oral administration of PBS).

Fig. S2. Expression of select genes in cultured intestinal epithelial cells following E. coli K12 infection or LPS stimulation

(A) Expression of select genes in cultured intestinal epithelial cells following E. coli K12 infection. HCT-8 and IEC4.1 cells were exposed to E. coli K12 infection for 24h, respectively, and the expression levels of select genes were quantified by real-time PCR. The non-infected cells were used as the controls.

(B) Expression of select genes in IEC4.1 cells following LPS stimulation. The TLR4-positive IEC4.1 cells were exposed to LPS stimulation for 4h and expression of select genes was measured by real-time PCR. Cells without LPS treatment were used as the controls.

Fig. S3. C. parvum infection didn’t alter the stability of suppressed genes in intestinal epithelial cells

Several intestinal epithelial cell lines were exposed to C. parvum infection for 24h, and treated with actinomycin D (Act D) for up to 2h. The stability of selected RNAs was measured by PCR, calculated, and presented as the relative amount of RNA levels in cells before Act D treatment.

Fig. S4. Occupancy of Cdg7_Flc_0990 to the LRP5 and SLC7A8 gene loci in cells overexpressing Cdg7_Flc_0990

An increased occupancy of Cdg7_FLc_0990 to the promoter regions of LRP5 and SLC7A8 gene loci was detected in HCT-8 cells transfected with the Cdg7_FLc_0990 construct, using ChIRP analysis with a pool of biotinylated tiling probes to target Cdg7_FLc_0990. Chromatin complexes were purified and the resultant genomic DNA fragments were validated using realtime PCR with the same designed primer sets for ChIP assay for LRP5 and SLC7A8 genes. Primer sets designed for LacZ served as the controls.

Acknowledgments

We thank Drs. Min Li, Yan Li, Xin-Tian Zhang, and Zhenping Ming for helpful and stimulating discussions, Dr. Yongyue Qi for his assistance with statistical analysis, and Barbara L. Bittner for her assistance in writing the manuscript. This work was supported by funding from the National Institutes of Health (AI116323 to XMC) and the Nebraska Stem Cell Research Program (LB606 to XMC), and by revenue from Nebraska’s excise tax on cigarettes awarded to Creighton University through the Nebraska Department of Health and Human Services (DHHS) (LB595 to XMC). The project described was also supported by Grant Number G20RR024001 from the National Center for Research Resources. The content is solely the responsibility of the authors and does not necessarily represent the official views of the State of Nebraska, DHHS, the National Center for Research Resources, or the National Institutes of Health.

The abbreviations used are

CCND1

cyclin D1

ChIP

chromatin immunoprecipitation

ChIRP

chromatin isolation by RNA purification

CXCL2

C-X-C motif chemokine ligand 2

FZD7

frizzled class receptor 7

G9a

euchromatic histone lysine methyltransferase 2

HSP70

heat shock protein 70

ICAM1

intercellular adhesion molecule 1

IL33

interleukin 33

IL6

interleukin 6

IL8

interleukin 8

LRP5

LDL receptor related protein 5

ncRNAs

non-protein coding RNAs

NOS2

nitric oxide synthase 2

NR1D2

nuclear receptor subfamily 1 group D member 2

PCGF2

polycomb group ring finger 2

PRDM1

PR domain zinc finger protein 1

RBP

RNA binding proteins

RIP

RNA immunoprecipitation

SLC7A8

solute carrier family 7 member 8

TFF1

trefoil factor 1

Footnotes

DISCLOSURES

The authors disclose no conflict of interest.

Supporting information

Additional supporting information may be found in the online version of this article at the publisher’s web-site:

References

  1. Abmayr SM, Yao T, Parmely T, Workman JL. Preparation of nuclear and cytoplasmic extracts from mammalian cells. Current Protocols in Pharmacology. 2006 doi: 10.1002/0471141755.ph1203s35. Chapter 12, Unit 12.3. [DOI] [PubMed] [Google Scholar]
  2. Abrahamsen MS, Templeton TJ, Enomoto S, Abrahante JE, Zhu G, Lancto CA, Kapur V. Complete genome sequence of the apicomplexan, Cryptosporidium parvum. Science. 2004;304(5669):441–445. doi: 10.1126/science.1094786. [DOI] [PubMed] [Google Scholar]
  3. Alcantara CS, Yang CH, Steiner TS, Barrett LJ, Lima AA, Chappell CL, Guerrant RL. Interleukin-8, tumor necrosis factor-alpha, and lactoferrin in immunocompetent hosts with experimental and Brazilian children with acquired cryptosporidiosis. The American Journal of Tropical Medicine and Hygiene. 2003;68(3):325–328. [PubMed] [Google Scholar]
  4. Carpenter S, Aiello D, Atianand MK, Ricci EP, Gandhi P, Hall LL, Fitzgerald KA. A long noncoding RNA mediates both activation and repression of immune response genes. Science. 2013;341(6147):789–792. doi: 10.1126/science.1240925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Checkley W, White AC, Jr, Jaganath D, Arrowood MJ, Chalmers RM, Chen XM, Houpt ER. A review of the global burden, novel diagnostics, therapeutics, and vaccine targets for cryptosporidium. The Lancet Infectious Diseases. 2015;15(1):85–94. doi: 10.1016/S1473-3099(14)70772-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen XM, Keithly JS, Paya CV, LaRusso NF. Cryptosporidiosis. The New England Journal of Medicine. 2002;346(22):1723–1731. doi: 10.1056/NEJMra013170. [DOI] [PubMed] [Google Scholar]
  7. Chen XM, Levine SA, Splinter PL, Tietz PS, Ganong AL, Jobin C, LaRusso NF. Cryptosporidium parvum activates nuclear factor kappaB in biliary epithelia preventing epithelial cell apoptosis. Gastroenterology. 2001;120(7):1774–1783. doi: 10.1053/gast.2001.24850. [DOI] [PubMed] [Google Scholar]
  8. Chen XM, O’Hara SP, Huang BQ, Nelson JB, Lin JJ, Zhu G, LaRusso NF. Apical organelle discharge by Cryptosporidium parvum is temperature, cytoskeleton, and intracellular calcium dependent and required for host cell invasion. Infection and Immunity. 2004;72(12):6806–6816. doi: 10.1128/IAI.72.12.6806-6816.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chu C, Qu K, Zhong FL, Artandi SE, Chang HY. Genomic maps of long noncoding RNA occupancy reveal principles of RNA-chromatin interactions. Molecular Cell. 2011;44(4):667–678. doi: 10.1016/j.molcel.2011.08.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Creamber B, Shorter RG, Bamforth J. The turnover and shedding of epithelial cells. I. The turnover in the gastro-intestinal tract. Gut. 1961;2:110–118. doi: 10.1136/gut.2.2.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Deng M, Lancto CA, Abrahamsen MS. Cryptosporidium parvum regulation of human epithelial cell gene expression. International Journal for Parasitology. 2004;34(1):73–82. doi: 10.1016/j.ijpara.2003.10.001. [DOI] [PubMed] [Google Scholar]
  12. Dong X, Weng Z. The correlation between histone modifications and gene expression. Epigenomics. 2013;5(2):113–116. doi: 10.2217/epi.13.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fraga S, Pinho MJ, Soares-da-Silva P. Expression of LAT1 and LAT2 amino acid transporters in human and rat intestinal epithelial cells. Amino Acids. 2005;29(3):229–233. doi: 10.1007/s00726-005-0221-x. [DOI] [PubMed] [Google Scholar]
  14. Goel S, Chin EN, Fakhraldeen SA, Berry SM, Beebe DJ, Alexander CM. Both LRP5 and LRP6 receptors are required to respond to physiological Wnt ligands in mammary epithelial cells and fibroblasts. The Journal of Biological Chemistry. 2012;287(20):16454–16466. doi: 10.1074/jbc.M112.362137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gomez JA, Wapinski OL, Yang YW, Bureau JF, Gopinath S, Monack DM, Kirkegaard K. The NeST long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-γ locus. Cell. 2013;152(4):743–754. doi: 10.1016/j.cell.2013.01.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gómez-Díaz E, Jordà M, Peinado MA, Rivero A. Epigenetics of host-pathogen interactions: the road ahead and the road behind. PLoS Pathogens. 2012;8(11):e1003007. doi: 10.1371/journal.ppat.1003007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, Lander ES. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature. 2009;458(7235):223–227. doi: 10.1038/nature07672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Guttman M, Donaghey J, Carey BW, Garber M, Grenier JK, Munson G, Lander ES. LincRNAs act in the circuitry controlling pluripotency and differentiation. Nature. 2011;477(7364):295–300. doi: 10.1038/nature10398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gyory I, Wu J, Fejér G, Seto E, Wright KL. PRDI-BF1 recruits the histone H3 methyltransferase G9a in transcriptional silencing. Nature Immunology. 2004;5(3):299–308. doi: 10.1038/ni1046. [DOI] [PubMed] [Google Scholar]
  20. Hamon MA, Cossart P. Histone modifications and chromatin remodeling during bacterial infections. Cell Host & Microbe. 2008;4(2):100–109. doi: 10.1016/j.chom.2008.07.009. [DOI] [PubMed] [Google Scholar]
  21. Harper J, Mould A, Andrews RM, Bikoff EK, Robertson EJ. The transcriptional repressor Blimp1/Prdm1 regulates postnatal reprogramming of intestinal enterocytes. Proceedings of the National Academy of Sciences of the United States of America. 2011;108(26):10585–10590. doi: 10.1073/pnas.1105852108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hermann E, Berthe A, Truyens C, Alonso-Vega C, Parrado R, Torrico F, Braud VM. Killer cell immunoglobulin-like receptor expression induction on neonatal CD8(+) T cells in vitro and following congenital infection with Trypanosoma cruzi. Immunology. 2010;129(3):418–426. doi: 10.1111/j.1365-2567.2009.03194.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hirai C, Ichiba H, Saito M, Shintaku H, Yamano T, Kusuda S. Trophic effect of multiple growth factors in amniotic fluid or human milk on cultured human fetal small intestinal cells. Journal of Pediatric Gastroenterology and Nutrition. 2002;34(5):524–528. doi: 10.1097/00005176-200205000-00010. [DOI] [PubMed] [Google Scholar]
  24. Jamieson SE, de Roubaix LA, Cortina-Borja M, Tan HK, Mui EJ, Cordell HJ, Blackwell JM. Genetic and epigenetic factors at COL2A1 and ABCA4 influence clinical outcome in congenital toxoplasmosis. PLoS One. 2008;3(6):e2285. doi: 10.1371/journal.pone.0002285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. John SA, Garrett-Sinha LA. Blimp1: a conserved transcriptional repressor critical for differentiation of many tissues. Experimental Cell Research. 2009;315(7):1077–1084. doi: 10.1016/j.yexcr.2008.11.015. [DOI] [PubMed] [Google Scholar]
  26. Kapel N, Benhamou Y, Buraud M, Magne D, Opolon P, Gobert JG. Kinetics of mucosal ileal gamma-interferon response during cryptosporidiosis in immunocompetent neonatal mice. Parasitology Research. 1996;82(8):664–667. doi: 10.1007/s004360050182. [DOI] [PubMed] [Google Scholar]
  27. Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, Rinn JL. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proceedings of the National Academy of Sciences of the United States of America. 2009;106(28):11667–11672. doi: 10.1073/pnas.0904715106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, Levine MM. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet. 2013;382(9888):209–222. doi: 10.1016/S0140-6736(13)60844-2. [DOI] [PubMed] [Google Scholar]
  29. Kuhnert F, Davis CR, Wang HT, Chu P, Lee M, Yuan J, Kuo CJ. Essential requirement for Wnt signaling in proliferation of adult small intestine and colon revealed by adenoviral expression of Dickkopf-1. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(1):266–271. doi: 10.1073/pnas.2536800100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lacroix S, Mancassola R, Naciri M, Laurent F. Cryptosporidium parvum specific mucosal immune response in C57BL/6 neonatal and gamma interferon-deficient mice: Role of tumor necrosis factor alpha in protection. Infection and Immunity. 2001;69(3):1635–1642. doi: 10.1128/IAI.69.3.1635-1642.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Laurent F, Eckmann L, Savidge TC, Morgan G, Theodos C, Naciri M, Kagnoff MF. Cyptosporidium parvum infection of human intestinal epithelial cells induces the polarized secretion of C-X-C chemokines. Infection and Immunity. 1997;65(12):5067–5073. doi: 10.1128/iai.65.12.5067-5073.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Liao Q, Shen J, Liu J, Sun X, Zhao G, Chang Y, Wu Z. Genome-wide identification and functional annotation of Plasmodium falciparum long noncoding RNAs from RNA-seq data. Parasitology Research. 2014;113(4):1269–1281. doi: 10.1007/s00436-014-3765-4. [DOI] [PubMed] [Google Scholar]
  33. Ma S, Ming Z, Gong AY, Wang Y, Chen X, Hu G, Chen XM. A long noncoding RNA, lincRNA-Tnfaip3, acts as a coregulator of nf-κb to modulate inflammatory gene transcription in mouse macrophages. FASEB Journal. 2016 doi: 10.1096/fj.201601056R. pii: fj.201601056R. [Epub ahead of print] [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Manzoor R, Kuroda K, Yoshida R, Tsuda Y, Fujikura D, Miyamoto H, Takada A. Heat shock protein 70 modulates influenza A virus polymerase activity. The Journal of Biological Chemistry. 2014;289(11):7599–7614. doi: 10.1074/jbc.M113.507798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Nagy PD, Wang RY, Pogany J, Hafren A, Makinen K. Emerging picture of host chaperone and cyclophilin roles in RNA virus replication. Virology. 2011;411(2):374–82. doi: 10.1016/j.virol.2010.12.061. [DOI] [PubMed] [Google Scholar]
  36. Niranjanakumari S, Lasda E, Brazas R, Garcia-Blanco MA. Reversible cross-linking combined with immunoprecipitation to study RNA-protein interactions in vivo. Methods. 2002;26(2):182–190. doi: 10.1016/S1046-2023(02)00021-X. [DOI] [PubMed] [Google Scholar]
  37. Novak SM, Sterling CR. Susceptibility dynamics in neonatal BALB/c mice infected with Cryptosporidium parvum. The Journal of Protozoology. 1991;38(6):103S–104S. [PubMed] [Google Scholar]
  38. O’Connor RM, Wanyiri JW, Wojczyk BS, Kim K, Ward H. Stable expression of Cryptosporidium parvum glycoprotein gp40/15 in Toxoplasma gondii. Molecular and Biochemical Parasitology. 2007;152(2):149–158. doi: 10.1016/j.molbiopara.2007.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. O’Donoghue PJ. Cryptosporidium and cryptosporidiosis in man and animals. International Journal for Parasitology. 1995;25(2):139–195. doi: 10.1016/0020-7519(94)e0059-v. [DOI] [PubMed] [Google Scholar]
  40. Paschos K, Allday MJ. Epigenetic reprogramming of host genes in viral and microbial pathogenesis. Trends in Microbiology. 2010;18(10):439–447. doi: 10.1016/j.tim.2010.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Pierce KK, Kirkpatrick BD. Update on human infections caused by intestinal protozoa. Current Opinion in Gastroenterology. 2009;25(1):12–17. doi: 10.1097/mog.0b013e32831da7dd. [DOI] [PubMed] [Google Scholar]
  42. Prasanth KV, Spector DL. Eukaryotic regulatory RNAs: an answer to the ‘genome complexity’ conundrum. Genes & Development. 2007;21(1):11–42. doi: 10.1101/gad.1484207. [DOI] [PubMed] [Google Scholar]
  43. Puiu D, Enomoto S, Buck GA, Abrahamsen MS, Kissinger JC. CryptoDB: the Cryptosporidium genome resource. Nucleic Acids Research. 2004;32:D329–331. doi: 10.1093/nar/gkh050. Database issue. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Putignani L, Menichella D. Global distribution, public health and clinical impact of the protozoan pathogen cryptosporidium. Interdisciplinary Perspectives on Infectious Diseases. 2010 doi: 10.1155/2010/753512. pii: 753512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Sasahara T, Maruyama H, Aoki M, Kikuno R, Sekiguchi T, Takahashi A, Inoue M. Apoptosis of intestinal crypt epithelium after Cryptosporidium parvum infection. Journal of Infection and Chemotherapy. 2003;9(3):278–281. doi: 10.1007/s10156-003-0259-1. [DOI] [PubMed] [Google Scholar]
  46. Savidge TC, Shmakov AN, Walker-Smith JA, Phillips AD. Epithelial cell proliferation in childhood enteropathies. Gut. 1996;39(2):185–193. doi: 10.1136/gut.39.2.185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Shin HM, Kapoor VN, Guan T, Kaech SM, Welsh RM, Berg LJ. Epigenetic modifications induced by Blimp-1 regulate CD8+ T cell memory progression during acute virus infection. Immunity. 2013;39(4):661–675. doi: 10.1016/j.immuni.2013.08.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Shinkai Y, Tachibana M. H3K9 methyltransferase G9a and the related molecule GLP. Genes & Development. 2011;25(8):781–788. doi: 10.1101/gad.2027411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sibley LD. Intracellular parasite invasion strategies. Science. 2004;304(5668):248–253. doi: 10.1126/science.1094717. [DOI] [PubMed] [Google Scholar]
  50. Striepen B. Parasitic infections: time to tackle cryptosporidiosis. Nature. 2013;503(7475):189–191. doi: 10.1038/503189a. [DOI] [PubMed] [Google Scholar]
  51. Subramaniam D, Ramalingam S, May R, Dieckgraefe BK, Berg DE, Pothoulakis C, Anant S. Gastrin-mediated interleukin-8 and cyclooxygenase-2 gene expression: differential transcriptional and posttranscriptional mechanisms. Gastroenterology. 2008;134(4):1070–1082. doi: 10.1053/j.gastro.2008.01.040. [DOI] [PubMed] [Google Scholar]
  52. Tarver AP, Clark DP, Diamond G, Russell JP, Erdjument-Bromage H, Tempst P, Bevins CL. Enteric beta-defensin: molecular cloning and characterization of a gene with inducible intestinal epithelial cell expression associated with Cryptosporidium parvum infection. Infection and Immunity. 1998;66(3):1045–1056. doi: 10.1128/iai.66.3.1045-1056.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Ulitsky I, Bartel DP. LincRNAs: genomics, evolution, and mechanisms. Cell. 2013;154(1):26–46. doi: 10.1016/j.cell.2013.06.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wang Y, Gong AY, Ma S, Chen X, Li Y, Su CJ, Chen XM. Delivery of parasite RNA transcripts into infected epithelial cells during Cryptosporidium infection and its potential impact on host gene transcription. The Journal of Infectious Diseases. 2016 doi: 10.1093/infdis/jiw607. pii: jiw607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Won HY, Lee JY, Shin DH, Park JH, Nam JS, Kim HC, Kong G. Loss of Mel-18 enhances breast cancer stem cell activity and tumorigenicity through activating Notch signaling mediated by the Wnt/TCF pathway. FASEB Journal. 2012;26(12):5002–5013. doi: 10.1096/fj.12-209247. [DOI] [PubMed] [Google Scholar]
  56. Yamagishi J, Wakaguri H, Sugano S, Kawano S, Fujisaki K, Sugimoto C, Xuan X. Construction and analysis of full-length cDNA library of Cryptosporidium parvum. Parasitology International. 2011;60(2):199–202. doi: 10.1016/j.parint.2011.03.001. [DOI] [PubMed] [Google Scholar]
  57. Yang YL, Serrano MG, Sheoran AS, Manque PA, Buck GA, Widmer G. Over-expression and localization of a host protein on the membrane of Cryptosporidium parvum infected epithelial cells. Molecular and Biochemical Parasitology. 2009;168(1):95–101. doi: 10.1016/j.molbiopara.2009.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zhou R, Hu G, Liu J, Gong AY, Drescher KM, Chen XM. NF-kappaB p65-dependent transactivation of miRNA genes following Cryptosporidium parvum infection stimulates epithelial cell immune responses. PLoS Pathogens. 2009;5(12):e1000681. doi: 10.1371/journal.ppat.1000681. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Tables

Table S1. Primers for PCR, RIP, ChIP, ChIRP and construct generating

Table S2. ChIRP probe sequences

Fig. S1. Upregulation of selected genes in intestinal epithelium following C. parvum infection

(A), (B), and (C) Upregulation of selected genes in intestinal epithelial cells following C. parvum infection in vitro. HCT-8 (A), INT (B), and IEC4.1 (C) cells were cultured and exposed to C. parvum oocyst infection for 24 and 48h. Expression levels of selected genes were quantified using real-time PCR and compared with that in the non-infected cells as the control (Ctrl). Data are from at least three independent experiments, presented as a ratio to the control as normalized by GAPDH.

(D) Upregulation of selected genes in intestinal epithelium of C. parvum-infected neonatal mice. Ileum epithelium was isolated from mice at 24h after oral administration of C. parvum oocysts. Levels of selected genes in the isolated ileum epithelium were measured using real-time PCR and compared with that of the control (ileum epithelium from mice after oral administration of PBS).

Fig. S2. Expression of select genes in cultured intestinal epithelial cells following E. coli K12 infection or LPS stimulation

(A) Expression of select genes in cultured intestinal epithelial cells following E. coli K12 infection. HCT-8 and IEC4.1 cells were exposed to E. coli K12 infection for 24h, respectively, and the expression levels of select genes were quantified by real-time PCR. The non-infected cells were used as the controls.

(B) Expression of select genes in IEC4.1 cells following LPS stimulation. The TLR4-positive IEC4.1 cells were exposed to LPS stimulation for 4h and expression of select genes was measured by real-time PCR. Cells without LPS treatment were used as the controls.

Fig. S3. C. parvum infection didn’t alter the stability of suppressed genes in intestinal epithelial cells

Several intestinal epithelial cell lines were exposed to C. parvum infection for 24h, and treated with actinomycin D (Act D) for up to 2h. The stability of selected RNAs was measured by PCR, calculated, and presented as the relative amount of RNA levels in cells before Act D treatment.

Fig. S4. Occupancy of Cdg7_Flc_0990 to the LRP5 and SLC7A8 gene loci in cells overexpressing Cdg7_Flc_0990

An increased occupancy of Cdg7_FLc_0990 to the promoter regions of LRP5 and SLC7A8 gene loci was detected in HCT-8 cells transfected with the Cdg7_FLc_0990 construct, using ChIRP analysis with a pool of biotinylated tiling probes to target Cdg7_FLc_0990. Chromatin complexes were purified and the resultant genomic DNA fragments were validated using realtime PCR with the same designed primer sets for ChIP assay for LRP5 and SLC7A8 genes. Primer sets designed for LacZ served as the controls.

NIHMS887885-supplement-supplement_1.pdf (1.4MB, pdf)

RESOURCES