β₂-Adrenoceptor signaling in airway epithelial cells promotes eosinophilic inflammation, mucous metaplasia, and airway contractility

Significance

Activation of β₂-adrenoreceptors (β₂ARs) on airway smooth muscle cells produces airway relaxation, and β₂AR agonists are the most widely used bronchodilators for treating asthma. Paradoxically, murine models show β₂AR activation is also required for expression of cardinal features of the asthma phenotype, including airway hyperresponsiveness (AHR), inflammation, and mucous metaplasia. However β₂ARs are expressed on all the cell types implicated in the pathogenesis and maintenance of asthma, and which cell type(s) control these asthmatic effects is unknown. Here we show activation of β₂AR signaling solely on airway epithelium is sufficient to restore/promote the cardinal features of asthma, including inflammation, mucous metaplasia, and AHR. These studies support the role of the airway epithelium as a master regulator of key features of asthma.

Abstract

The mostly widely used bronchodilators in asthma therapy are β₂-adrenoreceptor (β₂AR) agonists, but their chronic use causes paradoxical adverse effects. We have previously determined that β₂AR activation is required for expression of the asthma phenotype in mice, but the cell types involved are unknown. We now demonstrate that β₂AR signaling in the airway epithelium is sufficient to mediate key features of the asthmatic responses to IL-13 in murine models. Our data show that inhibition of β₂AR signaling with an aerosolized antagonist attenuates airway hyperresponsiveness (AHR), eosinophilic inflammation, and mucus-production responses to IL-13, whereas treatment with an aerosolized agonist worsens these phenotypes, suggesting that β₂AR signaling on resident lung cells modulates the asthma phenotype. Labeling with a fluorescent β₂AR ligand shows the receptors are highly expressed in airway epithelium. In β₂AR^−/− mice, transgenic expression of β₂ARs only in airway epithelium is sufficient to rescue IL-13–induced AHR, inflammation, and mucus production, and transgenic overexpression in WT mice exacerbates these phenotypes. Knockout of β-arrestin-2 (βarr-2^−/−) attenuates the asthma phenotype as in β₂AR^−/− mice. In contrast to eosinophilic inflammation, neutrophilic inflammation was not promoted by β₂AR signaling. Together, these results suggest β₂ARs on airway epithelial cells promote the asthma phenotype and that the proinflammatory pathway downstream of the β₂AR involves βarr-2. These results identify β₂AR signaling in the airway epithelium as capable of controlling integrated responses to IL-13 and affecting the function of other cell types such as airway smooth muscle cells.

The β₂-adrenoreceptor (β₂AR) agonists are the most widely used and effective bronchodilators in asthma, but their chronic use may cause a loss of asthma control and an increase in asthma mortality (1–6). We have shown that a possible explanation for the paradoxical adverse chronic effects of β₂AR agonists is due to β₂AR signaling being required for full expression of the asthma phenotype in mice (7–9). Using both pharmacological and genetic approaches in antigen-driven murine asthma models, we showed that inhibition of β₂AR signaling by administration of certain β₂AR-blockers or by genetic deletion of the β₂AR resulted in a marked reduction of three cardinal features of asthma: airway hyperresponsiveness (AHR), inflammation, and mucous metaplasia (7–10). Furthermore, removal of the endogenous ligand for the β₂AR, epinephrine, again using both pharmacological and genetic approaches, also produced an attenuation of the asthma phenotype (9). These findings were translated to pilot clinical trials that demonstrated chronic treatment with the β-blocker nadolol produced a dose-dependent reduction in AHR (11, 12), although another β-blocker showed no improvement in a different subset of asthmatics (13). Previous murine studies were performed using global deletion of the β₂AR or of the enzyme responsible for epinephrine synthesis and systemic administration of β₂AR antagonists or reserpine (to deplete epinephrine) (8, 9). Therefore, the cell types that were critical in mediating the antigen-driven features of the asthma phenotype remained unknown.

The aim of the present study was to identify the principal cell type and the signaling pathway by which activation of the β₂AR promotes the asthma phenotype (Fig. 1). Our previous studies suggested the airway epithelium might be a key site of β₂AR signaling because inhibition of β₂AR signaling had a greater effect on reducing mucous metaplasia than on inflammation in mouse ovalbumin (OVA) models of asthma. These results suggested that epithelial effector responses are upstream of leukocyte recruitment (7, 8, 10). In this study we used genetic and pharmacological approaches to show an essential role of the airway epithelium in the mediation of the asthma phenotype produced by intratracheal administration of IL-13. Our results demonstrate that both expressing the β₂AR solely on the airway epithelium in mice with systemic deletion of the β₂AR can restore the cardinal features produced by IL-13, and that aerosolized delivery of a hydrophilic β₂AR blocker to WT mice is sufficient to attenuate the response to IL-13 to the same extent as the attenuation of the asthma phenotype produced by systemic β₂AR blocker administration in antigen-driven murine models.

Fig. 1.

Schematic of potential β₂AR signaling in models of asthma. The β₂AR can activate at least two distinct pathways: the canonical Gs-cAMP–mediated pathway and a βarr-2–mediated pathway. The canonical pathway is thought to be responsible for the potent bronchodilator effects of β₂AR agonist by activating β₂ARs on airway smooth muscle cells. However, the βarr-2–mediated pathway has been implicated as proinflammatory in asthma models (15, 16), but the cell type(s) mediating these effects is unknown. The aim of the present study is to test the hypothesis that the airway epithelium may be a main site of action for the proinflammatory effects of β₂AR agonists.

Additionally, the β₂AR has been shown to be able to activate at least two signaling pathways: the canonical Gs-cAMP pathway and a β-arrestin-2 (βarr-2)–dependent pathway (14). Activation of the β₂AR–βarr-2 pathway has been implicated in mediating the cardinal features of asthma in murine models (Fig. 1) (15, 16) and may lead to activation of MAP kinases. In the current study we present evidence that epithelial signaling via β₂AR–βarr-2 mediates development of the IL-13–induced asthma phenotype. Previous studies using global deletion of βarr-2 implicate this pathway as mediating the asthma phenotype in murine antigen-driven models (15). Our results show that selective deletion of βarr-2 in airway epithelium is sufficient to attenuate the IL-13–induced asthma phenotype response.

Last, we show that β₂AR signaling from the airway epithelium does not affect inflammation in neutrophilic models. These data suggest the proinflammatory β₂AR signaling from the airway epithelium selectively modulates eosinophilic inflammation. Taken together, our results suggest β₂AR signaling via a βarr-2 pathway solely on the airway epithelium is sufficient to modulate key features of the asthma phenotype produced by intratracheal administration of IL-13. These results further contribute to the increasing role of the cells that line hollow organs, such as the vascular endothelium, in sensing and coordinating integrated responses to hormones, antigens, or other stimuli.

Results

Topical Administration of β₂AR Ligands Affects Allergic Lung Inflammation.

As an initial exploration of whether the β2AR signals resident or recruited cells to promote allergic inflammation, we exposed mouse lung parenchymal cells directly to IL-13, a key cytokine in allergic asthma (17–20). Intratracheal administration of IL-13 to WT mice induced a marked increase 24 h later in airway epithelial mucin and lung lavage eosinophils, both of which were attenuated in β₂AR^−/− mice (Fig. 2 A and B). This suggested that IL-13 acting directly on lung parenchymal cells requires β₂AR signaling within resident cells because of the short interval between IL-13 instillation and phenotypic assessment. Supporting a lung parenchymal site of β₂AR action, Rag1^−/− mice, which lack all anti-specific lymphocytes that contribute to the asthma phenotype (21, 22), exhibited mucous metaplasia and lung eosinophilia comparable to WT mice in response to IL-13-instillation (Fig. S1), although this does not rule out a role for innate lymphoid cells or other leukocytes (23).

Fig. 2.

Interaction of IL-13 and β₂AR signaling in the lungs of mice. (A) WT and β₂AR^−/− mice were administered 3 µg IL-13 intratracheally, and 24 h later lungs were harvested and stained with PAFS for mucin (Left) or were lavaged and stained with Wright–Giemsa staining for inflammatory cells (Right). (Scale bars: Left, 50 µm; Right, 100 µm.) (B) Epithelial mucin content (Left), lung lavage total cell counts (Center), and lung lavage eosinophil counts (Right) from WT (black bars) and β₂AR^−/− (white bars) mice administered or not administered 3 µg IL-13 intratracheally. (C) Mucin content and lavage cell counts from WT mice treated for 21 d with aerosolized vehicle alone (Veh, black bars) or with 1.5 mg nadolol twice daily (white bars) and administered or not administered 3 µg IL-13 intratracheally. (D) Mucin content and lavage cell counts from WT mice treated for 21 d with aerosolized vehicle alone (black bars) or with 20 µg formoterol twice daily (white bars) and administered or not administered 3 µg IL-13 intratracheally (n = 6–8; error bars show SEM; ****P < 0.0001 compared with the vehicle-treated control group; ^###P < 0.001 and ^####P < 0.0001 compared with WT mice challenged with IL-13). All analyses were performed using two-way ANOVA and Tukey’s multiple comparisons post-hoc test.

Fig. S1.

Direct effect of exogenous IL-13 on lung parenchymal cells in the absence of lymphocytes. WT mice (black bars), Rag1^−/− mice (white bars), or Rag1^−/− mice pretreated twice daily for 21 d with 1.5 mg aerosolized nadolol (gray bars) were administered or not administered 3 µg IL-13 intratracheally. After 24 h, epithelial mucin content (Left), lung lavage total cell counts (Center), and lung lavage eosinophil counts (Right) were measured (n = 6; error bars show SEM; ****P < 0.0001 compared with the vehicle-treated Rag1^−/− group; ^###P < 0.001 and ^####P < 0.0001 compared with Rag1^−/− mice challenged with IL-13). All analyses were performed using two-way ANOVA and Tukey’s multiple comparisons post-hoc test.

To further test local interactions between IL-13 and β₂AR signaling within the lungs, we exposed mice to aerosolized β₂AR ligands at concentrations not likely to have systemic effects. In previous time-course studies in OVA models, the β₂AR antagonist nadolol (250 ppm) when administered in the diet for 7 d partially suppressed and when administered for 28 d strongly suppressed mucous metaplasia (7). To more precisely define the time required for maximal effects of nadolol, a time-course study was performed by assessing mice every 3 d for 28 d. The results showed a plateau of effect on lung eosinophilia by day 7 and on mucous metaplasia after 22 d (Fig. S2A). Based on these results, mice in the current study were exposed to aerosolized nadolol for 21 d. In previous dose–response studies, nadolol in the diet at 5 ppm did not reduce the eosinophilia and only mildly reduced mucous metaplasia, while at 25 ppm there was a significant reduction of the eosinophilia and an almost complete suppression of the mucous metaplasia (10). We measured the plasma concentration of nadolol given in the diet at 5 ppm as 0.65 ng/mL (± 0.1 SEM, n = 4) and at 25 ppm as 3.1 ng/mL (± 0.4 SEM, n = 3). When 1.5 mg of nadolol was aerosolized twice daily for 21 d, the plasma level was only 0.25 ng/mL (± 0.1 SEM, n = 5). Despite the subtherapeutic plasma nadolol level (less than half the blood levels produced by the 5-ppm oral dose), mucous metaplasia and lung eosinophilia in response to IL-13 were reduced nearly as much by aerosolized nadolol as by genetic deletion of β₂AR (Fig. 2C). Thus, nadolol appeared to have powerful effects acting locally within the lungs. Further supporting a lung parenchymal rather than circulating leukocyte site of action, Rag1^−/− mice exposed to aerosolized nadolol exhibited attenuated eosinophilia and metaplasia in response to IL-13 comparable to that in WT mice (Fig. S1).

Fig. S2.

Time courses of the effect from the onset and loss of nadolol. (A) Mice were immunized with OVA and alum as described (7–9) and then were placed on a diet containing 250 ppm nadolol for the number of days indicated (black bars) or were not treated with nadolol (No Rx). (B) Mice were immunized to OVA and then were placed on a diet containing 250 ppm nadolol for 28 d (black) or were not treated with nadolol (No Rx). Nadolol was then withdrawn from the diet for the number of days indicated. All mice except the control group (No OVA) were challenged daily for 5 d with intranasal OVA for the indicated number of days on (A) or off (B) nadolol and then were killed and analyzed. Epithelial mucin content (Left), lung lavage total cell counts (Center), and lung lavage eosinophil counts (Right) were measured (n = 4–10; error bars show SEM; *P < 0.05, ***P < 0.001, ****P < 0.0001 compared with no OVA; ^#P < 0.05, ^##P < 0.01, ^###P < 0.001, and ^####P < 0.0001 compared with no nadolol). All analyses were performed using one-way ANOVA and Dunnett’s multiple comparisons post-hoc test.

We also tested the local activity of the high-efficacy β₂AR agonist formoterol given by aerosol. In previous time-course studies, we found that restoration of β₂AR signaling in phenylethanolamine N-methyltransferase (PNMT) null mice, which lack epinephrine, by twice daily i.p. injection of formoterol required 12 d to reach a maximal effect on eosinophilia and 19 d to reach a maximal effect on mucous metaplasia (9). We obtained similar results in time-course studies restoring β₂AR signaling by withdrawing nadolol (250 ppm) from the diet of WT mice in an OVA model (Fig. S2B). Based on these results, mice in the current study were exposed to aerosolized formoterol for 21 d. We used the clinical dose of 20 μg nebulized twice daily to maximize pulmonary effects and minimize systemic effects (24); drug deposition in the lungs scales with animal size, allowing the assumption of comparable delivery between humans and mice (25, 26). This regimen augmented lung eosinophilia and mucous metaplasia in response to IL-13 (Fig. 2D), further supporting a site of action for β₂AR signaling within the lungs and demonstrating that an exogenous β₂AR agonist can cause a gain-in-function above the endogenous agonist in promoting the asthma phenotype.

Airway Epithelial Cells Express β₂ARs.

To explore β₂AR distribution within the lungs, we labeled mouse peripheral lung sections with boron dipyrromethene (BODIPY-TMR-CGP-12177), a fluorescent β₂AR ligand (27). This revealed fluorescence in airway epithelial cells and blood vessels (arrowheads and arrows, respectively, in Fig. 3A). Pretreatment of tissue sections with bromoacetyl alprenolol menthane (BAAM), an irreversible β₂AR antagonist, resulted in diminished fluorescence in airway epithelial cells but not blood vessels (Fig. 3B), indicating that fluorescence associated with airway epithelium, but not blood vessels, was due to specific β₂AR binding. Blood vessels were visible even in the absence of BODIPY-TMR-CGP-12177 (Fig. 3C), indicating autofluorescence that is probably due to elastin fibers that appear black in the histochemically stained section (Fig. 3D). Central airways containing smooth muscle were also examined to compare receptor density in epithelium with a cell type known to have high β₂AR density (25). As determined by photometry, labeling of epithelial cells by BODIPY-TMR-CGP-12177 was 77.6% (± 2.7% SEM, n = 6) as intense as the labeling of smooth muscle cells (Fig. 3 E–G).

Fig. 3.

Localization of β₂AR in mouse lungs. (A) Peripheral lung labeled with the fluorescent β₂AR ligand BODIPY-TMR-CGP (CPG) shows fluorescence in airway epithelium (arrowhead) and an arteriole (arrow). (B) Lung labeled as in A except that it was first exposed to the irreversible antagonist BAAM, resulting in a loss of epithelial (arrowhead) but not arteriolar (arrow) staining. (C) Lung not exposed to BODIPY-TMR-CGP shows fluorescence in an arteriole (arrow), indicating autofluorescence. (D) For comparison, light microscopy of peripheral lung stained with Verhoeff’s elastin stain and picrosirius red (PSR) shows tan epithelium in an airway (arrowhead) and black elastin in an artery wall (arrow). (E) Central lung labeled with BODIPY-TMR-CGP shows a bronchus with intense pseudocolor (smart LUT) fluorescence. (F) The airway in E at twofold higher magnification shows the most intense fluorescence in the ring of smooth muscle and less in the epithelium. (G) Light microscopy of an adjacent section of the same airway stained with elastin-picrosirius red shows tan epithelium lining the airway lumen and pink smooth muscle just outside the black lamina reticularis. (Scale bars: 100 µm in all images.)

Transgenic Expression of the β₂AR in Airway Secretory Cells of β₂AR^−/− Mice Restores a Full Asthma Phenotype.

As a test of the site of β₂AR signaling in promoting allergic inflammation, we evaluated whether restoration of receptors only in airway epithelial cells of β₂AR^−/− mice could rescue the asthma phenotype in response to IL-13. We generated transgenic (Tg-Epith-β₂) mice expressing hemagglutinin-tagged human β₂AR under control of the secretoglobin Scgb1a1 promoter (Fig. S3), which is efficient and selective for airway epithelial secretory (club) cells (28, 29). Expression of β₂AR was confirmed using anti-hemagglutinin antibody (Fig. S3D). BODIPY-TMR-CGP-12177 labeling was restored in the airway epithelium of β₂AR^−/− mice carrying the Scgb1a1-HA-β₂AR transgenic allele (β₂AR^−/− + Tg-Epith-β₂) and was augmented in β₂AR WT mice carrying the Scgb1a1-β₂AR allele (WT + Tg-Epith-β₂) compared with WT mice (Fig. 4A). Transgenic expression of β₂AR in airway epithelial secretory cells of β₂AR^−/− mice was sufficient for recovery of IL-13–induced mucous metaplasia and lung eosinophilia (Fig. 4B), while overexpression in WT + Tg-Epith-β₂ mice resulted in increased epithelial mucin content, (Fig. 4B), epithelial height, and lung eosinophilia compared with WT mice (Fig. 4B). These results indicate that β₂AR signaling in airway secretory cells alone is sufficient for the promotion of two cardinal features of the asthma phenotype and that increased β₂AR signaling can cause a gain-in-function similar to that observed with the exogenous agonist formoterol (Fig. 2D).

Fig. S3.

Generation of transgenic mice expressing β₂AR in airway epithelial secretory cells. (A) Diagram of the expression construct showing the mouse Scgb1a1 promoter, a rabbit β-globin intron, a hemagglutinin tag, the β₂AR coding region, and the cattle growth hormone polyadenylation signal, together with restriction sites. (B) Genomic DNA from F2 mouse tails was amplified using PCR with primers corresponding to the coding sequence of the β₂AR. WT (lane 1) and β₂AR^−/− (lane 2) controls fail to provide a template, whereas DNA of the predicted size was amplified from two mouse lines that incorporated the Scgb1a1-HA-β₂AR transgene (lanes 3 and 4). (C) Scgb1a1-HA-β₂AR mice were crossed to β₂AR^−/− mice, yielding offspring that expressed β₂AR in airway epithelial secretory cells on a homozygous β₂AR^−/− background (lane 1), a homozygous WT background (lanes 2 and 3), or a heterozygous background (lane 4). (D) Expression of HA-β₂AR protein (∼47 kDa) in lung homogenates using anti-HA antibody in a Western blot in three of four mouse lines that incorporated the transgene (lanes 1–4) compared with WT (lane 5) and β₂AR^−/− (lane 6) mice. GAPDH was used for loading controls.

Fig. 4.

Effect of airway epithelial β₂AR and βarr-2 signaling on the asthma phenotype. (A) BODIPY-TMR-CGP labeling of lung from WT mice shows fluorescence in airway epithelium; lung from β₂AR^−/− mice shows no labeling; lung from Scgb1a1-HA-β₂AR transgenic mice crossed to β₂AR^−/− mice (β₂AR^−/− + Tg-Epith-β₂) shows fluorescence in epithelium comparable to that in WT mice; and lung from Scgb1a1-HA-β₂AR mice on a WT background (WT + Tg-Epith-β₂) shows more intense fluorescence than in WT mice. (Scale bar: 50 µm.) (Please note that the long structure on the left of the WT image at the top of A is an adjacent airway that has been damaged/folded during the section cutting process). (B) Epithelial mucin content (Left), lung lavage total cell counts (Center), and lung lavage eosinophil counts (Right) from mice of the genotypes in A administered or not administered 3 µg IL-13 intratracheally (n = 5–7 mice in each group; error bars show SEM; ****P < 0.0001 compared with the vehicle-treated control group; ^##P < 0.01 and ^####P < 0.0001 compared with WT mice administered IL-13). (C) Newtonian airway resistance (Raw, recorded at 1-min intervals for 4 min and then averaged) in response to increasing doses of aerosolized MCh (10–100 mg/mL) in mice administered (filled symbols) or not administered (open symbols) 3 µg IL-13 intratracheally 24 h earlier (n = 5–7 mice in each group; *P < 0.05 compared with WT mice administered IL-13). (D) Peak Raw in response to aerosolized MCh of mice administered 3 µg IL-13 intratracheally 24 h earlier and treated or not treated with 1 mg/mL isoproterenol (ISO) to induce bronchodilation (n = 5–7 mice in each group; ****P < 0.0001 compared with WT mice not treated with isoproterenol). (E) Epithelial mucin content (Left), lung lavage total cell counts (Center), and lung lavage eosinophil counts (Right) from WT (black bars) and βarr-2^−/− (white bars) mice administered or not administered 3 µg IL-13 intratracheally (n = 5–6 mice in each group; error bars show SEM; ****P < 0.0001, compared with the vehicle-treated control group; ^####P < 0.0001, compared with WT challenged with IL-13). All analyses were performed using two-way ANOVA and Tukey’s multiple comparisons post-hoc test.

We then tested whether β₂AR signaling in airway secretory cells alone is sufficient to promote AHR, a third cardinal feature of asthma. Intratracheal IL-13 caused AHR in methacholine (MCh)-treated WT mice (Fig. 4C), which was markedly reduced in β₂AR^−/− mice, as we have previously observed (8). Transgenic expression of β₂AR in airway epithelial secretory cells was sufficient for recovery of IL-13–induced AHR in β₂AR^−/− + Tg-Epith-β₂ mice, although overexpression in WT + Tg-Epith-β₂ mice did not cause significantly increased AHR (Fig. 4C). Aerosolized isoproterenol, a βAR agonist, functionally antagonized IL-13–induced AHR in WT mice but did not further reduce the attenuated AHR in β₂AR^−/− mice (Fig. 4D). Isoproterenol treatment of β₂AR^−/− + Tg-Epith-β₂ mice did not impede IL-13–induced AHR (Fig. 4D), suggesting that β₂ARs on airway smooth muscle cells are necessary for mediating bronchodilation.

βarr-2 Gene Deletion and Pharmacologic Inhibition of MAP Kinases Also Attenuate Allergic Inflammation.

We next explored the signaling pathway downstream of the β₂AR that promotes allergic inflammation. Previous studies of βarr-2^−/− mice indicate that these mice mimic β₂AR^−/− mice in models of OVA immunization and challenge, acting in both hematopoietic and nonhematopoietic cells (15, 30). We tested whether βarr-2^−/− mice also attenuate responses to acute topical exposure to IL-13 to highlight the function of βarr-2 in epithelial cells. Reductions in IL-13–induced mucous metaplasia and lung eosinophilia in βarr-2^−/− mice (Fig. 4E) were similar to those in β₂AR^−/− mice (Fig. 2B), supporting the possibility that these function in the same pathway in epithelial cells.

Under certain conditions MAP kinases have been found to function downstream of βarr-2 (31, 32), so we tested whether intratracheal instillation of U0126, an inhibitor of MEK1/2 (33), before the instillation of IL-13 reduced mucous metaplasia and eosinophilia (Fig. S4A), similar to the genetic loss of β₂ARs (Fig. 2B) or βarr-2 (Fig. 4E). The addition of U0126 also produced a reduction in mucin 5AC (MUC5AC) transcripts in cultured human airway epithelial cells exposed to both epinephrine and IL-13 (Fig. S4B). Together these results suggest that MAP kinases function downstream of β₂AR and βarr-2 in airway epithelial cells to promote allergic airway inflammation (34, 35).

Fig. S4.

Effect of the MEK1/2 inhibitor U0126 on mucin content and inflammation. (A) Mucin content (Left), lavage total cell counts (Center), and eosinophil counts (Right) from WT mice treated with vehicle alone (Veh, black bars) or the MEK1/2 inhibitor 250 µg U0126 (white bars) and administered or not administered 3 µg IL-13 intratracheally (n = 5–6 mice in each group, error bars show SEM; ***P < 0.001, ****P < 0.0001 compared with vehicle-treated control group; ^##P < 0.01, ^###P < 0.001 compared with WT mice challenged with IL-13). (B) Fold change in MUC5AC transcript levels in NHBE cells grown in medium supplemented with 3 µM epinephrine, with or without 20 ng/mL IL-13, and with vehicle alone (black bars) or with 3 µM U0126 (white bars) (n = 5–6 mice in each group or three donors for NHBE cells; error bars show SEM; *P < 0.05 compared with the vehicle-treated control group; ^#P < 0.05 compared with WT mice challenged with IL-13). All analyses were performed using two-way ANOVA and Tukey’s multiple comparisons post-hoc test.

Epinephrine-Mediated β₂AR Signaling in Isolated Human Bronchial Epithelial Cells.

To further isolate the direct effects of β₂AR activation on epithelial cells, we analyzed normal human bronchial epithelial (NHBE) cells in vitro. We confirmed that NHBE cells required epinephrine in addition to IL-13 to increase expression of MUC5AC transcripts (Fig. 5A and ref. 36), a molecular correlate of mucous metaplasia (37). Besides the effects on mucous metaplasia, our studies in mice suggested that airway epithelial β₂AR signaling promotes allergic inflammation because leukocyte recruitment to the lungs varied with changes in epithelial β₂AR signaling (Figs. 2 and 4B). To test this, we measured secretion from NHBE cells of the epithelial-derived chemokines chemokine (C-C motif) ligand 24 (CCL24), chemokine (C-X-C motif) ligand 1 (CXCL1), and chemokine (C-C motif) ligand 2 (CCL2) that participate in allergic lung inflammation (38–42) and chemokine (C-C motif) ligand 20 (CCL20) that participates in neutrophilic inflammation (43). NHBE cells required β₂AR signaling to increase secretion of CCL24, CXCL1, and CCL2, but not CCL20, in response to IL-13 (Fig. 5B). These results in primary human cells confirm that epinephrine acts directly on airway epithelial cells to promote proinflammatory activities of IL-13. As expected for a β₂AR-mediated effect, in the presence of epinephrine, nadolol inhibited MUC5AC expression and the increased secretion of CCL24, CXCL1, and CCL2, but not CCL20 (Fig. 5). Since at circulating levels norepinephrine activates all adrenoreceptors except β₂AR, this confirms the receptor specificity of epinephrine in mediating these effects.

Fig. 5.

β₂AR signaling and effect on MUC5AC and chemokines in NHBE cells. (A) Fold change in MUC5AC transcript levels in NHBE cells grown in medium supplemented or not supplemented with 3 µM epinephrine (EPI) and containing vehicle alone (Veh, black bars), 20 ng/mL IL-13 (white bars), or 20 ng/mL IL-13 and 10 µM nadolol (gray bars); (n = 3–4 donors; ****P < 0.0001 compared with cells in medium treated with IL-13 and epinephrine). (B) Cytokines from the basolateral medium of NHBE cells grown in the presence of 3 µM epinephrine or not and containing vehicle alone (black bars), 20 ng/mL IL-13 (white bars), or 20 ng/mL IL-13 and 10 µM nadolol (NAD) (gray bars) (n = 3–4 donors; ****P < 0.0001 compared with cells treated with IL-13 and epinephrine). All analyses were performed using two-way ANOVA and Tukey’s multiple comparisons post-hoc test.

β₂AR Signaling Does Not Promote Neutrophilic Inflammation.

We next addressed whether β₂AR signaling is nonspecifically proinflammatory or is selective for allergic inflammation. Previous experimental models utilized sensitization and then challenge by OVA (7–9). Here the effects of genetic deletion of β₂AR on a variety of innate stimuli of eosinophilic and neutrophilic inflammation were compared. Crude extrinsic stimuli (lysates of Aspergillus species protease or nontypeable Haemophilus influenzae, NTHi), chemically well-defined extrinsic stimuli [chitin or the Toll-like receptor agonists Pam2CSK4 and ODN M362 (PAM2/ODN)], and intrinsic stimuli (IL-13 or IL-17A) were introduced into the lungs of WT and β₂AR^−/− mice (Fig. 6). As expected, the loss of β₂AR signaling resulted in the attenuation of lung eosinophilia in response to all three eosinophilic stimuli (Fig. 6A). However, lack of β₂AR signaling caused no loss or even a slight augmentation of lung neutrophilia in response to the neutrophilic stimuli (Fig. 6B).

Fig. 6.

Effect of β₂AR signaling on innate eosinophilic or neutrophilic inflammation. (A) BAL eosinophil counts obtained from WT and β₂AR^−/− mice after exposure to extrinsic crude (15 mg A. fumigatus), extrinsic defined (100 µg chitin), and intrinsic (2 µg IL-13) eosinophilic stimuli (n = 5–9 mice per group). (B) BAL neutrophil counts obtained from WT and β₂AR^−/− mice after exposure to extrinsic crude (15 mg NTHi), extrinsic defined (PAM2/ODN at daily doses of 30.5 µg and 48.3 µg, respectively), and intrinsic (1 µg IL-17A) neutrophilic stimuli (n = 5–9 mice per group). (C and D) BAL neutrophil counts 48 h after exposure to PAM2/ODN in Pmnt^−/− mice (n = 4 mice per group) (C) or WT mice (D) previously treated with a loading dose of 5 mg/kg reserpine, followed by a maintenance dose of 0.3 mg/kg for the next 5 d (n = 4 mice per group). Error bars show SEM; *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 compared with WT mice challenged with eosinophilic or neutrophilic crude stimuli. Analyses in A and B were performed using two-way ANOVA and Tukey’s multiple comparisons post-hoc test. Analyses in C and D were performed using one-way ANOVA and Dunnett’s multiple comparisons post-hoc test.

We have previously shown that the promotion of eosinophilic inflammation by the β₂AR is ligand dependent rather than constitutive (9). To examine the effects of endogenous epinephrine on neutrophilic inflammation, mice in which epinephrine was depleted genetically by deletion of Pnmt, which is responsible for the final step in epinephrine synthesis, or pharmacologically by exposure to reserpine, as we have described previously (9), were exposed to PAM2/ODN. In contrast to our previous results with eosinophilic inflammation (9), neither genetic (Fig. 6C) nor pharmacologic (Fig. 6D) depletion of epinephrine caused a reduction in neutrophilic lung inflammation.

To determine the cell types involved, PAM2/ODN was used to identify the involvement of specific receptors in β₂AR^−/− + Tg-Epith-β₂ mice with transgenic expression of the receptor only in the airway epithelial secretory cells (Fig. S5). The transgenic expression of the β₂AR solely on airway epithelial cells was sufficient to restore neutrophilic inflammation equaled to that of the WT mice.

Fig. S5.

Effect of airway epithelial β₂AR signaling on neutrophilic inflammation and mechanism. Blockade of β₂AR on neutrophilic inflammation was assessed using mice with genetic deletion of the β₂AR gene (β₂AR^−/−) or pharmacologically with WT mice nebulized twice daily for 21 d with 1.5 mg nadolol (WT + NAD), while the contribution of epithelial cell β₂AR signaling was examined using the β₂AR transgene expressed in the epithelial secretory cells of β₂AR-KO mice (β₂AR^−/− + Tg-Epith-β₂). Loss-of-function experiments were performed using the β₂AR transgene expression in epithelial secretory cells of WT mice (WT + Tg-Epith-β₂) or pharmacologically with the administration of 20 µg nebulized formoterol twice daily for 21 d into the airways of WT mice (WT + FOR). Lavage neutrophils were harvested 48 h after nebulization with PAM2/ODN at daily doses of 30.5 µg and 48.3 µg, respectively, or vehicle (n = 5–9 mice in each group; error bars show SEM; ****P < 0.0001 compared with WT mice not challenged with PAM2/ODN; ^##P < 0.01 and ^####P < 0.0001 compared with WT mice challenged with PAM2/ODN). All analyses were performed using one-way ANOVA and Dunnett’s multiple comparisons post-hoc test.

Discussion

Together these studies provide several lines of evidence that airway epithelial cells are the principle cell type through which β₂AR signaling promotes the asthma phenotype. First, the effect of topical administration of IL-13 to the lung was sensitive to expression of β₂AR (Figs. 2 A and B and 4B), and topical administration of a hydrophilic β-blocker (Fig. 2C) or β₂AR agonist (Fig. 2D) together with IL-13 modulated the asthma phenotype, suggesting that the site of interaction between IL-13 and β₂AR signaling is in resident lung cells. Second, β₂ARs are highly expressed in airway epithelial cells in addition to smooth muscle cells, as shown by fluorescent ligand labeling (Fig. 3). Third, transgenic expression of β₂AR only in airway epithelial cells rescues the loss of function shown by β₂AR^−/− mice and induces a gain of function in WT mice (Fig. 4B). Fourth, we show that β₂AR signaling is responsible for the increased expression of MUC5AC and secretion of Th2 cytokines by IL-13 in isolated human airway epithelial cells (Fig. 5).

The airway epithelium is known to be an important site of IL-13 action (19, 44, 45), and our in vitro studies suggest that IL-13 and β₂AR signaling interact cell-autonomously in airway epithelium (Fig. 5 and Fig. S4B). In their location at the interface of the lungs with the outside environment, airway epithelial cells are best positioned to integrate signals from inhaled air (e.g., pathogen-associated molecular patterns), the immune system (e.g., IL-13), and the nervous system (e.g., epinephrine). They respond to these signals both directly through the increased production of mucins and indirectly by signaling to leukocytes (46–49). Our studies also show that β₂AR signaling on the airway epithelium can modulate airway smooth muscle function (Fig. 4C and ref. 19), reinforcing an analogy between the airway epithelium and the vascular endothelium (50, 51) that might extend to all cells lining hollow organs. These cells have traditionally often been called “barrier” cells because evidence shows that in disease it is often this barrier function that is disrupted (52, 53). However, in the last 30 y the vascular endothelium has emerged from this view of serving primarily a barrier function to being arguably the most important cell type in coordinating and maintaining vascular smooth muscle cell tone (54, 55). However, unlike the production of nitric oxide by the vascular endothelium, no relaxing or contracting factor released by airway epithelium has yet been widely recognized (50). This may be because epithelial regulation of the airway smooth muscle could be regulated by raising cytokine levels rather than by paracrine signaling as shown for CCL2, CCL24, and CXCL1 (Fig. 5B). However, it should be noted that the ability to coordinate an integrated response is common to all cells lining hollow organs.

Our studies also provide support for the hypotheses that explain the epidemiologic observation of a loss of asthma control and increase in asthma mortality with the regular use of β₂AR agonists (1–3, 5). The augmentation of airway mucous metaplasia, lung eosinophilia, and AHR we observed when the agonist formoterol was administered chronically (Fig. 2D) or the β₂AR was transgenically overexpressed in airway epithelium (Fig. 4 A–D) supports a mechanistic explanation for the observation that chronic activation of β₂AR to a level higher than that induced by endogenous epinephrine makes the asthma phenotype more severe. This is consistent with clinical findings in controlled trials of increased cough and sputum (4) and increased sputum eosinophils (4, 56, 57) with regular use of β₂AR agonists. It is also conceptually consistent with our previous loss-of-function studies in mice and humans (7–9, 11, 12, 58) and is supported by previous gain-of-function studies by us and others in mice (9, 59–62). Our studies of the signaling pathway downstream of β₂ARs in asthma promotion suggest that, whereas β₂ARs in airway smooth muscle cells signal most prominently through Gs and adenylyl cyclase to induce relaxation (Fig. 4D), β₂ARs in epithelial cells signal most prominently through βarr-2 and MEK1/2 to promote mucous metaplasia and inflammation (Fig. 4B and Fig. S4A). Biased β₂AR ligands that activate adenylyl cyclase signaling and inhibit βarr-2 signaling could retain the desirable bronchodilatory effect without incurring the undesirable mucus hypersecretory and inflammatory effects (60). Our results are also consistent with the beneficial effects of long-acting β-agonists, without adverse effects, in chronic obstructive pulmonary disease, a disease of neutrophilic inflammation (63).

Our studies identify the airway epithelium as the primary cell type and suggest β₂AR signaling via βarr-2 (and possibly MEK1/2) activation as the potential pathway mediating the proinflammatory responses. Last, our results show the β₂AR signaling on airway epithelium is selective for promoting eosinophilic inflammation, as β₂AR signaling has little effect on models of neutrophilic inflammation. These results reinforce the emerging role of the airway epithelium as a master-controller cell type capable of modulating the functions of other cells, as has been shown for the vascular endothelium.

Materials and Methods

Supplies.

Chemicals and reagents were obtained from Sigma-Aldrich unless otherwise stated.

Animals.

Six- to twelve-week-old mice were housed under specific pathogen-free conditions and were handled in accordance with the University of Texas MD Anderson Cancer Center Institutional Animal Care and Use Committee, which also approved all the experiments conducted in these studies. All mice were on an FVB/N background except for βarr-2^−/− mice, which were on a C57BL/6 background and used C57BL/6 controls. β₂AR and βarr-2^−/− mice have been described previously (8, 15). To generate epithelial-specific transgenic mice (Fig. S3), the β₂AR gene was cloned into a plasmid encoding the mouse Scgb1a1 promoter and a hemagglutinin tag (28, 29). The β₂AR sequence in the cloned construct was confirmed to be identical to contig NW_001838953, and the construct was injected into FVB/N blastocysts by the MD Anderson Genetically Engineered Mouse Facility. Scgb1a1-HA-β₂AR transgenic offspring were identified by PCR using the primers CGTGCTGGTTATTGTGCTGTCTC ATC and GCAGCCAGCAGAGGGTGAAAG. These mice were crossed to β₂AR^−/− mice identified using the primers TCCATCATGGCTGATGCAAT and TTGTGCTCTTTCA AGCAGAACTT to produce offspring expressing β₂AR only in epithelial secretory cells. For Western blots to identify lines expressing the transgene, lungs were lysed in SDS sample buffer, and proteins were separated by SDS/PAGE and transferred to a PVDF membrane (Millipore) as described (59). Membranes were blocked in 3% BSA (1 h, 20 °C), incubated overnight with horseradish peroxidase-conjugated anti-HA antibody (1:1,000, 4 °C), washed in saline, and visualized using chemiluminescent substrate (SuperSignal West Pico; Thermo Fisher Scientific).

Drug Administration.

Recombinant mouse IL-13 (3 µg in 25 μL 0.9% NaCl in water; PeproTech or BioLegend) was instilled into the tracheas of anesthetized (pentobarbital 6.5 mg) mice using a gel-loading pipette under direct visualization. Mice were killed 24 h later for histological and lung lavage fluid analyses as described (7). U0126 (15 mg/g mouse weight in 2% DMSO in 0.9% NaCl in water; Promega) was instilled intratracheally 2 h before IL-13 instillation and every 8 h until mice were killed. For aerosol delivery of drugs (nadolol, formoterol, PAM2/ODN), an AeroMist CA-209 jet nebulizer (CIS-US) was driven by 10 L/min of room air supplemented with 5% CO₂ to promote deep ventilation. The nebulizer was connected by polyethylene tubing to a 10-L polyethylene chamber containing mice, which was closed except for efflux polyethylene tubing vented to a low-resistance filter. Solutions of nadolol (1.5 mg) or formoterol (20 µg) in 0.9% NaCl in water (6 mL) were delivered twice daily for 21 d. PAM2/ ODN, 4 µM and 1 µM, respectively, dissolved in water was aerosolized once daily for 20 min to unrestrained mice.

Bronchoalveolar Lavage.

The lungs of the killed mice were lavaged twice with 1 mL 0.9% NaCl in water through a tracheal catheter, total cells were counted with a hemacytometer, and the differential count was obtained by cytocentrifugation of 300 µL of bronchoalveolar lavage (BAL) fluid at 450 × g for 5 min, followed by Wright–Giemsa staining as described (8).

Eosinophilic Stimuli.

Fresh Aspergillus fumigatus was passed several times through an EmulsiFlex homogenizer (Avestin Inc.) to create a homogenized lysate, which was then diluted to 2.5 mg/mL. Aspergillus oryzae lysate was generously provided by David B. Corry, Immunology, Allergy, and Rheumatology Section, Baylor College of Medicine, Houston. The first group of mice was administered 6 mL of this lysate by aerosol and was killed 48 h later for BAL analysis. The next group was given 100 µg of suspended chitin, prepared as described by Reese et al. (64). It was delivered in 25 µL of PBS intratracheally once daily for two administrations. These mice were killed for BAL analysis 24 h after the second treatment. The final group was given 2 µg of IL-13 (PeproTech) in 50 µL of PBS intratracheally; these mice were killed 48 h later for BAL analysis.

Neutrophilic Stimuli.

NTHi lysate was prepared as described by Evans et al. (65) and was administered as previously described (66). Briefly, 6 mL of the lysate at a concentration of 2.5 mg/mL was delivered to mice by an AeroMist CA-209 jet nebulizer. PAM2/ODN (InvivoGen) was used as the defined stimulus. PAM2/ODN was used in place of NTHi to identify the involvement of specific receptors. PAM2/ODN were reconstituted and delivered once by jet nebulization to mice as previously described (67). The final group was given 1 µg murine IL-17A (PeproTech) in 25 µL of PBS, delivered intratracheally. All animals were killed for BAL analysis 48 h after stimulus administration.

Gain-of-Function Studies.

Before PAM2/ODN administration, 20 µg of formoterol fumarate was delivered in 6 mL of saline (pH 5) by jet nebulization, administered twice per day for 21 d (Fig. S5) to mice as described above. Mice were killed 48 h later for BAL analysis.

Mechanism Studies.

Chitin and PAM2/ODN were prepared and delivered as described above. U0126 (Sigma) was prepared in a 2% DMSO solution to a concentration of 5 mg/mL, and 250 µg was delivered intratracheally to WT C57 mice every 8 h, starting 2 h before the initial experimental administration. Mice were killed 48 h later for BAL analysis.

Histochemistry.

For mucin quantification, lungs were inflated with 4% paraformaldehyde in PBS (20 °C) through a tracheal cannula and then were removed and further fixed overnight (4 °C) before paraffin embedding. Deparaffined sections were stained with periodic acid fluorescent Schiff's (PAFS) reagent, and images were acquired and analyzed as described below by investigators blinded to mouse genotype and treatment. The intracellular mucin content of airway epithelium is expressed as mucin volume density, signifying the measured volume of mucin overlying a unit area of epithelial basal lamina as described (7, 8, 68).

For examination of β₂AR distribution, lungs were inflated and fixed with 10% phosphate-buffered formalin and then were embedded in paraffin. Deparaffined sections were incubated in the dark at 20 °C for 60 min with water containing the fluorescent ligand boron dipyrromethene (BODIPY-TMR-CGP-12177; Molecular Probes) (100 nM in water), or with the irreversible antagonist BAAM (1 µM in 0.0001% ethanol in water) followed by BODIPY-TMR-CGP-12177 for 60 min, or with water alone for 120 min (27, 69, 70). The lung slices were observed with a Radiance 2100 confocal microscope (; Bio-Rad), 20× (NA 0.75) or 40× (NA 1.0) objective and 4× zoom; green HeNe laser, 643-nm excitation/590-nm emission; and were optimized to compare the fluorescence intensity between slices. For display purposes, a “smart” look-up-table (LUT) was applied to some fluorescent ligand images using ImageJ. This LUT assigns red/yellow hues to all values greater than 103 in an eight-bit image (0–225). For identification of lung tissues to compare with BODIPY-TMR-CGP labeling, sections were stained with Verhoeff’s elastic stain and picrosirius red and were examined by brightfield microscopy.

Lung Physiology.

Mice were anesthetized, tracheotomized, and connected to a computer-controlled ventilator (flexiVent; SCIREQ) (9). To induce bronchoconstriction, acetyl-β-methylcholine chloride (methacholine, MCh) in increasing doses from 10 to 100 mg/mL in 0.9% NaCl in water was aerosolized using the built-in nebulizer. Following each MCh dose, the Newtonian resistance (Raw) was recorded at 1-min intervals for 4 min and then averaged, with the largest value obtained referred to as “peak Raw” (9). To induce bronchorelaxation, the β-AR agonist isoproterenol (1 mg/mL in 0.9% NaCl in water) was aerosolized 2 min before MCh.

Cell Culture.

NHBE cells (Lonza) were seeded into Transwell-Clear culture inserts (24.5-mm diameter, 0.45-μm pore; Corning) and grown in a 1:1 mixture of Bronchial Epithelial Basal Medium (Lonza) and Dulbecco’s Modified Eagle's Medium (Life Technologies) supplemented with 30 μg/mL bovine pituitary extract, 0.5 μg/mL BSA, 0.5 μg/mL epinephrine, 50 μg/mL gentamycin, 50 ng/mL amphotericin B, 0.5 ng/mL human EGF, 0.5 μg/mL hydrocortisone, 5 μg/mL insulin, 7 ng/mL triiodothyronine, 10 μg/mL transferrin, and 0.1 ng/mL retinoic acid. When the cells reached confluence, the apical medium was removed to establish an air–liquid interface, and the basolateral medium was substituted with medium with or without epinephrine (3 µM), IL-13 (20 ng/mL), nadolol (10 µM), and U0126 (3 µM) and was replaced every 48 h for 14 d. For quantitative PCR, RNA was extracted from cells that had grown at the air–liquid interface for 14 d using TRIzol reagent (ThermoFisher Scientific) and was reverse transcribed using SuperScript III (Life Technologies). MUC5AC and 18S mRNA were quantified by real-time quantitative PCR using the Taqman Gene Expression Assay (Life Technologies). Relative MUC5AC expression was calculated using the ∆∆CT method. For chemokine measurement, basolateral medium was withdrawn from NHBE cells that had grown at the air–liquid interface for 5 d. Samples were flash frozen, and chemokines were measured by indirect ELISA (Aushon Biosystems). All experiments were repeated with cells from three donors.

Plasma Nadolol Measurement.

Blood from treated mice was recovered in EDTA (1.8 mg/mL) and centrifuged to retrieve the plasma supernatant. Plasma samples were diluted in water and analyzed in the MD Anderson Pharmaceutical Development Center using LC/MS (Acquity UPLC and Xevo TQ-S; Waters). For the chromatography, a C8 reversed-phase column (Kinetex; Phenomenex) was eluted using gradients of acetonitrile and 20 mM ammonium acetate in 0.1% formic acid. Nadolol reference standards were used to set a linear range of detection from 0.5 to 1,000 ng/mL.

Statistical Analysis.

Statistical analysis of multiple groups was performed using one- or two-way ANOVA followed by Dunnett’s or Tukey’s multicomparison tests (GraphPad Prism version 6 for Mac OX S; GraphPad Software). Data are presented as mean ± SEM. P < 0.05 was considered statistically significant.

Data-Sharing Plan.

The authors will make the data and materials available upon request. Please note that some of the genetically altered mice lines used in the experiments are no longer available, but the transgenic constructs to recreate the mice will be shared.