ABSTRACT
The bacterium Haemophilus parasuis is the specific pathogenic cause of Glässer's disease in swine. Fifteen serotypes of H. parasuis have been reported. A method to serotype H. parasuis isolates accurately would help to prevent and control Glässer's disease outbreaks through appropriate vaccination and to understand the epidemiology in specific geographic areas. However, according to traditional serotyping, the rate of nontypeable (NT) strains is 10 to 40%, which gives low accuracy. In the present study, we developed a set of PCR assays that are able to identify all the currently known H. parasuis serotypes, with a detection limit of 5 CFU. This PCR method is particularly useful to distinguish serotype 5 from serotype 12. We then surveyed the serotype prevalence of H. parasuis isolates from southern China using both the traditional indirect hemagglutination (IHA) and current PCR methods. Of the 298 isolates tested, 228 (76.51%) and 281 (94.30%) were serotyped by the IHA and PCR tests, respectively, with a concordance rate of 80.87% (241/298). The most prevalent serotypes obtained by PCR were 4, 5, 12, 13, NT, and 2, and the most prevalent obtained by IHA were NT, 5, 4, 12, 13, and 2. In conclusion, the PCR assays developed in this study provide a rapid and specific method for the molecular serotyping of H. parasuis.
KEYWORDS: serotyping, serotype-specific PCR, indirect hemagglutination assay, Haemophilus parasuis
INTRODUCTION
The Gram-negative bacterium Haemophilus parasuis is the etiological pathogen of Glässer's disease, which results in polyserositis syndrome with pleuritis, peritonitis, meningitis, and arthritis in swine (1, 2) and causes serious economic losses in the swine industry. H. parasuis is an opportunistic pathogen (3) that often coinfects with other swine pathogens, such as porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circovirus type 2 (4–7). At present, 15 serotypes of H. parasuis have been identified (7, 8). To improve understanding of the molecular epidemical characteristics of H. parasuis infection in specific geographic regions and aid clinical prevention and medication, it is very important to identify the serotypes of isolated strains rapidly.
Much research has been conducted regarding the worldwide distribution of H. parasuis serotypes. For example, serotypes 5, 4, 13, and 2 are dominant in some European countries (9–11), while in Australia, serotypes 4, 5, and 13 are the most prevalent (12). In Brazil, the prevalent serotypes are 4, 5, 14, and 13 (13), and in North America, serotypes 4, 5, 13, and 7 are prevalent (14). In addition, epidemics of H. parasuis infection have shown different characteristics at various times. Serotypes 4, 5, 13, 14, and 12 and nontypeable (NT) strains were the most prevalent in 17 provinces of China during the year 2005 (15) and in southern China during 2011 (16), but during 2016 the serotypes 5, 4, NT, 7, and 13 were predominant in 7 provinces of China (17). Yet, the global epidemiology of H. parasuis serotypes remains unclear.
The accuracy of the traditional serotyping methods is limited and often results in 10% to 40% rates of NT serotypes (9, 10, 12, 14–16, 18–21). Currently, the conventional tests for identification of H. parasuis serotypes using serotype-specific antisera are gel immunodiffusion and indirect hemagglutination assay (IHA) (19, 20). These methods require serotype-specific antisera (22–25). However, it is time-consuming to produce these antisera, and the detection methods are often costly (12, 19, 20, 26–28). The IHA method is more useful than the gel immunodiffusion method, being able to detect 15% more typeable serotypes (15, 29). PCR-based serotyping using primers that can be used to amplify serotype-specific genes is the most effective and rapid method for the identification and differentiation of serotypes. PCR assays used to identify specific H. parasuis serotypes have been reported (17, 29).
Historically, the H. parasuis serovar was believed to produce heat-stable antigens, such as capsular polysaccharide (CPS) antigen and lipopolysaccharide (LPS) or lipooligosaccharide (LOS), in a strain-dependent manner (11). There are many genes located at the CPS locus (11, 17, 29). Although it is simple and rapid to identify H. parasuis serotypes using PCR amplification of the serotype-specific CPS gene, serotypes 5 and 12 cannot be differentiated using the currently available PCR assays (17, 29). Therefore, an improved rapid and accurate PCR method with a high detection rate is required.
In the present study, we developed a rapid PCR serotyping method for detection of H. parasuis reference strains and clinical samples, which is especially useful to differentiate serotype 5 from serotype 12. The results of our method were then compared and confirmed with reference to IHAs.
RESULTS
Development of the PCR typing methods.
In the present study, the 15 serotype-specific PCR amplification products were electrophoresed (Fig. 1) and confirmed by DNA sequencing. Specific amplification bands were obtained using the primers. However, the PCR assay targeted for amplifying the funK gene could not differentiate serotype 5 from serotype 12.
FIG 1.
Band patterns of serotyping PCR for all 15 serovars of H. parasuis reference strains. Lanes S1 to S15, 15 serovars of H. parasuis reference strains; lane M, DL2000 DNA molecular weight marker; H2O, negative control.
A comparative analysis of the genome sequences of serotypes 5 and 12 (CP001321.1 and CP005384.1) was performed using Mauve 2.3.1 software, and specific primer H12 (used to amplify a hypothetical gene) was designed to differentiate the serotype 5 and serotype 12 strains. The PCR assay using primer H12 resulted in a specific positive band for serotype 12 but not for serotype 5 (Fig. 1). As few as 5 CFU (0.5 μl, 1 × 104 CFU/ml) of each reference strain, 15 serotypes in broth culture, could be detected in one PCR (25 μl). The specificity of the method was good, and there was no cross-reaction among the 15 serotypes. There was also no reactivity against closely related commensal Pasteurellaceae and other bacterial pathogens of pigs.
Comparison of the prevalence and serotype profiles between PCR and IHA.
A total of 298 Chinese H. parasuis clinical isolates were used for evaluation of our PCR method. Among them, 179 were isolated from lung, 14 from brain, 20 from joint fluid, 15 from heart, 10 from liver, 35 from tonsil, 1 from spleen, 4 from lymph, and 20 from unknown isolation sites (Table 1). These H. parasuis isolates from pigs with clinical signs of Glässer's disease were examined using the PCR and IHA methods. Of the 298 isolates, 17 (5.7%) were confirmed as nontypeable by PCR (Table 2 and Fig. 2). In contrast, 70 isolates were confirmed as nontypeable strains by IHA. The most prevalent serotype identified by PCR was serotype 4 (25.17% of isolates) and then serotypes 5 (23.15%), 12 (20.47%), 13 (6.04%), NT (5.70%), 2 (5.03%), 7 (3.69%), 1 (3.36%), 10 (2.01%), 14 (2.01%), 11 (1.34%), 8 (1.00%), 9 (0.67%), and 6 (0.34%) (Fig. 3). The most prevalent serotype profile identified by IHA was NT (23.49%) and then serotypes 5 (18.46%), 4 (18.12%), 12 (16.11%), 13 (5.03%), 2 (5.03%), 7 (3.02%), 1 (2.68%), 14 (2.01%), 10 (1.68%), 11 (1.34%), 15 (1.34%), 8 (1.00%), and 9 (0.67%) (Table 2 and Fig. 2).
TABLE 1.
Distribution of H. parasuis isolates in organs of pigs with Glässer's disease from 2007 to 2015
| Yr | No. of isolates by organ: |
Total | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Lung | Brain | Joint | Heart | Liver | Tonsil | Spleen | Lymph | Unknown | ||
| 2007 | 7 | 1 | 2 | 1 | 1 | 12 | ||||
| 2008 | 22 | 1 | 9 | 7 | 3 | 5 | 47 | |||
| 2009 | 20 | 4 | 3 | 5 | 32 | |||||
| 2010 | 10 | 1 | 11 | |||||||
| 2011 | 32 | 8 | 2 | 1 | 2 | 6 | 1 | 1 | 53 | |
| 2012 | 48 | 2 | 1 | 7 | 13 | 4 | 75 | |||
| 2013 | 9 | 1 | 1 | 9 | 1 | 21 | ||||
| 2014 | 11 | 2 | 1 | 7 | 21 | |||||
| 2015 | 20 | 1 | 1 | 4 | 26 | |||||
| Total | 179 | 14 | 20 | 15 | 10 | 35 | 1 | 4 | 20 | 298 |
TABLE 2.
Summary of the PCR and IHA results from 298 H. parasuis isolates
| Serotype determined by PCR | No. of isolates with serotype determined by IHA |
|||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | NTa | Total | |
| 1 | 8 | 2 | 10 | |||||||||||||
| 2 | 15 | 15 | ||||||||||||||
| 4 | 54 | 21 | 75 | |||||||||||||
| 5 | 55 | 14 | 69 | |||||||||||||
| 6 | 1 | 1 | ||||||||||||||
| 7 | 9 | 2 | 11 | |||||||||||||
| 8 | 3 | 3 | ||||||||||||||
| 9 | 2 | 2 | ||||||||||||||
| 10 | 5 | 1 | 6 | |||||||||||||
| 11 | 4 | 4 | ||||||||||||||
| 12 | 48 | 13 | 61 | |||||||||||||
| 13 | 15 | 3 | 18 | |||||||||||||
| 14 | 6 | 6 | ||||||||||||||
| 15 | 0 | |||||||||||||||
| NTa | 4 | 13 | 17 | |||||||||||||
| Total | 8 | 15 | 54 | 55 | 0 | 9 | 3 | 2 | 5 | 4 | 48 | 15 | 6 | 4 | 70 | 298 |
NT, nontypeable isolates.
FIG 2.
Serotype distribution of 298 Chinese isolates as determined by IHA and PCR.
FIG 3.
Serotype distribution of H. parasuis isolated from diseased pigs in southern China between 2007 and 2015.
Of the 228 serotyped isolates from the IHA, 61 were discrepant with PCR results. These serotype-discrepant isolates included a serotype 15 isolate identified as NT by PCR, 2 NT isolates identified as serotype 1, 21 NT isolates identified as serotype 4, 14 NT isolates identified as serotype 5, 1 NT isolate identified as serotype 6, 2 NT isolates identified as serotype 7, 1 NT isolate identified as serotype 10, 13 NT isolates identified as serotype 12, and 3 NT isolates identified as serotype 13 (Table 2). For the 228 typeable isolates identified by IHA, the concordance with PCR was >98.25% (224/228).
Distribution of serotypes by PCR of H. parasuis isolated from diseased pigs in southern China between 2007 and 2015.
The serotypes of 298 clinical H. parasuis pathogens isolated from 2007 to 2015 were identified by PCR (Table 3). Serotypes 4, 5, and 12 were the most prevalent serotypes throughout the 9 years. These 3 serotypes of H. parasuis were isolated nearly every year; serotype 4 was not isolated in 2010. Serotype 13 was also frequently isolated; it was isolated every year except 2007 and 2014. However, it is worth mentioning that the amount of detectable serotype 13, as a highly virulent serotype, was smaller than 4 isolates each year. Serotypes 6, 8, and 9 were the least often isolated serotypes among all the 15 serotypes.
TABLE 3.
Summary of the PCR serotyping results of H. parasuis isolated from diseased pigs in 6 provinces of southern China between 2007 and 2015
| Serotype | No. of isolates by yr of isolation |
||||||||
|---|---|---|---|---|---|---|---|---|---|
| 2007 | 2008 | 2009 | 2010 | 2011 | 2012 | 2013 | 2014 | 2015 | |
| 1 | 2 | 2 | 2 | 2 | 2 | ||||
| 2 | 1 | 4 | 3 | 2 | 2 | 3 | |||
| 4 | 6 | 11 | 2 | 21 | 25 | 5 | 3 | 2 | |
| 5 | 3 | 17 | 10 | 1 | 11 | 12 | 2 | 10 | 3 |
| 6 | 1 | ||||||||
| 7 | 1 | 6 | 2 | 2 | |||||
| 8 | 2 | 1 | |||||||
| 9 | 2 | ||||||||
| 10 | 1 | 4 | 1 | ||||||
| 11 | 1 | 2 | 1 | ||||||
| 12 | 3 | 9 | 5 | 4 | 5 | 22 | 7 | 2 | 4 |
| 13 | 2 | 3 | 1 | 4 | 3 | 2 | 3 | ||
| 14 | 2 | 4 | |||||||
| NTa | 4 | 4 | 2 | 2 | 1 | 4 | |||
NT, nontypeable isolates.
DISCUSSION
In this study, we developed a rapid PCR typing method using different primer sequences. This method was used to identify all 15 serotypes of H. parasuis reference strains and 298 serotypes of clinical isolates. The PCR serotyping experiment was compared and confirmed by IHAs. Serotypes 4, 5, and 12 were identified as the most prevalent serotypes among the 298 clinical isolates.
Serotypes of H. parasuis are determined by antigenic regions of capsular polysaccharides, which are composed of diversified monosaccharide units. These monosaccharide units contribute to the variation of different serotypes (28, 30). The genes expressing capsular polysaccharides are clustered in the CPS locus. Until now, no available genes could be used to distinguish serotype 5 from serotype 12, due to the similar structure of the CPS gene clusters. Howell et al. (29) developed multiplex PCR (mPCR) assays for serotypes 1 to 15 but not 5 and 12. The mPCR results were in 90% concordance with the IHA serotyping results, enabling the differentiation of 14 of the 15 serovars of H. parasuis. In a recent report by Ma et al. (17), serotypes 5 and 12 also could not be distinguished. In their research, 73 (73%) and 93 (93%) were serotyped by the gel immunodiffusion test and mPCR, respectively, with a concordance rate of 66% (66/100). Therefore, in the present study the choice of gene targets for serotype specificity was an important consideration in developing the PCR serotyping assays. We designed a new primer, H12, that can be used for detection of serotype 12. This PCR method could detect more typeable serotypes than the IHA, with greater than 98.25% (224/228) concordance with the IHA, and was particularly useful to distinguish serotype 5 from serotype 12. The method is rapid and effective for identification of all the H. parasuis serotypes.
Serotyping H. parasuis helps us to understand the epidemiology of disease and to monitor the serotype prevalence, as well as to provide information for vaccine development. The highly virulent serotypes of H. parasuis are 1, 5, 10, 12, 13, and 14 and some clade 4 serovars. Serotypes 2, 8, and 15 are less virulent, and the avirulent serotypes are 3, 6, 7, 9, and 11 (4, 19, 31–33). In the present study, serovars 4 (25.16%), 5 (23.15%), and 12 (20.47%) were the most prevalent, which is consistent with other findings (15–17). However, Zhang et al. (16) reported that serotypes 5, 4, and 2 were the most predominant. In the work of Zhang et al., 112 H. parasuis strains were subjected to serovar analysis by gel diffusion tests and IHAs. The difference in prevalence of H. parasuis serotypes may be due to lower sample volume, different sampling locations, or different serotyping methods. Serotype 3 of H. parasuis was not isolated in the present study, which is consistent with the reports of Ma et al. (17) and Cai et al. (15). It was also reported that only 1 strain with serotype 3 was isolated in southern China, indicating that serotype 3 is rare (16). Three strains of serotype 8 were isolated in the present study. Serotype 8 of H. parasuis was also reported by Zhang et al. (16) but not reported by Ma et al. (17) or Cai et al. (15), indicating that an epidemic of serotype 8 of H. parasuis may be related to regional characteristics.
In our study, 17 of the 298 isolates (5.7%) were confirmed by PCR as nontypeable. The ratio of NT to total was close to that reported by Ma et al. (17). In the study by Ma et al., 27% and 7% of NT isolates were serotyped using the gel immunodiffusion test and the multiplex PCR method, respectively. The NT isolates have been reported to contain obvious deletions and/or unknown sequences in the serotype-specific region of their capsule loci with “No Significantly Similar Sequence” (NSSS) found via BLASTn search. This may be the reason why there are such a high number of isolates that are not typeable by PCR. In the present study, serotypes 4, 5, and 12 were detected as the most prevalent over the 9 years; these serotypes were isolated every year from 2007 to 2015. It is worthwhile to note that a large number of highly virulent serotype 13 or moderate virulent serotype 2 (4, 19, 31–33) strain isolates were also collected, which can provide scientific evidence for work toward prevention.
In this study, H. parasuis isolates were collected from multiple tissues of pigs with classical signs of Glässer's disease, including lung, brain, joint, heart, liver, tonsil, spleen, and lymph. Among them, the greatest number of isolates was found in the lung, followed by the tonsils, which may be because H. parasuis is a species of commensal bacteria in the swine upper respiratory tract. The results allow us to isolate H. parasuis easily from lung tissue. The distribution of different serotypes was not correlated with specific organs, and there were multiple serotypes isolated from different organs (Table 4). All serotypes were isolated in the lungs, except for types 3 and 15. Serotype 4, 5, 12, and 13 strains were isolated from lung, brain, joint, heart, liver, or tonsil. In addition, it was noted that H. parasuis was often isolated together with Streptococcus suis. Therefore, it is well to consider the prevention and treatment of mixed infections of H. parasuis and S. suis on pig farms.
TABLE 4.
Serovar distribution of H. parasuis isolates in organs of pigs with Glässer's disease
| Serotype | No. of isolates by organ: |
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Lung | Brain | Joint | Heart | Liver | Tonsil | Spleen | Lymph | Unknown | Total | |
| 1 | 7 | 2 | 1 | 10 | ||||||
| 2 | 7 | 2 | 5 | 1 | 15 | |||||
| 3 | ||||||||||
| 4 | 45 | 3 | 6 | 3 | 3 | 9 | 3 | 3 | 75 | |
| 5 | 35 | 6 | 3 | 6 | 4 | 6 | 1 | 8 | 69 | |
| 6 | 1 | 1 | ||||||||
| 7 | 8 | 2 | 1 | 11 | ||||||
| 8 | 3 | 3 | ||||||||
| 9 | 2 | 2 | ||||||||
| 10 | 1 | 3 | 2 | 6 | ||||||
| 11 | 1 | 2 | 1 | 4 | ||||||
| 12 | 37 | 2 | 6 | 5 | 3 | 5 | 3 | 61 | ||
| 13 | 12 | 1 | 1 | 1 | 2 | 1 | 18 | |||
| 14 | 5 | 1 | 6 | |||||||
| 15 | 0 | |||||||||
| NT | 15 | 2 | 17 | |||||||
| Total | 179 | 14 | 20 | 15 | 10 | 35 | 1 | 4 | 20 | 298 |
In conclusion, the PCR assays developed in this study provide a rapid and specific method for the molecular serotyping of H. parasuis. This PCR method is particularly useful to distinguish serotype 5 from serotype 12. Serotypes 4, 5, and 12 were identified as the most prevalent serotypes among the 298 clinical isolates.
MATERIALS AND METHODS
Ethics statement.
The Animal Ethics Committee of South China Agricultural University approved this study. The porcine reproductive and respiratory syndrome virus (PRRSV)-negative nursery pigs used in this study were treated in strict accordance with the requirements of the Animal Ethics Procedures and Guidelines of the People's Republic of China. All animals were euthanized humanely using sodium pentobarbital anesthesia to reduce suffering.
Bacterial strains.
Reference strains of H. parasuis, comprising serotypes 1 to 15, were provided by South China Agricultural University in Guangdong province (Table 5). A total of 298 H. parasuis clinical strains, isolated between 2007 and 2015 from 894 pigs with Glässer's disease in 113 farms in Guangdong, Jiangxi, Guangxi, Sichuan, Hunan, and Henan provinces of southern China, were used for evaluation of a PCR method of H. parasuis serotyping and for understanding the molecular epidemical characteristics of H. parasuis. The isolates were all characterized as H. parasuis by detecting their biochemical characteristics (NAD dependent), Gram staining properties, and 16S rRNA sequences (99 to 100% identical to H. parasuis strain H0165 [NCBI accession no. ABKM01000007]).
TABLE 5.
Characteristics of 15 serovars of H. parasuis reference strains
| Serovar | Reference strain | Isolation site | Diagnosis | Country of origin |
|---|---|---|---|---|
| 1 | No. 4 | Nose | Healthy | Japan |
| 2 | SW140 | Nose | Healthy | Japan |
| 3 | SW114 | Nose | Healthy | Japan |
| 4 | SW124 | Nose | Healthy | Japan |
| 5 | Nagasaki | Meninges | Septicemia | Japan |
| 6 | 131 | Nose | Healthy | Switzerland |
| 7 | 174 | Nose | Healthy | Switzerland |
| 8 | C5 | Unknown | Unknown | Sweden |
| 9 | D74 | Unknown | Unknown | Sweden |
| 10 | H367 | Nose | Healthy | Germany |
| 11 | H465 | Trachea | Pneumonia | Germany |
| 12 | H425 | Lung | Polyserositis | Germany |
| 13 | IA-84-17975 | Lung | Unknown | USA |
| 14 | IA-84-22113 | Joint | Unknown | USA |
| 15 | SD-84-15995 | Lung | Pneumonia | USA |
PCR typing methods.
By comparing the genomic differences of 15 serotypes of H. parasuis, primers for each serotype-specific gene located in the capsular polysaccharide synthesis gene clusters were designed. The type-specific primer sequences, annealing temperatures, and PCR amplification product sizes of 15 target genes used for identification of 15 serotypes of H. parasuis reference strains are summarized in Table 2. The specificity of 15 pairs of primers was verified by PCR, and they were then used to identify each specific serotype. Of note, the primer sequences of the genes funB, funQ, scdA, funV, funX, and funAB are different from those reported (Table 6) by Howell et al. (11), although the primer names are the same. In addition, the primer sequences of the genes funE, dgdA, gltG, funL, actA, waaL, and funJ used for identification of serotypes 2, 3, 4, 6, 11, 13, and 15, respectively, were also different from recent reports by Howell et al. (11).
TABLE 6.
Primers of 15 genes used for PCR amplification of 15 serotypes of H. parasuis
| Serotype | Direction | Howell et al. (29) |
Current study |
||||||
|---|---|---|---|---|---|---|---|---|---|
| Targeted gene | Sequence (5′ to 3′) | Product size, bp | Targeted gene | Sequence (5′ to 3′) | Product size, bp | Temp, °C | Location of primer (positions) | ||
| 1 | Forward | funB | CTGTGTATAATCTACCCCGATCATCAGC | 180 | funB | TGCATAAAAAATTTTTGAA | 1,245 | 49 | 1–1245 |
| Reverse | GTCCAACAGAATTTGGACCAATTCCTG | TTATATATATTTTACATTTCTAAG | |||||||
| 2 | Forward | wzx | CTAACAAGTTAGGTATGGAGGGTTTTGGTG | 295 | funE | ATGGAAGAAAAAGAATATATC | 1,032 | 52 | 1–1032 |
| Reverse | GGCACTGAATAAGGGATAATTGTACTG | TTAAAGTTTTGATTTGTCAATG | |||||||
| 3 | Forward | glyC | CATGGTGTTTATCCTGACTTGGCTGT | 650 | dgdA | ATGACTAAAAAAATTTTAGTTACAG | 1,068 | 52 | 1–1068 |
| Reverse | TCCACATGAGGCCGCTTCTAATATACT | TTACTTAATACCTAAGCG | |||||||
| 4 | Forward | wciP | GGTTAAGAGGTAGAGCTAAGAATAGAGG | 320 | gltG | ATGAATAATAAAGTCTCAATTATAA | 753 | 52 | 1–753 |
| Reverse | CTTTCCACAACAGCTCTAGAAACC | TTACATATGTTTTACAATTCC | |||||||
| 5 or 12 | Forward | wcwK | CCACTGGATAGAGAGTGGCAGG | 450 | funK | ATGCCAATAGAGATAGC | 560 | 52 | 1–560 |
| Reverse | CCATACATCTGAATTCCTAAGC | CCTGCCATATTATGA | |||||||
| 6 | Forward | gltI | GATTCTGATGATTTTTGGCTGACGGAACG | 360 | funL | ATGAGTATTTTTTTTCTAATTG | 443 | 52 | 1–443 |
| Reverse | CCTATTCTGTCTATAAGCATAGACAGG | TTCCCTGATCATTGTAGTAACC | |||||||
| 7 | Forward | funQ | CTCCGATTTCATCTTTTCTATGTGG | 490 | funQ | TAGTTGGTATATTATTTTCT | 600 | 52 | 239–838 |
| Reverse | CGATAAACCATAACAATTCCTGGCAC | AGAATGCATCTGTACCACTAAG | |||||||
| 8 | Forward | scdA | GGAAGGGGATTACTACTACCTGAAAG | 650 | scdA | CAGCAGGTTCTATGGAGTCA | 350 | 49 | 851–1200 |
| Reverse | CTCCATAGAACCTGCTGCTTGAG | CACATTATAACTTTCTTT | |||||||
| 9 | Forward | funV | AGCCACATCAATTTTAGCCTCATCA | 710 | funV | GCTCCAATATCAGCAGTA | 819 | 58 | 82–900 |
| Reverse | CCTTAAATAGCCTATGTCTGTACC | AGAGTAATGAGCATCTCCG | |||||||
| 10 | Forward | funX | GGTGACATTTATGGGCGAGTAAGTC | 790 | funX | TGATTATTCTACTGCCTTTA | 320 | 55 | 566–886 |
| Reverse | GCACTGTCATCAATAACAATCTTAAGACG | CACCTAGCGTAACCCATA | |||||||
| 11 | Forward | amtA | CCATCTCTTTAACTAATGGGACTG | 890 | actA | ATGATTATAGGTATTTATGGTGC | 657 | 52 | 1–657 |
| Reverse | GGACGCCAACCAGTATTATCAAATG | CTATTTATTTTTTGAAAATTCTC | |||||||
| 12 | Forward | Hypothetical gene | ATGGCTCACGATCCGAAAG | 508 | 60 | 1–508 | |||
| Reverse | ATTTCCCTTTCCTAAACGC | ||||||||
| 13 | Forward | gltP | GCTGGAGGAGTTGAAAGAGTTGTTAC | 840 | waaL | GGCATTAGAGTTTCACCTA | 800 | 60 | 102–901 |
| Reverse | CAATCAAATGAAACAACAGGAAGC | TATTAGCATACCCAGCAT | |||||||
| 14 | Forward | funAB | GCTGGTTATGACTATTTCTTTCGCG | 730 | funAB | TGTCTTTGTTACTACTAATTATTG | 906 | 51 | 5–910 |
| Reverse | GCTCCCAAGATTAAACCACAAGCAAG | TAGTAACTCCAGATAAAGC | |||||||
| 15 | Forward | funI | CAAGTTCGGATTGGGAGCATATATC | 550 | funJ | TTCGCAAGTATAAGGGACT | 536 | 62 | 109–644 |
| Reverse | CCTATATCATTTGTTGGATGTACG | GATGTAGCCATAAAGTCAAT | |||||||
The serotypes of the 15 H. parasuis reference strains and the 298 clinical isolates were detected by PCR typing methods. In brief, the 25-μl PCR mixture consisted of the following: 1.25 U Taq DNA polymerase (TaKaRa, Japan), 2.5 μl of 10× PCR buffer, 2 μl deoxynucleoside triphosphate (dNTP) mixture (0.25 mM for each dNTP), 0.5 μl of forward and reverse primers (50 μM), and 0.5 μl bacterial culture. The genomic DNA was first denatured at 94°C for 5 min and then by 30 cycles of 94°C for 30 s, the annealing temperature of each serotype for 30 s, 72°C for 45 s, and a final extension at 72°C for 5 min. The PCR amplification products of the 15 H. parasuis reference strains were then electrophoresed in 1.0% agarose gels. The gels were observed using a gel imaging system (Tanon 4120; Tanon Science and Technology, Shanghai, China). Tris-borate buffer and a DL2000 DNA marker (TaKaRa, Japan) as the molecular weight standard were used for this gel electrophoresis. The PCR experiments were repeated twice for each bacterial strain.
To evaluate the sensitivity of the PCR assays, the H. parasuis reference strains were diluted in a 10-fold series, from 1 × 107 to 1 × 109 CFU/ml, and detected by the PCR typing methods. The methods were also used to detect 298 H. parasuis isolates from pigs in southern China, from broth cultures.
IHA.
All of the 298 clinical isolates were subjected to serotyping analysis by IHA (34). The antiserum used for serotyping was produced by rabbits as previously described (14). Bacterial cells were grown overnight on tryptic soy agar (BD Company, USA) supplemented with 10% serum and 10 μg/ml NAD. The saline extracts used as antigens were as described by Del Rio et al. (26, 35). The serotyping procedure was performed as described previously (20, 26, 35).
ACKNOWLEDGMENTS
This work was supported by National Key R&D Program of China (2017YFD0501104) and the Public Agriculture Specific Research Program (grant no. 201303034, no. 201303041). This work was completed at South China Agricultural University National and Regional Joint Engineering Laboratory for Medicament of Zoonosis Prevention and Control (People's Republic of China); Key Laboratory of Animal Vaccine Development, Ministry of Agriculture (People's Republic of China); and Key Laboratory of Zoonosis Prevention and Control of Guangdong Province (People's Republic of China).
All authors declare that there is no conflict of interest involved.
REFERENCES
- 1.Costa-Hurtado M, Aragon V. 2013. Advances in the quest for virulence factors of Haemophilus parasuis. Vet J 198:571–576. doi: 10.1016/j.tvjl.2013.08.027. [DOI] [PubMed] [Google Scholar]
- 2.Aragon V, Segalés J, Oliveira S. 2012. Glässer's disease, p 760–769. In Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Stevenson GW (ed), Diseases of swine. Wiley-Blackwell, Chichester, United Kingdom. [Google Scholar]
- 3.Zhang B, Tang C, Liao M, Yue H. 2014. Update on the pathogenesis of Haemophilus parasuis infection and virulence factors. Vet Microbiol 168:1–7. doi: 10.1016/j.vetmic.2013.07.027. [DOI] [PubMed] [Google Scholar]
- 4.Oliveira S, Pijoan C. 2004. Haemophilus parasuis: new trends on diagnosis, epidemiology and control. Vet Microbiol 99:1–12. doi: 10.1016/j.vetmic.2003.12.001. [DOI] [PubMed] [Google Scholar]
- 5.Palzer A, Haedke K, Heinritzi K, Zoels S, Ladinig A, Ritzmann M. 2015. Associations among Haemophilus parasuis, Mycoplasma hyorhinis, and porcine reproductive and respiratory syndrome virus infections in pigs with polyserositis. Can Vet J 56:285–287. [PMC free article] [PubMed] [Google Scholar]
- 6.Yu J, Wu J, Zhang Y, Guo L, Cong X, Du Y, Li J, Sun W, Shi J, Peng J, Yin F, Wang D, Zhao P, Wang J. 2012. Concurrent highly pathogenic porcine reproductive and respiratory syndrome virus infection accelerates Haemophilus parasuis infection in conventional pigs. Vet Microbiol 158:316–321. doi: 10.1016/j.vetmic.2012.03.001. [DOI] [PubMed] [Google Scholar]
- 7.Howell KJ, Weinert LA, Chaudhuri RR, Luan SL, Peters SE, Corander J, Harris D, Angen O, Aragon V, Bensaid A, Williamson SM, Parkhill J, Langford PR, Rycroft AN, Wren BW, Holden MT, Tucker AW, Maskell DJ, BRADP1T Consortium . 2014. The use of genome wide association methods to investigate pathogenicity, population structure and serovar in Haemophilus parasuis. BMC Genomics 15:1179. doi: 10.1186/1471-2164-15-1179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.McCaig WD, Loving CL, Hughes HR, Brockmeier SL. 2016. Characterization and vaccine potential of outer membrane vesicles produced by Haemophilus parasuis. PLoS One 11:e0149132. doi: 10.1371/journal.pone.0149132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Rubies X, Kielstein P, Costa L, Riera P, Artigas C, Espuna E. 1999. Prevalence of Haemophilus parasuis serovars isolated in Spain from 1993 to 1997. Vet Microbiol 66:245–248. doi: 10.1016/S0378-1135(99)00007-3. [DOI] [PubMed] [Google Scholar]
- 10.Angen O, Svensmark B, Mittal KR. 2004. Serological characterization of Danish Haemophilus parasuis isolates. Vet Microbiol 103:255–258. doi: 10.1016/j.vetmic.2004.07.013. [DOI] [PubMed] [Google Scholar]
- 11.Howell KJ, Weinert LA, Luan SL, Peters SE, Chaudhuri RR, Harris D, Angen O, Aragon V, Parkhill J, Langford PR, Rycroft AN, Wren BW, Tucker AW, Maskell DJ, BRaDP1T Consortium . 2013. Gene content and diversity of the loci encoding biosynthesis of capsular polysaccharides of the 15 serovar reference strains of Haemophilus parasuis. J Bacteriol 195:4264–4273. doi: 10.1128/JB.00471-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Turni C, Blackall PJ. 2010. Serovar profiling of Haemophilus parasuis on Australian farms by sampling live pigs. Aust Vet J 88:255–259. doi: 10.1111/j.1751-0813.2010.00592.x. [DOI] [PubMed] [Google Scholar]
- 13.Castilla KS, de Gobbi DD, Moreno LZ, Paixao R, Coutinho TA, dos Santos JL, Moreno AM. 2012. Characterization of Haemophilus parasuis isolated from Brazilian swine through serotyping, AFLP and PFGE. Res Vet Sci 92:366–371. doi: 10.1016/j.rvsc.2011.04.006. [DOI] [PubMed] [Google Scholar]
- 14.Rapp-Gabrielson VJ, Gabrielson DA. 1992. Prevalence of Haemophilus parasuis serovars among isolates from swine. Am J Vet Res 53:659–664. [PubMed] [Google Scholar]
- 15.Cai X, Chen H, Blackall PJ, Yin Z, Wang L, Liu Z, Jin M. 2005. Serological characterization of Haemophilus parasuis isolates from China. Vet Microbiol 111:231–236. doi: 10.1016/j.vetmic.2005.07.007. [DOI] [PubMed] [Google Scholar]
- 16.Zhang J, Xu C, Guo L, Shen H, Deng X, Ke C, Ke B, Zhang B, Li A, Ren T, Liao M. 2012. Prevalence and characterization of genotypic diversity of Haemophilus parasuis isolates from southern China. Can J Vet Res 76:224–229. [PMC free article] [PubMed] [Google Scholar]
- 17.Ma L, Wang L, Chu Y, Li X, Cui Y, Chen S, Zhou J, Li C, Lu Z, Liu J, Liu Y. 2016. Characterization of Chinese Haemophilus parasuis isolates by traditional serotyping and molecular serotyping methods. PLoS One 11:e0168903. doi: 10.1371/journal.pone.0168903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Tadjine M, Mittal KR, Bourdon S, Gottschalk M. 2004. Development of a new serological test for serotyping Haemophilus parasuis isolates and determination of their prevalence in North America. J Clin Microbiol 42:839–840. doi: 10.1128/JCM.42.2.839-840.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kielstein P, Rapp-Gabrielson VJ. 1992. Designation of 15 serovars of Haemophilus parasuis on the basis of immunodiffusion using heat-stable antigen extracts. J Clin Microbiol 30:862–865. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Rafiee M, Blackall PJ. 2000. Establishment, validation and use of the Kielstein-Rapp-Gabrielson serotyping scheme for Haemophilus parasuis. Aust Vet J 78:172–174. doi: 10.1111/j.1751-0813.2000.tb10586.x. [DOI] [PubMed] [Google Scholar]
- 21.Oliveira S, Blackall PJ, Pijoan C. 2003. Characterization of the diversity of Haemophilus parasuis field isolates by use of serotyping and genotyping. Am J Vet Res 64:435–442. doi: 10.2460/ajvr.2003.64.435. [DOI] [PubMed] [Google Scholar]
- 22.Bentley SD, Aanensen DM, Mavroidi A, Saunders D, Rabbinowitsch E, Collins M, Donohoe K, Harris D, Murphy L, Quail MA, Samuel G, Skovsted IC, Kaltoft MS, Barrell B, Reeves PR, Parkhill J, Spratt BG. 2006. Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. PLoS Genet 2:e31. doi: 10.1371/journal.pgen.0020031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Boyce JD, Chung JY, Adler B. 2000. Genetic organisation of the capsule biosynthetic locus of Pasteurella multocida M1404 (B:2). Vet Microbiol 72:121–134. doi: 10.1016/S0378-1135(99)00193-5. [DOI] [PubMed] [Google Scholar]
- 24.Verdier I, Durand G, Bes M, Taylor KL, Lina G, Vandenesch F, Fattom AI, Etienne J. 2007. Identification of the capsular polysaccharides in Staphylococcus aureus clinical isolates by PCR and agglutination tests. J Clin Microbiol 45:725–729. doi: 10.1128/JCM.01572-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Onokodi JK, Wauters G. 1981. Capsular typing of klebsiellae by coagglutination and latex agglutination. J Clin Microbiol 13:609–612. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Del Rio ML, Gutierrez CB, Rodriguez Ferri EF. 2003. Value of indirect hemagglutination and coagglutination tests for serotyping Haemophilus parasuis. J Clin Microbiol 41:880–882. doi: 10.1128/JCM.41.2.880-882.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Morozumi T, Nicolet J. 1986. Morphological variations of Haemophilus parasuis strains. J Clin Microbiol 23:138–142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wang K, Sun X, Lu C. 2012. Development of rapid serotype-specific PCR assays for eight serotypes of Streptococcus suis. J Clin Microbiol 50:3329–3334. doi: 10.1128/JCM.01584-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Howell KJ, Peters SE, Wang J, Hernandez-Garcia J, Weinert LA, Luan SL, Chaudhuri RR, Angen O, Aragon V, Williamson SM, Parkhill J, Langford PR, Rycroft AN, Wren BW, Maskell DJ, Tucker AW, BRaDP1T Consortium . 2015. Development of a multiplex PCR assay for rapid molecular serotyping of Haemophilus parasuis. J Clin Microbiol 53:3812–3821. doi: 10.1128/JCM.01991-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Roberts IS. 1996. The biochemistry and genetics of capsular polysaccharide production in bacteria. Annu Rev Microbiol 50:285–315. doi: 10.1146/annurev.micro.50.1.285. [DOI] [PubMed] [Google Scholar]
- 31.Salter SJ, Hinds J, Gould KA, Lambertsen L, Hanage WP, Antonio M, Turner P, Hermans PW, Bootsma HJ, O'Brien KL, Bentley SD. 2012. Variation at the capsule locus, cps, of mistyped and non-typable Streptococcus pneumoniae isolates. Microbiology 158:1560–1569. doi: 10.1099/mic.0.056580-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Zhang Y, Li G, Xie F, Liu S, Wang C. 2017. Evaluation of glutathione-binding protein A of Haemophilus parasuis as a vaccine candidate in a mouse model. J Vet Med Sci 79:184–187. doi: 10.1292/jvms.16-0327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhang Y, Li Y, Yuan W, Xia Y, Shen Y. 2016. Autophagy is associated with pathogenesis of Haemophilus parasuis. Front Microbiol 7:1423. doi: 10.3389/fmicb.2016.01423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Morozumi T, Nicolet J. 1986. Some antigenic properties of Haemophilus parasuis and a proposal for serological classification. J Clin Microbiol 23:1022–1025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Turni C, Blackall PJ. 2005. Comparison of the indirect haemagglutination and gel diffusion test for serotyping Haemophilus parasuis. Vet Microbiol 106:145–151. doi: 10.1016/j.vetmic.2004.12.019. [DOI] [PubMed] [Google Scholar]