Abstract
Background:
Perilipins are proteins that coat lipid globules in adipocytes, which are steroid-generating cells that play a central role in lipid storage and breakdown. The FTO gene is associated with type-2 diabetes (T2D) and increased fat mass. In this work the association of perilipin and FTO gene polymorphisms in T2D was investigated.
Methods:
One hundred eighty-three Iranian men and women with T2D, and 174 healthy controls with no known metabolic diseases, participated in the study. The subjects were genotyped using tetra-primer amplification refractory mutation system-polymerase chain reaction (Tetra-ARMS-PCR) and their clinical traits were analyzed.
Results:
A significant association was found between the perilipin rs1052700 polymorphism and T2D, and between the FTO rs3751812 polymorphism and obesity (P = 0.03 and 0.003, respectively); however, no significant relationship was found between rs3751812 and T2D.
Conclusion:
The FTO rs3751812 polymorphism is a major genetic determinant of obesity, but not T2D. The perilipin rs1052700 polymorphism is related to T2D but not obesity.
Key Words: FTO, Gene polymorphism, Perilipin, Type-2 diabetes
Introduction
The worldwide incidence of type-2 diabetes (T2D) has increased dramatically in recent years and is a major cause of metabolic disorders, heart disease, stroke, diabetic retinopathy, kidney failure, and poor circulation in the hands and feet, which may lead to amputation (1, 2).
In a genome-wide association study (GWAS), the fat mass and obesity-associated (FTO) locus has been recognized to contain FTO, a gene associated with increased risk of T2D in humans (3). In mice, FTO is expressed in many tissues, including brain. It is located on a section of chromosome 8 that is removed by the fused toes mutation (4). Dina et al. (5) surveyed the expression of FTO in human tissues and found it in all tissues tested, and in animal studies FTO was expressed in the brain. The dependence between FTO genotype and T2D proposes that FTO alleles, which enhance adiposity, have detrimental metabolic effects. Obesity is associated with insulin resistance, nonalcoholic fatty liver disease, hyperglycemia, hypertension, and dyslipidemia in the general population (6). A survey of the effects of FTO variation on clinical characteristics may improve our understanding of how genetic alterations to FTO could predict T2D and other diabetes-related diseases. In this study, the associations between the FTO rs3751812 polymorphism and T2D, and metabolic traits, including fasting blood glucose (FBG), total cholesterol (TC), triglyceride (TG), high-density lipoprotein-cholesterol (HDL-C), and low-density lipoprotein-cholesterol (LDL-C) were investigated. It was assumed that the FTO variant, through body mass index (BMI), would be related to metabolic traits, and changes in metabolic factors may predispose a person to T2D. However, the effects of the FTO genotype on pre-diabetic-mediated characteristics are not known.
The other gene investigated in this study was perilipin rs1052700, which encodes the perilipin protein, also known as PLIN or lipid dropletassociated protein. Perilipins are phosphoproteins that coat intracellular lipid droplets (7). In humans, perilipin is located at chromosomal location 15q26.1 (8) and has been shown to be a susceptibility locus for obesity, diabetes, and hypertriglyceridemia (9).
Perilipin is a target of protein kinase A (PKA), and non-phosphorylated perilipin may inhibit the hormone-sensitive lipase (HSL) that mediates lipolysis of TAG’s in lipid droplets (10). With phosphorylation, perilipin may activate HSL function (11). Therefore, perilipin A acts to increase cellular TAG storage by decreasing the rate of TAG hydrolysis. This activity may have a role in obesity and changes in lipid metabolism. Several studies have related perilipin expression to obesity.
Two studies identified obese individuals with lower levels of perilipin than thinner individuals (12); however, another study demonstrated that perilipin mRNA and protein were elevated in obese individuals (13). In this survey, the genetic variability of perilipin and FTO and their relationship with obesity, T2D, metabolic traits, and related characteristics in a southeast Iranian population were investigated.
Materials and Methods
Subjects and clinical analysis
The study saw designed and subjects enrolled according to the American Diabetes Association (ADA) (14) and as described in our previous reports (2, 15). The study population included 137 females and 46 males patients with T2D with a mean age of 54.10 ± 9.33 years, and 123 females and 51 males healthy controls with a mean age of 48.95 ± 9.65 years. The study was performed in Ali-Asghar Hospital in southeast Iran. All subjects provided informed consent before entering the study. The body mass index (BMI) was determined for all subjects and biochemical measurements were performed using standard methods. FBG, HDL-C, TC, TG, and LDL-C were determined for all subjects via enzymatic procedures and the Friedewald formula.
This study was financed by the Zahedan University of Medical Science, and the University Ethics Committee approved this study with code 7179.
DNA extraction and genotyping
Two mL of whole blood were collected from all subjects into CBC tubes containing 0.5M EDTA and stored at -20 0C until use. Genomic DNA was extracted from all samples using the salting-out method as previously described (16). DNA extracts were analyzed for quality by electrophoresis and DNA concentrations were determined by Nano-Drop. Both perilipin rs1052700 and FTO rs3751812 single nucleotide polymorphisms (SNPs) were analyzed by tetra primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR). DNA was amplified by PCR in 20 μL volumes containing 10 μL of master mix (Taq 2x Mastermix, Ampliqon, Denmark ), 1μL (10pmol/mL) each of forward and reverse primers, 1.5 μL of template DNA, and 4.5 μL of DNase-free water (17). For perilipin rs1052700 and FTO rs3751812, the amplifications were performed with an initial denaturation step at 95 °C for 5 min, followed by 30 cycles of denaturation at 95 °C for 30 sec, annealing 65 °C for 30 sec, and extension at 72 0C for 30 sec, with a final extension at 72 °C for 5 min. The primer sequences were as follows:
for perilipin:
forward outer: CCTCTGCGGATAAATATTTGCCACGAAT
reverse outer: TAATGATGCAAATGGAAATGTGGCTGTG
forward inner: CCCTCTGATGAACATCCTCTGATGAACA
reverse inner: CTTCAAAGTAGCCTGCTGGGAGCGTA
for FTO:
forward outer: TTTGGCTCTCCTTGTGTCTTTTCATGTG
reverse outer: GCAATGACTGGTAATGAAACCTACTTGGCA
forward inner: AGACCTGAAAATAGGTGAGCTGTCAGGG
reverse inner: CCAGAGGAGCCTCTCCCTGCCAATAA
Statistical analyses
SPSS version 21.0 (SPSS, Chicago, IL, USA) was used for all statistical analyses. Means ± standard deviations were used to describe the quantitative data, and the student’s t-test was used to compare the quantitative variants of the T2Ds and healthy controls. The Fisher’s exact test or the χ2-test was used to analyze genotypes and data frequencies. The allele frequencies were determined by gene counting. The Hardy–Weinberg equilibrium (HWE) was examined using the χ2 for each SNP. P values < 0.05 were considered statistically significant.
Results
FTO and perilipin polymorphisms of the T2D and control subjects were compared. Significant differences were found between the two groups for TG, FBG, and BMI (P < 0.05, Table 1). Regarding the FTO rs3751812, no significant differences were found between the two groups for genotypes or alleles (Table 2); however, significant differences in obesity (BMI ≥ 25) and TC were found between the FTO genotypes (Table 3) and between the groups for age, BMI, TG, and FBG in the TT genotype and for age, BMI, LDL-C, and FBG in the GT-GG genotype (Table 4). The genotype and allele frequencies of the perilipin rs1052700 polymorphism in the T2D and control groups are summarized in Table 5. Significant differences were observed between the three perilipin genotypes and perilipin alleles (genotypes, P = 0.03 and alleles, P < 0.001). Significant differences were observed for age ≤ 50 years, females, FBG < 110, and TG ≥ 130 between the three perilipin rs1052700 polymorphism genotypes (Table 6), and significant differences were found between T2D and control groups with TT genotypes for age, gender, BMI, FBG, and TG, and with the TA-AA genotype between T2D patients and controls for age, BMI, and FBG (Table 7).
Table 1.
Clinical and demographic characteristics in control and T2D subjects.
| Characteristics | Healthy Control (n = 174) | T2D (n = 183) | P value |
|---|---|---|---|
| Age in years ± SD | 48.95 ± 9.65 | 54.10 ± 9.33 | 0.543 |
| Gender, No (%) Female | 123 (67) | 137 (79) | 0.222 |
| TC (mg/dL) | 180 ± 36.64 | 183.39 ± 43.95 | 0.533 |
| TG (mg/dL) | 124 (89) | 148 (90) | 0.005 |
| HDL-C (mg/dL) | 52.92 ± 16.58 | 47.63 ± 21.66 | 0.603 |
| LDL-C (mg/dL) | 104.15 ± 33.33 | 93.92 ± 24.71 | 0. 190 |
| FBG (mg/dL) | 93 (14) | 180.23 (104) | P < 0.001 |
| BMI (kg/m2) | 23 (5) | 26.95 (5) | P < 0.001 |
TC: total cholesterol; TG: triglycerides; HDL-C: high density lipoprotein-cholesterol; LDL-C: low density lipoprotein-cholesterol; FBG: fasting blood glucose; BMI: body mass index.
Table 2.
Genotype and allele frequencies of the FTO rs3751812 polymorphism in T2D and control subjects.
| Genotypes | Alleles | ||||
|---|---|---|---|---|---|
| TT | GT | GG | T | G | |
| T2D (n =183) N (%) | 63 (34.4) | 98 (53.6) | 22 (12) | 224 (61.2) | 142 (38.8) |
| Control (n = 174) N (%) | 61 (35.1) | 83 (47.7) | 30 (17.2) | 205 (58.9) | 143 (41.1) |
| P value | 0.320 | 0.53 | |||
Table 3.
Association between the FTO rs3751812T/G polymorphism and clinical characteristics.
| Variable | FTO rs3751812 | |||
|---|---|---|---|---|
| TT | GT | GG | P value | |
| Age (years | ||||
| ≤50 n (%) | 31 (17) | 82 (46) | 67 (37) | 0.440 |
| >50 | 21 (12) | 99 (56) | 57 (32) | 0.464 |
| Gender, n (%) | ||||
| Female | 35 (14) | 131 (50) | 94 (36) | 0.694 |
| Male | 17 (18) | 50 (51) | 30 (31) | 0.737 |
| BMI (Kg/m2) | ||||
| < 25 n (%) | 24 (13) | 82 (46) | 72 (41) | 0.180 |
| ≥25 | 28 (15) | 99 (55) | 52 (30) | 0.003 |
| TC (mg/dL) | 146.43 ± 50. | 132 ± 47 | 195 ± 61.6 | 0.045 |
| TG (mg/dL) | ||||
| <130 n (%) | 26 (15) | 81 (51) | 60 (36) | 0.692 |
| ≥130 | 23 (13) | 95 (52) | 63 (35) | 0.897 |
| HDL-C (mg/dL) | 52.26 ± 15.47 | 51.26 ± 12.57 | 55.49 ± 17.7 | 0.131 |
| LDL-C (mg/dL) | 107.45 ± 26 | 104.47 ± 32.32 | 101.83 ± 42.22 | 0.601 |
| FBG (mg/dL) | ||||
| < 110 n (%) | 30 (16) | 93 (51) | 61 (33) | 0.056 |
| ≥110 | 20 (12) | 83 (50) | 62 (38) | 0.468 |
TC: total cholesterol, TG: triglycerides, HDL-C: high density lipoprotein-cholesterol, LDL-C: low density lipoprotein-cholesterol, FBG: fasting blood glucose, BMI: body mass index.
Table 4.
Baseline characteristics of the study population according to the FTO gene rs3751812T/G
| Characteristics | TT | GT-GG | ||||
|---|---|---|---|---|---|---|
| Patients (n = 63) | Controls (n = 61) | P value | Patients (n = 120) | Controls (n = 113) | P value | |
| Age in years ± SD | 52 (13) | 48 (11) | 0.003 | 55 (13) | 47 (14) | < 0.001 |
| Gender, No (%) Female | 48 (76) | 46 (75) | 0.921 | 89 (74) | 77 (68) | 0.312 |
| BMI (Kg/m2) | 26.29 (4) | 21 (6) | < 0.001 | 27.38 (6) | 23.42 (4) | < 0.001 |
| TC (mg/dL) | 187.6 ± 55.65 | 181 ± 41.06 | 0.455 | 181 ± 36.28 | 181 ± 33 | 0.980 |
| TG (mg/dL) | 148 (99) | 106 (69) | 0.004 | 148 (96) | 126 (92) | 0.379 |
| HDL-C (mg/dL) | 53.30 ± 18.23 | 55.89 ± 15.37 | 0.450 | 54.75 ± 21.30 | 52.91 ± 13.70 | 0.507 |
| LDL-C(mg/dL) | 101±41.57 | 100.54±29 | 0.860 | 97±28.52 | 107±29.95 | 0.022 |
| FBG (mg/dL) | 186 (11) | 94 (14) | < 0.001 | 159.50 (96) | 93 (14) | < 0.001 |
TC: total cholesterol, TG: triglycerides, HDL-C: high density lipoprotein-cholesterol, LDL-C: low density lipoprotein-cholesterol, FBG: fasting blood glucose, BMI: body mass index.
Table 5.
Genotype and allele frequencies of the perilipin rs1052700 polymorphism in T2D patients and controls.
| Genotypes | Alleles | ||||
|---|---|---|---|---|---|
| TT | TA | AA | T | A | |
| Patients(n=183) | 171 (93.4) | 1 (0.6) | 11 (6) | 343 (93.7) | 23 (6.3) |
| Control (n=174) N (% | 150 (86.2) | 0 (0) | 24 (13.8) | 300 (86.2) | 48 (13.8) |
| P value) | 0.03 | P < 0.001 | |||
Table 6.
Association between the perilipin rs1052700 gene polymorphism and clinical characteristics.
| Perilipin | Variable | p-value | ||
|---|---|---|---|---|
| AA | AT | TT | ||
| Age (years) | ||||
| ≤50 n (%) | 21 (12) | 0 (0) | 159 (88) | 0.027 |
| >50 | 14 (8) | 1 (0.5) | 162 (91.5) | 0.312 |
| Gender, n (%) | ||||
| Female | 27 (10.5) | 1 (0.3) | 232 (36) | 0.011 |
| Male | 8 (7) | 0 (0) | 89 (92) | 0.586 |
| BMI (Kg/m2) | ||||
| < 25 n (%) | 22 (12) | 0 (0) | 156 (88) | 0.098 |
| ≥ 25 | 13 (7.3) | 1 (0.5) | 165 (92.2) | 0.249 |
| TC (mg/dL) | 185.91 ± 44.96 | 134 | 176.46 ± 37.95 | 0. 478 |
| TG (mg/dL) | ||||
| < 130 n (%) | 20 (12) | 0 (0) | 147 (88) | 0.406 |
| ≥130 | 15 (8) | 1 (0.5) | 165 (91.5) | 0.010 |
| HDL-C (mg/dL) | 54.02 ± 12.73 | 44 | 53.33 ± 17.76 | 0.116 |
| LDL-C (mg/dL) | 98.98 ± 26.55 | 63 | 102.98 ± 35.78 | 0.724 |
| FBG (mg/dL) | ||||
| < 110 n (%) | 23 (12) | 0 (0) | 161 (88) | 0.01 |
| ≥ 110 | 12 (7.2) | 1 (0.6) | 152 (92.2) | 0.490 |
TC: total cholesterol, TG: triglycerides, HDL-C: high density lipoprotein-cholesterol, LDL-C: low density lipoprotein-cholesterol, FBG: fasting blood glucose, BMI: body mass index.
Table 7.
Baseline characteristics of the study population according to the perilipin rs1052700 gene
| Characteristics | TT | TA-AA | ||||
|---|---|---|---|---|---|---|
| Patients(n = 171) | Controls(n = 150) | P value | Patients(n = 12) | Controls(n = 24) | P value | |
| Age in years ± SD | 53 (13) | 48 (13) | < 0.001 | 54.5 (14) | 45.5 (12) | 0.025 |
| Gender, No (%)Female | 128 (55) | 104 (45) | < 0.001 | 9 (75) | 19 (79) | 0.051 |
| BMI (Kg/m2) | 26.95 (5) | 23 (5) | < 0.001 | 26.85 (8) | 21 (6) | 0.008 |
| TC (mg/dL) | 184.2 ± 44.4 | 180.9 ± 34.9 | 0.451 | 170.8 ± 36.8 | 179.3 ± 46.6 | 0.586 |
| TG (mg/dL) | 149 (98) | 125 (91) | 0.021 | 126.50 (47) | 94.50 (14) | 0.717 |
| HDL-C (mg/dL) | 169 ± 54.71 | 99 ± 54.02 | 0.763 | 47.63 ± 21.6 | 52.9 ± 16.6 | 0.498 |
| LDL-C (mg/dL) | 99 ± 34.17 | 105 ± 29.64 | 0.149 | 93.3 ± 24.7 | 104.15 ± 33 | 0.368 |
| FBG (mg/dL) | 173 (110) | 93 (14) | < 0.001 | 179 (84) | 94.5 (14) | < 0.001 |
TTC: total cholesterol, TG: triglycerides, HDL-C: high density lipoprotein-cholesterol, LDL-C: low density lipoprotein-cholesterol, FBG: fasting blood glucose, BMI: body mass index.
The subjects’ loci were analyzed for Hardy-Weinberg equilibrium (HWE). The genotype distribution of FTO rs3751812 was in HWE for healthy controls (P = 0.8462, χ2 = 0.04) and T2Ds (P = 0.1284, χ2 = 2.31); however, perilipin rs1052700 was not in HWE for both groups (P < 0.05, χ2 = 174 and P < 0.05. χ2 = 166.41 for healthy controls and T2Ds, respectively).
Discussion
Type 2 diabetes is recognized when any of the following criteria are met: FBG ≥ 126 mg/dL (7.0 mmol/L), 2-hour plasma glucose ≥ 200 mg/dL (11.1mmol/L), or a random blood glucose measurement ≥ 200 mg/dL (11.1mmol/L) in the presence of classic symptoms such as polydipsia and polyuria(17). A hemoglobin A1C measurement of 6.5% is also been considered as an indicator of T2D (18). All these conditions were confirmed in the current study on diabetic patients. However, obesity and T2D are increasing worldwide. In the present study, the impact of the genetic variability of perilipin and FTO on obesity, T2D, and related clinical and demographic characteristics in a sample of southeastern Iranian men and women with T2D (n = 183) was assessed. Our results provide evidence that FTO genetic variants are associated with obesity risk and related clinical traits in this population. Evidence from GWAS and meta-analyses supported the relationship of FTO variants with obesity and related traits in Caucasians (19, 20). FTO variants increased obesity risk by 1.20 to 1.32-fold in Europeans (21) and by 1.25-fold in Asians (22). Our findings indicate that the lack of association between FTO variants and T2D in Iranians is due to relativity small sample size and low allele frequency in the Iranian population. However, no association was found between FTO genotypes and T2D in the study population. In agreement with our results, Scuteri et al. found no significant association between FTO rs3751812 and T2D in African individuals (25). In addition, Hennig et al. found no relationship between several FTO SNPs, including rs3751812 and rs9931494 at this locus, and diabetes in a Gambian population (23). Bressle et al. (24) reported that the risk of T2D and obesity was differentially associated with variation in FTO rs9939609 in whites and African-Americans. Perhaps another cause of the lack of association between FTO and T2D in our study was the relatively low number of subjects. To achieve more accurate results, further studies are required. Another gene in the current survey was perilipin rs1052700. In contrast to FTO rs3751812, perilipin rs1052700 was significantly associated with T2D; however, no correlation was observed between the perilipin rs1052700 polymorphism and BMI. Wang (25) detected an association between ENPP1 and perilipin with an increased risk of T2D in a Taiwanese population. In clinical practice, the World Health Organization (WHO) classifies a person with a BMI ≥ 25 kg/m2 as obese (26). Because obesity is considered a pre-diabetic condition, the aim of the present study was to assess the association between the obesity-related genes perilipin and FTO and an individual’s diabetes risk. Gender and age are associated with obesity and body composition; for example, women tend to store more fat subcutaneously than in visceral adipose tissue, and carry more body fat than men (27). Yu et al. (28) reported two genetic variants of Perilipin Gene (PLIN) rs1052700 and rs894160; the results detected that fasting glucose concentration and diabetes risk increased significantly with increase of BMI also they found adult with allele T in rs1052700 or with allele A in rs894160 of Perilipin Gene may have a high risk for diabetes. However, Bergmann et al. (29) found no association between perilipin polymorphisms and obesity and weight variations in people at high risk for T2D. In a survey of an Asian population, the perilipin polymorphism was associated with increased obesity risk (30).
The reason for the deviation from HWE in our study is not clear but may be due to small sample size, migration, and/or subjects who were offspring of consanguineous marriages, which are commons in southeast Iran.
In conclusion, the FTO rs3751812 polymorphism is a major genetic determinant of obesity, but not T2D. The perilipin rs1052700 polymorphism is related to T2D but not obesity.
Acknowledgements
The authors thank Zahedan University of Medical Sciences for funded and supported this work and the patients and healthy subjects who willingly participated in this study.
The authors declare that there is no conflict of interests to disclose.
References
- 1.Fasanmade O, Odeniyi I, Ogbera A. Diabetic ketoacidosis: diagnosis and management. African journal of medicine and medical sciences. 2008;37(2):99–105. [PubMed] [Google Scholar]
- 2.Galavi HR, Saravani R, Alamdari AR, Ranjbar N, Damani E, Khodakhier TN. Evaluating the effect of the rs2229238 and the rs4845625 interleukin 6 receptor gene polymorphisms on body mass index and the risk of type 2 diabetes in an iranian study population. International Journal of High Risk Behaviors and Addiction. 2016;5(4) [Google Scholar]
- 3.Scott LJ, Mohlke KL, Bonnycastle LL, Willer CJ, Li Y, Duren WL, et al. A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. science. 2007;316(5829):1341–5. doi: 10.1126/science.1142382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Peters T, Ausmeier K, Rüther U. Cloning of Fatso (Fto), a novel gene deleted by the Fused toes (Ft) mouse mutation. Mamm Genome. 1999;10(10):983–6. doi: 10.1007/s003359901144. [DOI] [PubMed] [Google Scholar]
- 5.Dina C, Meyre D, Gallina S, Durand E, Körner A, Jacobson P, et al. Variation in FTO contributes to childhood obesity and severe adult obesity. Nat Genet. 2007;39(6):724–6. doi: 10.1038/ng2048. [DOI] [PubMed] [Google Scholar]
- 6.Eckel RH, Grundy SM, Zimmet PZ. The metabolic syndrome. The Lancet. 2005;365(9468):1415–28. doi: 10.1016/S0140-6736(05)66378-7. [DOI] [PubMed] [Google Scholar]
- 7.Londos C, Brasaemle D, Gruia-Gray J, Servetnick D, Schultz C, Levin D, et al. Perilipin: unique proteins associated with intracellular neutral lipid droplets in adipocytes and steroidogenic cells. Biochem Soc Trans. 1995;23(3):611–5. doi: 10.1042/bst0230611. [DOI] [PubMed] [Google Scholar]
- 8.Nishiu J, Tanaka T, Nakamura Y. Isolation and chromosomal mapping of the human homolog of perilipin (PLIN), a rat adipose tissue-specific gene, by differential display method. Genomics. 1998;48(2):254–7. doi: 10.1006/geno.1997.5179. [DOI] [PubMed] [Google Scholar]
- 9.Mori Y, Otabe S, Dina C, Yasuda K, Populaire C, Lecoeur C, et al. Genome-wide search for type 2 diabetes in Japanese affected sib-pairs confirms susceptibility genes on 3q, 15q, and 20q and identifies two new candidate Loci on 7p and 11p. Diabetes. 2002;51(4):1247–55. doi: 10.2337/diabetes.51.4.1247. [DOI] [PubMed] [Google Scholar]
- 10.Mottagui-Tabar S, Ryden M, Löfgren P, Faulds G, Hoffstedt J, Brookes A, et al. Evidence for an important role of perilipin in the regulation of human adipocyte lipolysis. Diabetologia. 2003;46(6):789–97. doi: 10.1007/s00125-003-1112-x. [DOI] [PubMed] [Google Scholar]
- 11.Zhang HH, Souza SC, Muliro KV, Kraemer FB, Obin MS, Greenberg AS. Lipase-selective functional domains of perilipin A differentially regulate constitutive and protein kinase A-stimulated lipolysis. J Biol Chem. 2003;278(51):51535–42. doi: 10.1074/jbc.M309591200. [DOI] [PubMed] [Google Scholar]
- 12.Wang Y, Sullivan S, Trujillo M, Lee MJ, Schneider SH, Brolin RE, et al. Perilipin expression in human adipose tissues: effects of severe obesity, gender, and depot. Obes Res. 2003;11(8):930–6. doi: 10.1038/oby.2003.128. [DOI] [PubMed] [Google Scholar]
- 13.Kern PA, Di Gregorio G, Lu T, Rassouli N, Ranganathan G. Perilipin expression in human adipose tissue is elevated with obesity. The Journal of Clinical Endocrinology & Metabolism. 2004;89(3):1352–8. doi: 10.1210/jc.2003-031388. [DOI] [PubMed] [Google Scholar]
- 14.Association AD. Standards of medical care in diabetes. Diabetes care. 2004;27(suppl 1):s15–s35. doi: 10.2337/diacare.27.2007.s15. [DOI] [PubMed] [Google Scholar]
- 15.Saravani R, Galavi HR, Ranjbar N, Alamdari A. ATP-Binding Cassette Transporter A1 Polymorphisms and Haplotypes in Risk of Type 2 Diabetes. Gene, Cell and Tissue. 2016 DOI: 10.17795/gct-43677. [Google Scholar]
- 16.Mousavi M, Saravani R, Modrek MJ, Shahrakipour M, Sekandarpour S. Detection of Toxoplasma gondii in Diabetic Patients Using the Nested PCR Assay via RE and B1 Genes. Jundishapur journal of microbiology. 2016;9(2) doi: 10.5812/jjm.29493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Saravani R, Esmaeeli E, Tamendani MK, Nejad MN. Oxytocin Receptor Gene Polymorphisms in Patients With Diabetes. Gene, Cell and Tissue. 2015;2(2) [Google Scholar]
- 18.Goldenberg R, Punthakee Z. Definition, classification and diagnosis of diabetes, prediabetes and metabolic syndrome. Canadian journal of diabetes. 2013;37:S8–S11. doi: 10.1016/j.jcjd.2013.01.011. [DOI] [PubMed] [Google Scholar]
- 19.Hinney A, Nguyen TT, Scherag A, Friedel S, Brönner G, Müller TD, et al. Genome wide association (GWA) study for early onset extreme obesity supports the role of fat mass and obesity associated gene (FTO) variants. PLoS One. 2007;2(12):e1361. doi: 10.1371/journal.pone.0001361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Willer CJ, Speliotes EK, Loos RJ, Li S, Lindgren CM, Heid IM, et al. Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. Nat Genet. 2009;41(1):25–34. doi: 10.1038/ng.287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Speliotes EK, Willer CJ, Berndt SI, Monda KL, Thorleifsson G, Jackson AU, et al. Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. Nat Genet. 2010;42(11):937–48. doi: 10.1038/ng.686. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Li H, Kilpeläinen TO, Liu C, Zhu J, Liu Y, Hu C, et al. Association of genetic variation in FTO with risk of obesity and type 2 diabetes with data from 96,551 East and South Asians. Diabetologia. 2012;55(4):981–95. doi: 10.1007/s00125-011-2370-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Hennig BJ, Fulford AJ, Sirugo G, Rayco-Solon P, Hattersley AT, Frayling TM, et al. FTO gene variation and measures of body mass in an African population. BMC Med Genet. 2009;10(1):1. doi: 10.1186/1471-2350-10-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Bressler J, Kao WL, Pankow JS, Boerwinkle E. Risk of type 2 diabetes and obesity is differentially associated with variation in FTO in whites and African-Americans in the ARIC study. PLoS One. 2010;5(5):e10521. doi: 10.1371/journal.pone.0010521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wang C-H, Ke W-S, Lin E. Evaluation of the ENPP1 and PLIN Single Nucleotide Polymorphisms With Type 2 Diabetes in a Taiwanese Population. Journal of Investigative Medicine. 2012;60(8):1169–73. doi: 10.2310/JIM.0b013e3182746498. [DOI] [PubMed] [Google Scholar]
- 26.WHO EC. Appropriate body-mass index for Asian populations and its implications for policy and intervention strategies. Lancet (London, England) 2004;363(9403):157. doi: 10.1016/S0140-6736(03)15268-3. [DOI] [PubMed] [Google Scholar]
- 27.Ogden CL, Yanovski SZ, Carroll MD, Flegal KM. he epidemiology of obesity. Gastroenterology. 2007;132(6):2087–102. doi: 10.1053/j.gastro.2007.03.052. [DOI] [PubMed] [Google Scholar]
- 28.Yu D, Li C, Xie J, Xu G, Li Y, Liu J, et al. Association between three genetic variants of the perilipin gene (PLIN) and glucose metabolism: results from a replication study among Chinese adults and a meta-analysis. Endocrine research. 2013;38(4):263–79. doi: 10.3109/07435800.2013.778864. [DOI] [PubMed] [Google Scholar]
- 29.Bergmann A, Li J, Reimann M, Hentrich T, Hanefeld M, Bornstein S, et al. Polymorphisms in perilipin gene (PLIN) are not associated with obesity and weight variation in people with high risk of type 2 diabetes. Experimental and clinical endocrinology & diabetes. 2008;116(S 01):S56–S8. doi: 10.1055/s-2008-1081493. [DOI] [PubMed] [Google Scholar]
- 30.Qi L, Tai ES, Tan CE, Shen H, Chew SK, Greenberg AS, et al. Intragenic linkage disequilibrium structure of the human perilipin gene (PLIN) and haplotype association with increased obesity risk in a multiethnic Asian population. J Mol Med. 2005;83(6):448–56. doi: 10.1007/s00109-004-0630-4. [DOI] [PubMed] [Google Scholar]