Abstract
Twenty-three isolates of Pasteurella multocida were tested for susceptibility to six aminoglycoside agents and screened by polymerase chain reaction for the presence of aminoglycoside resistance genes. In addition, mutations in the resistance-determining region of strains showing a high level of induced resistance to spectinomycin strains were examined. Susceptibility testing showed that all of the isolates were resistant to at least two types of aminoglycosides, and that the most effective antimicrobial was spectinomycin. The resistance genes aphA1, strB and aacA4 were present in all 23 isolates. In the three induced spectinomycin-resistant strains, a 9-bp deletion in rpsE that encodes ribosomal protein S5 was detected.
Keywords: aminoglycoside resistance, mutations, Pasteurella multocida
Pasteurella multocida is one of the most prevalent pathogens responsible for bovine respiratory disease. It is an opportunistic pathogen that generally inhabits the upper respiratory tract [6, 18]. Aminoglycosides have been used clinically against gram-negative bacteria for many years [14]. Despite increasing resistance, aminoglycoside use to control bovine respiratory disease resulting from P. multocida infections continues. The mechanisms underlying aminoglycoside resistance have been reported for many bacteria [1, 7, 8]. However, the aminoglycoside resistance status of P. multocida isolates in China has rarely been reported [19]. Aminoglycoside resistance genes such as strA, strB, aadA14, aphA1, aadB and aadA25 have been reported in P. multocida or other members of the family Pasteurellaceae, and these genes are believed to play an important role in aminoglycoside resistance [5, 12, 15]. In addition to aminoglycoside-modifying enzymes, high-level resistance to spectinomycin often results from mutations in the 16S ribosomal ribonucleic acid (rRNA) and/or rpsE, which encodes ribosomal protein S5 [3, 11, 21]. In the current study, we investigated the aminoglycoside resistance status and prevalence of aminoglycoside resistance genes in 23 P. multocida isolates from eight provinces in China. Furthermore, we identified a new mutation in rpsE in strains with a high level of induced spectinomycin resistance.
Twenty-three P. multocida field isolates (designated Pm1 to Pm23) were obtained from nasal swabs or lungs from cattle on 23 farms located in eight provinces of China (Jilin, Heilongjiang, Neimenggu, Liaoning, Shandong, Hebei, Henan and Jiangsu) from 2011 to 2014. The isolates were identified as described previously [13]. These P. multocida strains were routinely cultured in brain heart infusion (BHI, Oxoid, Cambridge, U.K.) broth or on BHI agar at 37°C. Isolates were tested for susceptibility to six aminoglycosides (gentamicin [GEN], kanamycin [KAN], spectinomycin [SPT], streptomycin [SM], amikacin ([AMK], neomycin ([NEO]) using the broth microdilution method according to the Clinical and Laboratory Standards Institute guidelines in VET01-A4 [2]. The reference strain Escherichia coli ATCC 25922 served as quality control in the antimicrobial susceptibility tests, and each experiment was repeated three times. Three strains (Pm-1, Pm-3 and Pm-5) were randomly selected for in vitro induction of highly SPT-resistant mutants. SPT-resistant mutants were obtained by plating the bacteria on a medium supplemented with increasing concentrations of SPT, as described previously [20]. Briefly, P. multocida strains were grown in BHI broth to the log phase, and then the strains were plated on BHI agar plates with an SPT concentration gradient ranging from a subinhibitory level to a concentration two times the minimal inhibitory concentration (MIC). Bacterial cells from a plate with a lower antibiotic concentration were used to seed a plate containing a higher concentration of SPT. The procedure was repeated until a final concentration was 512 µg/ml was reached. Chromosomal deoxyribonucleic acid (DNA) was extracted from freshly cultured P. multocida. Briefly, the bacterial cells were transferred to a microcentrifuge tube containing 500 µl of Tris-EDTA (TE) buffer, followed by centrifugation at 12,000 rpm for 2 min. After the supernatant was discarded, the pellet was resuspended in 200 µl of TE buffer, heated in a 100°C water bath for 10 min to release the DNA, and then centrifuged. All of the primers used to amplify the gene fragments are listed in Table 1. The primers used to amplify aminoglycoside-resistant genes were based on the P. multocida whole genome sequence in GenBank (accession no. CP003022), and the primers used for the six 16S rRNA and rpsE were previously described [11]. Polymerase chain reaction (PCR) was performed in a 25 µl reaction volume containing 2.5 µl 10× PCR buffer, 0.5 mmol L−1 dNTP, 0.5 µmol L−1 each primer, 15.6 µl PCR water, and 1 U ExTaq polymerase (Takara, Otsu, Japan). A homology analysis of nucleotide sequences was performed using nucleotide-nucleotide BLAST (BLASTN).
Table 1. Primers used in the study.
| Primer | Sequence (5′–3′) | Reference | Annealing temp (°C) | Product (bp) |
|---|---|---|---|---|
| strA Pm-fw | ATCGCAGATAGAAGGCAAGGC | This study | 55 | 574 |
| strA Pm-rv | AACTGGCAGGAGGAACAGGA | This study | ||
| strB Pm-fw | GCGTTGCTCCTCTTCTCCAT | This study | 54 | 723 |
| strB Pm-rv | ACCTTTTCCAGCCTCGTTTG | This study | ||
| aadB Pm-fw | CAACGCAGGTCACATTGATACAC | This study | 55 | 418 |
| aadB Pm-rv | ACTGGTGGTACTTCATCGGCATA | This study | ||
| aadA25 Pm-fw | ACTATCAGAGGTGCTAAGCGTCAT | This study | 55 | 724 |
| aadA25 Pm-rv | CACGTAGTGAACAAATTCTTCCAAC | This study | ||
| aphA1 Pm-fw | AAAGCCGTTTCTGTAATGAAGGAG | This study | 55 | 642 |
| aphA1 Pm-rv | GGCAATCAGGTGCGACAATCT | This study | ||
| aacA4 Pm-fw | CTCGAATGCCTGGCGTGTTT | This study | 59 | 482 |
| aacA4 Pm-rv | TTGCGATGCTCTATGAGTGGCTA | This study | ||
| aadA14 Pm-fw | TCACTTGTTTGGTTCCGCAGT | [4] | 60 | 642 |
| aadA14 Pm-rv | TCTTTCGGATAAGCTGCCAGA | [4] | ||
| 16S RNA PmA-fw | GAGATAGTAGATACACCTCGCGTCG | [5] | 60 | 1,740 |
| 16S RNA PmB-fw | TGGATAGAGCGTTGGCCTCC | [5] | 62 | 1,976 |
| 16S RNA PmC-fw | CGCCTTGGCAGTCAATTCAG | [5] | 58 | 2,179 |
| 16S RNA PmD-fw | TCACAGGTGGAGAAACAGATACCA | [5] | 60 | 2,055 |
| 16S RNA PmE-fw | TGTGGTCAATTGAGTAATGCCTG | [5] | 62 | 2,091 |
| 16S RNA PmF-fw | CTATGTATTAGAGTCCATTGCGGATCT | [5] | 60 | 1,935 |
| 16S RNA Pm-rv | AGGAGGTGATCCAACCGCAG | [5] | ||
| rpsE PmS5-fw | TGCATATGGCGAAGACCAAG | [5] | 55 | 862 |
| rpsE PmS5-rw | AAGTGATTGCACCGAACGG | [5] |
The MICs of the six aminoglycosides against the P. multocida isolates are presented in Table 2. All 23 P. multocida isolates were resistant to AMK and showed 100% non-susceptibility to NEO and KAN. Twelve of the 23 isolates (52.2%) were resistant to SM, and only 13.0% (3/23) were susceptible to this antibiotic. All of the isolates were susceptible to SPT and all of the isolates except four strains showed intermediate susceptibility to GEN. Further analysis of the MICs revealed that six strains were resistant to two aminoglycosides, and 17 isolates (74.0%) were resistant to at least three aminoglycosides. The three induced SPT-resistant strains showed no effect on the MICs of other aminoglycosides.
Table 2. Aminoglycosides susceptibilitya) and MIC (µg/ml) of the P. multocida isolates.
| Antimicrobial agentsb) | GEN | SM | SPT | NEO | AMK | KAN |
|---|---|---|---|---|---|---|
| Pm-1 | I (8) | R (32) | S (4) | R (128) | R (128) | R (64) |
| Pm-2 | I (8) | R (32) | S (16) | R (128) | R (256) | R (32) |
| Pm-3 | I (8) | R (32) | S (16) | R (128) | R (256) | I (16) |
| Pm-4 | I (8) | I (16) | S (8) | R (128) | R (64) | I (16) |
| Pm-5 | S (4) | I (16) | S (4) | R (64) | R (128) | R (64) |
| Pm-6 | I (8) | I (16) | S (8) | R (64) | R (128) | R (64) |
| Pm-7 | I (8) | S (1) | S (4) | R (128) | R (64) | R (64) |
| Pm-8 | S (1) | R (32) | S (4) | R (128) | R (128) | I (16) |
| Pm-9 | I (8) | I (16) | S (0.5) | I (32) | R (256) | R (32) |
| Pm-10 | I (8) | R (32) | S (4) | R (128) | R (128) | R (64) |
| Pm-11 | I (8) | R (32) | S (4) | R (128) | R (64) | R (32) |
| Pm-12 | I (8) | R (32) | S (4) | R (128) | R (128) | R (64) |
| Pm-13 | I (8) | R (32) | S (4) | R (128) | R (128) | R (64) |
| Pm-14 | S (1) | R (32) | S (4) | R (128) | R (128) | I (16) |
| Pm-15 | I (8) | I (16) | S (0.5) | I (32) | R (256) | R (32) |
| Pm-16 | S (1) | R (32) | S (4) | R (128) | R (128) | I (16) |
| Pm-17 | I (8) | R (32) | S (4) | R (128) | R (64) | R (32) |
| Pm-18 | I (8) | I (16) | S (8) | R (128) | R (64) | I (16) |
| Pm-19 | I (8) | I (16) | S (8) | R (128) | R (64) | I (16) |
| Pm-20 | I (8) | I (16) | S (0.5) | I (32) | R (256) | R (32) |
| Pm-21 | I (8) | R (32) | S (4) | R (128) | R (128) | R (64) |
| Pm-22 | I (8) | S (1) | S (4) | R (128) | R (64) | R (64) |
| Pm-23 | I (8) | S (1) | S (4) | R (128) | R (64) | R (64) |
a) GEN=gentamicin; SM=streptomycin; SPT=spectinomycin; NEO=neomycin; AMK=amikacin; KAN=kanamycin; R=resistant; I=intermediate; S=susceptible. b) Cut-off values used were those described in CLSI document VET01-S2 and elsewhere [14].
This study is the first report on aminoglycoside resistance of P. multocida in bovines in China. However, the number of strains in this study was small, and the rate of resistance was higher than that in other reports. Aminoglycoside resistance is emerging worldwide. Jamali et al. showed that, from 2012 to 2013, 169 P. multocida strains from cattle were frequently resistant to SM (22%) [9]. Katsuda et al. showed that, of 378 P. multocida isolates from clinically healthy and diseased calves, 9% were resistant to KAN [10]. The animal health division of Germany reported that, of 231 P. multocida isolates from cattle, 3% showed resistance to SPT between 2002 and 2006 [4]. In this study, SPT was the most effective antimicrobial agent against clinical P. multocida strains. Whether SPT can be used for the treatment of P. multocida infection in China is an important question. However, because the number of isolates in this study was small, and, therefore, these samples were not representative, a large-scale survey should be conducted to answer this question.
According to the National Center for Biotechnology Information database (accession nos. NG_047288.1, AP014637.1 and CP021856.1), only three aminoglycoside-resistant genes, strB (aminoglycoside 6’-phosphotransferase), aphA1 (aminoglycoside 3′-phosphotransferase III), and aacA4 (aminoglycoside adenylyltransferase), were detected in all 23 P. multocida isolates. However, there were none of the other examined resistance genes in any P. multocida isolates. The results of a previous study suggested that strains harboring strB generally were resistant to SM, whereas strains harboring aphA1 generally showed resistance to KAN, AMK and NEO, and strains harboring aacA4 generally were resistant to GEN [14]. We doubt that the three resistance genes were expressed at different levels in the isolates with different resistances; however, the relationship between MICs and the expression of resistance genes should be explored in the future. Among the known mechanisms of resistance to aminoglycosides, the most prevalent is enzyme modification, and many enzymes have been detected in clinical strains [16, 17]. However, few aminoglycoside-modified enzymes in P. multocida have been reported. Michael et al. analyzed an 82-kb integrative element of a multi-drug resistant P. multocida 36950 in 2011. It harbored five aminoglycoside resistance genes, aadA25, strA, strB, aadB and aphA1 [15]. In 2015, a similar element that contained strA, strB and aphA1 genes was identified in Mannheimia haemolytica [5]. In addition, this element has been shown to be easily transmitted to P. multocida, leading to the acquisition of resistance. However, in our examination of aminoglycoside resistance genes, we did not discover SPT resistance genes in any of the P. multocida isolates.
In the three strains with high-level induced SPT resistance, no mutations in the six rRNA operons were detected. However, a 9-bp deletion in rpsE, which resulted in the loss of the amino acids Met, Ser and Phe at positions 31 to 33, was present (Fig. 1), but the SPT susceptible isolates did not exhibit mutations in the spectinomycin resistance-determining region (SRDR) of any rRNA operons or rpsE. Thus, the loss of Met, Ser and Phe detected in this study is believed to affect the binding of the mutated S5 protein to the 16S rRNA. Previous research has shown that amino acids 19 to 33 of ribosomal protein S5 form a loop structure that is involved in binding of SPT to the ribosome, causing SPT resistance [3]. Kehrenberg et al. found a 3-bp deletion in rpsE that caused the loss of Lys at position 23 and resulted in a high level of spectinomycin resistance of bovine P. multocida [11]. In this study, we verified another mutation in ribosomal protein S5 in the induced SPT resistance strains. Thus, the loss of the highly conserved amino acids may affect the interactions between the S5 protein and the 16S rRNA.
Fig. 1.
Alignment of nucleotide and amino acid sequences at the 5′ end of rpsE and the corresponding sequences of ribosomal protein S5 in three -induced spectinomycin-resistant strains (D1, D3, D5) and Pm-3. The transparent boxes indicate the altered regions.
In conclusion, we found that 23 clinical isolates of bovine P. multocida from eight provinces of China were resistant to several aminoglycosides, and the aminoglycoside resistance genes aphA1, strB and aacA4 were universally present in the clinical strains. In the high-level induced SPT resistance strains, we found a new mutation in rpsE, which encodes ribosomal protein S5 in P. multocida. These results provide more evidence that mutations in highly conserved positions in ribosomal protein S5 can result in spectinomycin resistance.
Acknowledgments
This research was funded by National Key Research and Development Plan (Grant number: 2016YFD0501301), National Natural Science Foundation of China (Grant number: 31702293), the Science and Technology Development Plan of Jilin Province (Grant number 20170520074JH).
REFERENCES
- 1.Bauskenieks M., Pole I., Skenders G., Jansone I., Broka L., Nodieva A., Ozere I., Kalvisa A., Ranka R., Baumanis V.2015. Genotypic and phenotypic characteristics of aminoglycoside-resistant Mycobacterium tuberculosis isolates in Latvia. Diagn. Microbiol. Infect. Dis. 81: 177–182. doi: 10.1016/j.diagmicrobio.2014.12.004 [DOI] [PubMed] [Google Scholar]
- 2.Clinical and Laboratory Standards Institute 2013. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. approved standard, 4th ed. In: ClSI Document VET01-A4, CLSI, Wayne.
- 3.Davies C., Bussiere D. E., Golden B. L., Porter S. J., Ramakrishnan V., White S. W.1998. Ribosomal proteins S5 and L6: high-resolution crystal structures and roles in protein synthesis and antibiotic resistance. J. Mol. Biol. 279: 873–888. doi: 10.1006/jmbi.1998.1780 [DOI] [PubMed] [Google Scholar]
- 4.de Jong A., Thomas V., Simjee S., Moyaert H., El Garch F., Maher K., Morrissey I., Butty P., Klein U., Marion H., Rigaut D., Vallé M.2014. Antimicrobial susceptibility monitoring of respiratory tract pathogens isolated from diseased cattle and pigs across Europe: the VetPath study. Vet. Microbiol. 172: 202–215. doi: 10.1016/j.vetmic.2014.04.008 [DOI] [PubMed] [Google Scholar]
- 5.Eidam C., Poehlein A., Leimbach A., Michael G. B., Kadlec K., Liesegang H., Daniel R., Sweeney M. T., Murray R. W., Watts J. L., Schwarz S.2015. Analysis and comparative genomics of ICEMh1, a novel integrative and conjugative element (ICE) of Mannheimia haemolytica. J. Antimicrob. Chemother. 70: 93–97. doi: 10.1093/jac/dku361 [DOI] [PubMed] [Google Scholar]
- 6.Ewers C., Lübke-Becker A., Bethe A., Kiebling S., Filter M., Wieler L. H.2006. Virulence genotype of Pasteurella multocida strains isolated from different hosts with various disease status. Vet. Microbiol. 114: 304–317. doi: 10.1016/j.vetmic.2005.12.012 [DOI] [PubMed] [Google Scholar]
- 7.Hu X., Xu B., Yang Y., Liu D., Yang M., Wang J., Shen H., Zhou X., Ma X.2013. A high throughput multiplex PCR assay for simultaneous detection of seven aminoglycoside-resistance genes in Enterobacteriaceae. BMC Microbiol. 13: 58. doi: 10.1186/1471-2180-13-58 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Islam S., Oh H., Jalal S., Karpati F., Ciofu O., Høiby N., Wretlind B.2009. Chromosomal mechanisms of aminoglycoside resistance in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Clin. Microbiol. Infect. 15: 60–66. doi: 10.1111/j.1469-0691.2008.02097.x [DOI] [PubMed] [Google Scholar]
- 9.Jamali H., Rezagholipour M., Fallah S., Dadrasnia A., Chelliah S., Velappan R. D., Wei K. S., Ismail S.2014. Prevalence, characterization and antibiotic resistance of Pasteurella multocida isolated from bovine respiratory infection. Vet. J. 202: 381–383. doi: 10.1016/j.tvjl.2014.07.024 [DOI] [PubMed] [Google Scholar]
- 10.Katsuda K., Hoshinoo K., Ueno Y., Kohmoto M., Mikami O.2013. Virulence genes and antimicrobial susceptibility in Pasteurella multocida isolates from calves. Vet. Microbiol. 167: 737–741. doi: 10.1016/j.vetmic.2013.09.029 [DOI] [PubMed] [Google Scholar]
- 11.Kehrenberg C., Schwarz S.2007. Mutations in 16S rRNA and ribosomal protein S5 associated with high-level spectinomycin resistance in Pasteurella multocida. Antimicrob. Agents Chemother. 51: 2244–2246. doi: 10.1128/AAC.00229-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kehrenberg C., Catry B., Haesebrouck F., de Kruif A., Schwarz S.2005. Novel spectinomycin/streptomycin resistance gene, aadA14, from Pasteurella multocida. Antimicrob. Agents Chemother. 49: 3046–3049. doi: 10.1128/AAC.49.7.3046-3049.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kong L. C., Gao D., Gao Y. H., Liu S. M., Ma H. X.2014. Fluoroquinolone resistance mechanism of clinical isolates and selected mutants of Pasteurella multocida from bovine respiratory disease in China. J. Vet. Med. Sci. 76: 1655–1657. doi: 10.1292/jvms.14-0240 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Magnet S., Blanchard J. S.2005. Molecular insights into aminoglycoside action and resistance. Chem. Rev. 105: 477–498. doi: 10.1021/cr0301088 [DOI] [PubMed] [Google Scholar]
- 15.Michael G. B., Kadlec K., Sweeney M. T., Brzuszkiewicz E., Liesegang H., Daniel R., Murray R. W., Watts J. L., Schwarz S.2012. ICEPmu1, an integrative conjugative element (ICE) of Pasteurella multocida: analysis of the regions that comprise 12 antimicrobial resistance genes. J. Antimicrob. Chemother. 67: 84–90. doi: 10.1093/jac/dkr406 [DOI] [PubMed] [Google Scholar]
- 16.Osuka H., Nakajima J., Oishi T., Funayama Y., Ebihara T., Ishikawa H., Saito K., Koganemaru H., Hitomi S.2016. High-level aminoglycoside resistance in Enterococcus faecalis and Enterococcus faecium causing invasive infection: Twelve-year surveillance in the Minami Ibaraki Area. J. Infect. Chemother. 22: 61–63. doi: 10.1016/j.jiac.2015.09.003 [DOI] [PubMed] [Google Scholar]
- 17.Ramirez M. S., Tolmasky M. E.2010. Aminoglycoside modifying enzymes. Drug Resist. Updat. 13: 151–171. doi: 10.1016/j.drup.2010.08.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Smith R. A.1998. Impact of disease on feedlot performance: a review. J. Anim. Sci. 76: 272–274. doi: 10.2527/1998.761272x [DOI] [PubMed] [Google Scholar]
- 19.Tang X., Zhao Z., Hu J., Wu B., Cai X., He Q., Chen H.2009. Isolation, antimicrobial resistance, and virulence genes of Pasteurella multocida strains from swine in China. J. Clin. Microbiol. 47: 951–958. doi: 10.1128/JCM.02029-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Turkmani A., Psaroulaki A., Christidou A., Chochlakis D., Tabaa D., Tselentis Y.2008. In vitro-selected resistance to fluoroquinolones in two Brucella strains associated with mutational changes in gyrA. Int. J. Antimicrob. Agents 32: 227–232. doi: 10.1016/j.ijantimicag.2008.03.012 [DOI] [PubMed] [Google Scholar]
- 21.Unemo M., Golparian D., Skogen V., Olsen A. O., Moi H., Syversen G., Hjelmevoll S. O.2013. Neisseria gonorrhoeae strain with high-level resistance to spectinomycin due to a novel resistance mechanism (mutated ribosomal protein S5) verified in Norway. Antimicrob. Agents Chemother. 57: 1057–1061. doi: 10.1128/AAC.01775-12 [DOI] [PMC free article] [PubMed] [Google Scholar]