Skip to main content
NCBI home page
Cell Transplantation logoLink to Cell Transplantation
. 2017 Jan 1;26(1):95–102. doi: 10.3727/096368916X692816

Differences in Tfh Cell Response between the Graft and Spleen with Chronic Allograft Nephropathy

Jian Shi *, Xianlin Xu *, Fengbao Luo *, Qianqian Shi *, Xiaozhou He *,✉, Ying Xia †
PMCID: PMC5657687  PMID: 27524795

Abstract

The aim of this study was to investigate follicular helper T (Tfh) cell response and its difference between renal graft and spleen in a rat renal transplantation model undergoing chronic allograft nephropathy (CAN). Orthotopical kidney transplantations were performed on Fischer (F344) rats and transplanted to Lewis rats, using syngeneic Lewis–Lewis grafts as controls. Tissue samples were collected at 8 weeks posttransplantation. The status of Tfh cell response was assessed by measuring the levels of transcription factor B-cell lymphoma 6 (Bcl-6), interleukin-21 (IL-21), chemokine receptor type 5 (CXCR5), and B-cell-activating factor belonging to the TNF family (BAFF). Tfh cell response was upregulated in both renal graft and spleen of the CAN group compared to the control group. However, Tfh cell response of the spleen was weaker than that of the graft, which was possibly related to the upregulation of splenic Treg activation. Also, the difference between two tissues was partially associated with the different expressions of tristetraprolin (TTP)/IL-10. Our data help improve our understanding of the role of Tfh cell response in the body with CAN and may provide a valuable clue for better treatment of CAN.

Keywords: Tfh cell response, Chronic allograft nephropathy (CAN), Renal graft, Spleen

Introduction

Despite renal transplantation as the preferred method of effectively advancing the survival of patients with endstage renal disease1, the long-term effectiveness of grafts remains the major challenge for clinicians and researchers due to the effects of chronic allograft nephropathy (CAN)2.

The CAN-induced renal allograft failure is primarily due to T- and B-cell-mediated immune injury3. Follicular helper T (Tfh) cells are necessary for B-cell differentiation and production of immunoglobulin G (IgG) isotype-switched alloantibodies in germinal centers (GCs) with active immune responses4,8. Some recent studies have shown that Tfh cell response plays an important role in the acute rejection after renal transplantation8, but the underlying mechanisms in the status of CAN are not well elucidated yet.

We have recently found that Tfh cells exist in the renal allograft and spleen of CAN rats (Shi et al., unpublished data). On the other hand, Tfh/GC B-cell development and their interaction in Tfh cell response require B-cell lymphoma 6 (Bcl-6), interleukin-21 (IL-21), and some surface signaling molecules such as C-X-C chemokine receptor type 5 (CXCR5) and B-cell-activating factor (BAFF)9,10. We therefore asked if these immunological molecules are similarly or differentially involved in Tfh cell response in the grafts and spleen in the condition of CAN.

Moreover, recent studies show that IL-10 is a key regulatory cytokine that can inhibit the generation of proinflammatory cytokines and control the localization and differentiation of Tfh cells in the secondary lymphoid organs to mediate cardiac transplantation tolerance11. Clinical evidence suggests that a low expression of IL-10 in renal allograft biopsy usually indicates high T-cell infiltration12. Similarly, tristetraprolin (TTP) can offer negative regulation to proinflammatory cytokines, such as tumor necrosis factor (TNF), by degrading their mRNAs in a rat model with chronic renal failure13,16. An increase in TTP enhances the effect of IL-10 on anti-inflammatory response17. Therefore, we also explored whether the Tfh cell response is associated with TTP/IL-10 expression in the graft and spleen with CAN.

Materials and Methods

Subjects

Male, specific pathogen-free Fischer (F344; RT1lv1) and Lewis (LEW; RT1l) rats were purchased from Vital River Laboratories (Beijing, P.R. China). These Fischer and Lewis rats, weighting 250–300 g, were used as kidney donors and recipients, respectively. All rats were fed with standard food and water in air-conditioned rooms at constant temperature and humidity on a 12-h light and 12-h dark cycle. The animal procedures were performed according to the Institutional Ethics Committee of The Third Affiliated Hospital of Soochow University, Jiangsu Province, P.R. China.

CAN Model

To establish the CAN model, kidney transplantation surgery was carried out as described in a previous study18. The rats were anesthetized and had no signs of pain during transplant procedures. The left donor kidney was orthotopically transplanted with end-to-side anastomoses of the renal artery and vein. The right native kidney of the recipient was removed on the 10th day posttransplantation. Cyclosporin A (CsA; Novartis, Basel, Switzerland) is a calcineurin inhibitor and can decline acute rejection rates after renal transplantation. All recipients received 10 mg/kg/day CsA for the first 10 days after renal transplantation, and then switched to 0.5 mg/kg/day CsA from day 11 to week 8. Recent studies have shown that the rat recipients have typical symptoms, and the renal grafts show pathological changes of CAN at 8 weeks after transplantation19. Syngeneic Lewis–Lewis grafts were used as the normal control (NC) group. The grafts and spleens were collected at 8 weeks after surgery. Parts of these tissue samples were snap frozen in liquid nitrogen and stored at −80°C for mRNA or protein analysis. Other renal and spleen tissues were fixed in 4% paraformaldehyde (PFA; Amresco, Solon, OH, USA) for pathological examination.

Histopathology Assessment

The paraffin-embedded tissues were cut into 4-μm-thick sections. After dewaxing, the kidneys were stained with periodic acid–Schiff (PAS; Nanjing Jiancheng Bioengineering Institute, Nanjing, P.R. China), and the spleens were stained with hematoxylin and eosin (H&E; Nanjing Jiancheng Bioengineering Institute, Nanjing, P.R. China). All slides were assessed by pathologists in a double-blind review.

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Total RNA was extracted and purified from kidney and spleen tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using the PrimeScriptTM RT Reagent Kit (Takara, Kusatsu, Shiga, Japan) according to the manufacturer's instructions. The mRNA levels were detected by quantitative realtime polymerase chain reaction (qRT-PCR) using the SYBR® Premix Ex TaqTM Kit (Takara) and the Prism 7500 RT-PCR System (Applied Biosystems, Foster City, CA, USA). The following cycling conditions were used: 95°C for 30 s, 95°C for 5 s, 60°C for 34 s (40 cycles). qRT-PCR was performed three times. The expression of Bcl-6, IL-21, CXCR5, BAFF, IL-17, and forkhead box P3 (Foxp3) was normalized to the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) signal. The primers used are listed in Table 1.

Table 1.

Primers Used in This Work

Gene Primer Sequence
Bcl-6 Sense 5′-CACCACCAGCCTCTTATCCG-3′
Antisense 5′-GGGGCATCTCGTAGTTCCTC-3′
IL-21 Sense 5′-AGGACCCTTGTCTGTCTGATACTC-3′
Antisense 5′-ACATTGCCCCTTTACATCTTGT-3′
CXCR5 Sense 5′-CCTGGTGTTATGTGGGAGTGGT-3′
Antisense 5′-CGAAGGTGTAGAGCATGGGATT-3′
BAFF Sense 5′-AGCTACCGAAGTTCAGCGACAC-3′
Antisense 5′-TCATGGTGAGAAGCATGGCAGT-3′
IL-17 Sense TACCTCAACCGTTCCACTTCACC
Antisense GCACTTCTCAGGCTCCCTCTTC
Foxp3 Sense TCACCTATGCCACCCTCATCC
Antisense CTTGCGAAACTCAAATTCATCTACG
GAPDH Sense 5′-ACCACAGTCCATGCCATCAC-3′
Antisense 5′-TCCACCACCCTGTTGCTGTA-3′
Open in a new tab

Western Blot Analysis

Samples of kidney and spleen were homogenized in a protein extraction buffer (KeyGEN, Nanjing, P.R. China). The total protein content was determined using the bicinchoninic acid assay (BCA) method, and proteins were then heated at 100°C for 5 min. Protein (50 μg) (each sample) was subjected to a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred onto a polyvinylidene difluoride (PVDF; Merck Millipore, Darmstadt, Germany) membrane. The PVDF membrane was blocked with 5% (w/v) nonfat powdered milk (BD Pharmingen, Franklin Lakes, NJ, USA) in Tris-buffered saline containing 0.1% (v/v) Tween 20 (TBST; Amresco) for 1 h at room temperature (RT) and then incubated overnight at 4°C with antibodies diluted in the blocked buffer (BD Pharmingen). The primary antibodies we used were Bcl-6 (1:1,000 dilution; Santa Cruz Biotechnology, Dallas, TX, USA), IL-21 (1:500 dilution; Santa Cruz Biotechnology), TTP (1:200 dilution; Santa Cruz Biotechnology), and IL-10 (1:1,000 dilution; Santa Cruz Biotechnology). Afterward, the membrane was washed repeatedly with TBST and incubated with horseradish peroxidase (HRP)-labeled secondary antibody (1:10,000 dilution; Bioworld, Dublin, OH, USA) at RT for 1 h. Hybridizing binds were generated using Pierce® ECL substrate (Thermo Fisher Scientific, Waltham, MA, USA). The signals were imaged and analyzed by a Molecular Imager Chemi Doc XRS Imaging System (Bio-Rad, Berkeley, CA, USA). These measured protein levels were normalized to GAPDH as the internal control.

Statistical Analysis

Data are shown as mean ± standard deviation (SD). SPSS 13.0 software (IBM, Armonk, NY, USA) was used for statistical analysis. Comparisons between the two groups were performed using the t-test. A value of p < 0.05 was accepted as statistically significant.

Results

Histological Evaluation

The rat CAN model was successfully established. As shown in Figure 1, the graft tissues with CAN presented tubular atrophy, glomerulopathy, and interstitial infiltration of lymphocytes or mononuclear cells. The spleens with CAN showed enlarged splenic nodules and a discernible increase in lymphocytes and neutrophils (Fig. 2), while the control group did not present these pathological changes.

Figure 1.

Figure 1.

Open in a new tab

Periodic acid–Schiff (PAS) staining shows renal histopathological changes (n = 3). Scale bars: 100 μm. Arrows indicate obvious pathological changes. Magnification: 200×. Note: Significantly severe tubule damage, lymphocytes, or mononuclear cell infiltration in the chronic allograft nephropathy (CAN) rats, but not in the normal control (NC) individuals.

Figure 2.

Figure 2.

Open in a new tab

Hematoxylin and eosin (H&E) staining shows spleen histological changes (n = 3). Scale bars: 100 μm. The arrow indicates apparent pathological injury. Magnification: 200×. Note: Significant structure swelling and elevated number of lymphocytes and neutrophils in the CAN group, but not in the NC group.

Differential Expression of Bcl-6 and IL-21 between the Renal Graft and Spleen with CAN

Since both Bcl-6 and IL-21 are crucial for Tfh cell and B-cell activation in Tfh cell response20, we therefore detected these molecules in the renal graft and spleen and compared their expression between these two tissues. As shown in Figure 3A and B, Bcl-6 and IL-21 mRNA levels were all higher in the graft (Fig. 3A) and spleen (Fig. 3B) of the CAN group compared to their levels in the NC group. The results of the data comparison demonstrated that the spleen contained lower mRNA and protein levels of Bcl-6 and IL-21 than the graft in the CAN group (Fig. 3C and D).

Figure 3.

Figure 3.

Open in a new tab

Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of B-cell lymphoma 6 (Bcl-6) and inter-leukin-21 (IL-21) mRNA levels (n = 3). (A) Bcl-6 and IL-21 mRNA expressions in renal graft. (B) Bcl-6 and IL-21 mRNA expressions in the spleen. (A, B) **p < 0.01, ***p < 0.001 versus NC group. (C) Comparison of Bcl-6 and IL-21 mRNA levels between the renal graft and spleen of the CAN group. (D) Comparison of Bcl-6 and IL-21 protein levels between the renal graft and spleen of the CAN group. (C, D) *p < 0.05, ***p < 0.001 versus renal graft. Note that significantly increased expression of Bcl-6 and IL-21 was detected in the CAN group compared to the NC group; the spleen had lower Bcl-2 and IL-21 levels than the graft during CAN.

Different Expressions of CXCR5 and BAFF between the Renal Graft and Spleen with CAN

Since the Tfh cell/B-cell combination and the initiation of GC response are dependent on their surface costimulatory signals like CXCR5 and BAFF21,23, we next analyzed the mRNA levels of CXCR5 and BAFF between these two tissues in the CAN group. Interestingly, we found lower CXCR5 and BAFF levels in the spleen than those in the graft (Fig. 4).

Figure 4.

Figure 4.

Open in a new tab

Comparison of C-X-C chemokine receptor 5 (CXCR5) and B-cell-activating factor (BAFF) mRNA levels between the renal graft and spleen with CAN using qRT-PCR (n = 3). Note that lower CXCR5 and BAFF levels were observed in the spleen than those in the graft of the CAN group. ***p < 0.001 versus renal graft.

Increased Foxp3 but no Change of IL-17 Levels in the Spleen of CAN

Recent studies have disclosed that Tfh cells can mediate the generation and function of Th17 and regulatory T cells (Tregs) in the spleen of an animal model undergoing allogeneic transplantation24. Moreover, Tfh cell migration into the graft and Tfh cell response in the GC also depend on Th17- and Treg-mediated regulation in the secondary lymphoid structures24,25. IL-17 and Foxp3 are identified as specific markers of Th17 and Tregs, respectively26. Therefore, we further examined the IL-17 and Foxp3 levels in the spleen. As shown in Figure 5, only Foxp3 expression was upregulated, and the level of IL-17 was not changed in the spleen of the CAN group when compared to the NC group.

Figure 5.

Figure 5.

Open in a new tab

qRT-PCR analysis of IL-17 and forkhead box P3 (Foxp3) in the spleen (n = 3). Note that the Foxp3 level was increased, but the IL-17 level was similar in the spleen of the CAN group compared with the NC group. ***p < 0.001 versus NC group.

Differential Expression of TTP/IL-10 in the Renal Graft and Spleen with CAN

Since TTP and IL-10 also affect T-cell responses in the lymphoid structures, we next determined whether the Tfh cell response in the graft and spleen is associated with a change in TTP/IL-10 levels in CAN rats. As expected, disparate results were obtained in these two tissues. As shown in Figure 6, we found that both TTP and IL-10 expressions were downregulated in the graft, but enhanced in the spleen with CAN.

Figure 6.

Figure 6.

Open in a new tab

Western blot analysis of tristetraprolin (TTP) and IL-10 in the renal graft and spleen (n = 3). (A) Representative Western blots of TTP and IL-10 protein in the graft. (B) Quantitation of TTP and IL-10 protein in the graft. (C) Representative Western blots of TTP and IL-10 protein in the spleen. (D) Quantitation of TTP and IL-10 protein in the spleen. *p < 0.05, **p < 0.01 versus the NC group. Note that the levels of TTP and IL-10 were both higher in the graft but lower in the spleen of the CAN group than those of the NC group.

Discussion

This work was the first to compare the expression of immunological molecules involved in Tfh cell response between renal graft and spleen with CAN. Our results suggest that Tfh cell response is active in both the graft and spleen of CAN rats, though it is more active in the former.

Emerging evidence has demonstrated that an imbalance of Tfh cell response in lymphoid structures is related with the pathogenic process of many immune diseases27. Renal Tfh cells were found from renal biopsies in patients with acute rejection after kidney transplantation7. Moreover, our pilot studies have indicated that Tfh cells are present in the follicular structures of both renal graft and spleen (Shi et al., unpublished data). Therefore, it is interesting to compare Tfh cell response between the graft and spleen in the condition of CAN by detecting the expression of some functional molecules that are critically relevant to Tfh cell response.

High Bcl-6 level is indispensable for the initiation and promotion of Tfh cell and B-cell development and their mutual connection in Tfh cell response28. On the other hand, IL-21 can control the CD8+ T-cell expansion and B-cell differentiation in alloreactivity29. IL-21 also induces the promotion of Bcl-6 expression30. We found that both Bcl-6 and IL-21 levels increased in the graft and spleen of the CAN group with their levels being much higher in the former than the latter. Our results suggest that Tfh cell response is likely upregulated in both the graft and spleen during CAN, with the spleen having a weaker response.

Our data also demonstrated that the expression of CXCR5 and BAFF was lower in the spleen compared to that of the renal graft in CAN rats. High CXCR5 levels enable Tfh cells to recognize follicular B cells of secondary lymphoid tissues, which is essential for the acceleration of Tfh cell response31. BAFF is crucial in regulating B-cell maturation, differentiation, and activation, contributing to the outcomes of Tfh cell response to specific antigen stimulation31,33. Recent clinical studies have shown that a high serum BAFF level is correlated with increased incidences of antibody-mediated rejection and graft function injury32. Moreover, blocking BAFF signals leads to neutralizing alloantibody production and improving allograft survival34. Therefore, the relatively low levels of CXCR5 and BAFF also suggest a weaker Tfh cell response in the spleen than that in the renal graft in CAN.

The Tfh cell response is often influenced by Tfh cells' activation and their interaction with Th17 and Tregs in immune diseases24,26. Foxp3-expressing Tregs contribute to renal transplant tolerance by negatively regulating Tfh cells35. Blocking the stimulatory signal of Tfh cells undermines the expansion of alloantigen-specific Tregs in vitro36. An increase in Foxp3 in the spleen of the CAN group suggests that the weaker Tfh cell response in the spleen may be attributed to the elevated immunosuppression of splenic Tregs. More recently, some studies have shown that Th17 assists Tfh cells to play crucial roles in autoimmune diseases with synchronous changes in their quantities and cytokine production37. A high IL-17 level is especially linked to increased immune reactions in GCs, which is the same with the effect of IL-2138. However, we found that the expression of IL-17, unlike IL-21, did not increase in the spleen of the CAN group. This unexpected result suggests that Th17 might have little impact on Tfh cell response in the spleen with CAN. More investigations are needed to clarify the relationship among Tregs, Th17, and Tfh cells in CAN.

IL-10 is an important immunosuppressive factor that exerts diverse effects on T-cell-dependent immune responses39. A deficiency of IL-10 promotes the Tfh cell response in lymphoid structures while preventing the tolerance to allograft11. In addition, the initiation of IL-10's protective effect demands an increase in TTP expression during inflammation or immune injury17. In our study, TTP and IL-10 levels were higher in the spleen but lower in the renal graft of the CAN group when compared to the NC group. The different changes in TTP and IL-10 in these two organs suggest that the immunosuppressive action of TTP and IL-10 is upregulated in the spleen and downregulated in the graft under CAN. Consistent with this notion, the spleen and graft had a major difference in terms of Tfh cell response (i.e., opposite to the alteration in TTP and IL-10 levels). These results suggest that there may be a TTP/IL-10-mediated inhibition on Tfh cell response in the spleen and graft of the body with CAN.

Taken together, our data, for the first time, demonstrate that Tfh cell response is upregulated in both the graft and spleen of the CAN model, with a weaker response in the latter. The difference between these two tissues may be attributed to differential regulation of Tregs, TTP, and IL-10 under CAN. These novel results help us better understand the mechanism of Tfh cell-mediated immune response in the pathogenesis of CAN and may shed light on new therapeutic strategies against the immunological damage in CAN.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Grant No. 81273267), the Memorial Hermann's Foundation, and the Vivian L Smith Neurologic Foundation. The authors declare no conflicts of interests.

References

  • 1.Bhatti A.B., Usman M.. Chronic renal transplant rejection and possible anti-proliferative drug targets. Cureus 2015; 7(11): e376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Lukenda V., Mikolasevic I., Racki S., Jelic I., Stimac D., Orlic L.. Transient elastography: A new noninvasive diagnostic tool for assessment of chronic allograft nephropathy. Int Urol Nephrol. 2014; 46(7): 1435–40. [DOI] [PubMed] [Google Scholar]
  • 3.Kamburova E.G., Koenen H.J., van den Hoogen M.W., Baas M.C., Joosten I., Hilbrands L.B.. Longitudinal analysis of T and B cell phenotype and function in renal transplant recipients with or without rituximab induction therapy. PLoS One 2014; 9(11): e112658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Tangye S.G., Ma C.S., Brink R., Deenick E.K.. The good, the bad and the ugly-TFH cells in human health and disease. Nat Rev Immunol. 2013; 13(6): 412–26. [DOI] [PubMed] [Google Scholar]
  • 5.Shi W., Li X., Cha Z., Sun S., Wang L., Jiao S., Yang B., Shi Y., Wang Z., Wu Z., Dai G.. Dysregulation of circulating follicular helper T cells in nonsmall cell lung cancer. DNA Cell Biol. 2014; 33(6): 355–60. [DOI] [PubMed] [Google Scholar]
  • 6.Slight S.R., Rangel-Moreno J., Gopal R., Lin Y., Fallert-Junecko B.A., Mehra S., Selman M., Becerril-Villanueva E., Baquera-Heredia J., Pavon L., Kaushal D., Reinhart T.A., Randall T.D., Khader S.A.. CXCR5(+) T helper cells mediate protective immunity against tuberculosis. J Clin Invest. 2013; 123(2): 712–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Carla C.B., Gretchen N.G., Karin B.. T follicular helper cells in transplantation: The target to attenuate antibody-mediated allogeneic responses? Curr Transpl Rep. 2014; 1(3): 166–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kim E.J., Kwun J., Gibby A.C., Hong J.J., Farris A.B. 3rd, Iwakoshi N.N., Villinge F., Kirk A.D., Knechtle S.J.. Costimulation blockade alters germinal center responses and prevents antibody-mediated rejection. Am J Transplant. 2014; 14(1): 59–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Morris M.C., Kozara K., Salamone F., Benoit M., Pichichero M.E.. Adenoidal follicular T helper cells provide stronger B-cell help than those from tonsils. Laryngoscope 2016; 126(2): E80–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Krejsek J., Kolackova M., Lindrova I., Slezak R., Andrys C.. Increase of intracellular in B cells of Sjogren's patients is not affected by decrease of BAFFR. Acta Medica (Hradec Kralove) 2015; 58(1): 25–31. [DOI] [PubMed] [Google Scholar]
  • 11.Lal G., Kulkarni N., Nakayama Y., Singh A.K., Sethi A., Burrell B.E., Brinkman C.C., Iwami D., Zhang T., Hehlgans T., Bromberg J.S.. IL-10 from marginal zone precursor B cells controls the differentiation of Th17, Tfh and Tfr cells in transplantation tolerance. Immunol Lett. 2016; 170: 52–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Khan F., Sar A., Gonul I., Benediktsson H., Doulla J., Yilmaz S., Berka N.. Graft inflammation and histologic indicators of kidney chronic allograft failure: Low-expressing interleukin-10 genotypes cannot be ignored. Transplantation 2010; 90(6): 630–8. [DOI] [PubMed] [Google Scholar]
  • 13.Kratochvill F., Gratz N., Qualls J.E., Van De Velde L.A., Chi H., Kovarik P., Murray P.J.. Tristetraprolin limits inflammatory cytokine production in tumor-associated macrophages in an mRNA decay-independent manner. Cancer Res. 2015; 75(15): 3054–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Qiu L.Q., Lai W.S., Bradbury A., Zeldin D.C., Blackshear P.J.. Tristetraprolin (TTP) coordinately regulates primary and secondary cellular responses to proinflammatory stimuli. J Leukoc Biol. 2015; 97(4): 723–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Patial S., Curtis A.D. 2nd, Lai W.S., Stumpo D.J., Hill G.D., Flake G.P., Mannie M.D., Blackshear P.J.. Enhanced stability of tristetraprolin mRNA protects mice against immune-mediated inflammatory pathologies. Proc Natl Acad Sci USA 2016; 113(7): 1865–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Patial S., Stumpo D.J., Young W.S. 3rd, Ward J.M., Flake G.P., Blackshear P.J.. Effects of combined tristetraprolin/tumor necrosis factor receptor deficiency on the splenic transcriptome. Mol Cell Biol. 2016; 36(9): 1395–411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Schaljo B., Kratochvill F., Gratz N., Sadzak I., Sauer I., Hammer M., Vogl C., Strobl B., Müller M., Blackshear P.J., Poli V., Lang R., Murray P.J., Kovarik P.. Tristetraprolin is required for full anti-inflammatory response of murine macrophages to IL-10. J Immunol. 2009; 183(2): 1197–206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lu Y.P., Chen W.G., Wang I., Li Y.P.. A new rat model of transplant arteriosclerosis accelerated by ischemia/reperfusion injury. Transplant Proc. 2003; 35(1): 184–6. [DOI] [PubMed] [Google Scholar]
  • 19.Luo L., Sun Z., Wu W., Luo G.. Mycophenolate mofetil and FK506 have different effects on kidney allograft fibrosis in rats that underwent chronic allograft nephropathy. BMC Nephrol. 2012; 13: 53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Park H.J., Kim D.H., Lim S.H., Kim W.J., Youn J., Choi Y.S., Choi J.M.. Insights into the role of follicular helper T cells in autoimmunity. Immune Netw. 2014; 14(1): 21–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Havenar-Daughton C., Lindqvist M., Heit A., Wu J.E., Reiss S.M., Kendric K., Bélanger S., Kasturi S.P., Landais E., Akondy R.S., McGuire H.M., Bothwell M., Vagefi P.A., Scully E. IAVI Protocol C Principal Investigators, Tomaras GD, Davis MM, Poignard P, Ahmed R, Walker BD, Pulendran B, McElrath MJ, Kaufmann DE, Crotty S. CXCL13 is a plasma biomarker of germinal center activity. Proc Natl Acad Sci USA 2016; 113(10): 2702–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Coquery C.M., Loo W.M., Wade N.S., Bederman A.G., Tung K.S., Lewis J.E., Hess H., Erickson L.D.. BAFF regulates follicular helper t cells and affects their accumulation and interferon-γ production in autoimmunity. Arthritis Rheumatol. 2015; 67(3): 773–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chen M., Lin X., Liu Y., Li Q., Deng Y., Liu Z., Brand D., Guo Z., He X., Ryffel B., Zheng S.G.. The function of BAFF on T helper cells in autoimmunity. Cytokine Growth Factor Rev. 2014; 25(3): 301–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lal G., Kulkarni N., Nakayama Y., Singh A.K., Sethi A., Burrell B.E., Brinkman C.C., Iwami D., Zhang T., Hehlgans T., Bromberg J.S.. IL-10 from marginal zone precursor B cells controls the differentiation of Th17, Tfh and Tfr cells in transplantation tolerance. Immunol Lett. 2016; 170: 52–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mesquita D. Jr, Cruvinel W.M., Resende L.S., Mesquita F.V., Silva N.P., Câmara N.O., Andrade L.E.. Follicular helper T cell in immunity and autoimmunity. Braz J Med Biol Res. 2016; 49(5): e5209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen Z., Guo M., Song G., Gao J., Zhang Y., Jing Z., Liu T., Dong C.. Schisandrin B inhibits Th1/Th17 differentiation and promotes regulatory T cell expansion in mouse lymphocytes. Int Immunopharmacol. 2016; 35: 257–64. [DOI] [PubMed] [Google Scholar]
  • 27.Mesquita D. Jr, Cruvinel W.M., Resende L.S., Mesquita F.V., Silva N.P., Câmara N.O., Andrade L.E.. Follicular helper T cell in immunity and autoimmunity. Braz J Med Biol Res. 2016; 49(5): e5209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Andersson K.M., Brisslert M., Cavallini N.F., Svensson M.N., Welin A., Erlandsson M.C., Ciesielski M.J., Katona G., Bokarewa M.I.. Survivin co-ordinates formation of follicular T-cells acting in synergy with Bcl-6. Oncotarget 2015; 6(24): 20043–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Avery D.T., Deenick E.K., Ma C.S., Suryani S., Simpson N., Chew G.Y., Chan T.D., Palendira U., Bustamante J., Boisson-Dupuis S., Choo S., Bleasel K.E., Peake J., King C., French M.A., Engelhard D., Al-Hajjar S., Al-Muhsen S., Magdorf K., Roesler J., Arkwright P.D., Hissaria P., Riminton D.S., Wong M., Brink R., Fulcher D.A., Casanova J-L, Cook M.C., Tangye S.G.. B cell-intrinsic signaling through IL-21 receptor and STAT3 is required for establishing long-lived antibody responses in humans. J Exp Med. 2010; 207(1): 155–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Recher M., Berglund L.J., Avery D.T., Cowan M.J., Gennery A.R., Smart J., Peake J., Wong M., Pai S.Y., Baxi S., Walter J.E., Palendira U., Tangye G.A., Rice M., Brothers S., Al-Herz W., Oettgen H., Eibel H., Puck J.M., Cattaneo F., Ziegler J.B., Giliani S., Tangye S.G., Notarangelo L.D.. IL-21 is the primary common g chain-binding cytokine required for human B-cell differentiation in vivo. Blood 2011; 118(26): 6824–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tangye S.G., Ma C.S., Brink R., Deenick E.K.. The good, the bad and the ugly—TFH cells in human health and disease. Nat Rev Immunol. 2013; 13(6): 412–26. [DOI] [PubMed] [Google Scholar]
  • 32.Banham G., Prezzi D., Harford S., Taylor C.J., Hamer R., Higgins R., Bradley J.A., Clatworthy M.R.. Elevated pretransplantation soluble BAFF is associated with an increased risk of acute antibody-mediated rejection. Transplantation 2013; 96(4): 413–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Banham G.D., Clatworthy M.R.. B-cell biomarkers in transplantation—From genes to therapy. Tissue Antigens 2015; 85(2): 82–92. [DOI] [PubMed] [Google Scholar]
  • 34.Kwun J., Page E., Hong J.J., Gibby A., Yoon J., Farris A.B., Villinger F., Knechtle S.. Neutralizing BAFF/APRIL with atacicept prevents early DSA formation and AMR development in T cell depletion induced nonhuman primate AMR model. Am J Transplant. 2015; 15(3): 815–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Shrestha S., Yang K., Guy C., Vogel P., Neale G., Chi H.. Treg cells require the phosphatase PTEN to restrain TH1 and TFH cell responses. Nat Immunol. 2015; 16(2): 178–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zheng J., Chan P.L., Liu Y., Qin G., Xiang Z., Lam K.T., Lewis D.B., Lau Y.L., Tu W.. ICOS regulates the generation and function of human CD4+ Treg in a CTLA-4 dependent manner. PLoS One 2013; 8(12): e82203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Zhang Y., Li Y., Lv T.T., Yin Z.J., Wang X.B.. Elevated circulating Th17 and follicular helper CD4(+) T cells in patients with rheumatoid arthritis. APMIS 2015; 123(8): 659–66. [DOI] [PubMed] [Google Scholar]
  • 38.Wichner K., Stauss D., Kampfrath B., Krüger K., Müller G., Rehm A., Lipp M., Höpken U.E.. Dysregulated development of IL-17- and IL-21-expressing follicular helper T cells and increased germinal center formation in the absence of RORγt. FASEB J. 2016; 30(2): 761–74. [DOI] [PubMed] [Google Scholar]
  • 39.Wang S., Gao X., Shen G., Wang W., Li J., Zhao J., Wei Y.Q., Edwards C.K.. Interleukin-10 deficiency impairs regulatory T cell-derived neuropilin-1 functions and promotes Th1 and Th17 immunity. Sci Rep. 2016; 6: 24249. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cell Transplantation are provided here courtesy of SAGE Publications

RESOURCES