Skip to main content
Technology in Cancer Research & Treatment logoLink to Technology in Cancer Research & Treatment
. 2016 Aug 29;16(5):609–619. doi: 10.1177/1533034616665720

Knockdown of Hypoxia-Inducible Factor 1α Improved the Efficacy of Low-Dose Metronomic Chemotherapy of Paclitaxel in Human Colon Cancer Xenografts

Mu Zhang 1, Chen Chen 2, Feng Su 1, Zhiguo Huang 1, Xiangmin Li 1, Xiaogang Li 1,✉
PMCID: PMC5665152  PMID: 27573201

Abstract

Low-dose metronomic chemotherapy represents a new strategy for solid tumor treatments with a strong antiangiogenic activity and few side effects. However, low-dose metronomic therapy alone is not always as effective as traditional chemotherapy on eradication of tumor. On the contrary, low-dose metronomic in some cases could stimulate tumor growth due to hypoxia of tumor cells induced during therapy. Our study aimed to investigate whether knockdown of hypoxia-inducible factor-1α expression in tumor cell could facilitate low-dose metronomic therapy with paclitaxel for human colon cancer. Human colon cancer cell line (HT-29) stably transfected with specific short hairpin RNAs silencing hypoxia-inducible factor-1α exhibited marked attenuation of hypoxia-induced expression of the target genes such as vascular endothelial growth factor, glucose transporter 1, and P-glycoprotein. Compared with HT-29-c xenograft tumor model established by subcutaneous injection of HT-29 cells stably transfected with scrambled control short hairpin RNA, HT-29-ih xenograft tumor model showed more significant and long-lasting antitumor responses of empirical metronomic paclitaxel regimens, accompanied by drastic angiogenesis decrease and neglectable toxicity. All these data indicated that the combination of paclitaxel low-dose metronomic therapy with hypoxia-inducible factor-1α knockdown might provide a potent battle against colon cancer.

Keywords: HIF-1α knockdown, LDM, cell proliferation, apoptosis, invasion, angiogenesis, side effects

Introduction

Colon cancer is one of the most common malignant diseases in China.1 Patients with colon cancer, despite surgery, are still at high risk of relapse and cancer-related death.2 Adjuvant therapies for colon cancer are rapidly evolving nowadays, besides regular treatments.3,4 Conventional chemotherapies, that is, maximum tolerated dose (MTD) chemotherapy, which target the tumor cells directly, take effects in a dose-dependent manner and lead to cyclic treatments allowing nontumor cells to recover from their side effects.5 Any potential damages to the tumor vasculature due to chemotherapy can be repaired during the long breaks. Therefore, using antiangiogenic drugs as additional or combinational approaches could confer the possibilities to overcome chemoresistance resulting from tumor angiogensis.6–8 Low-dose metronomic (LDM) chemotherapy, which directly targets endothelial cells, is thought to have fewer side effects and lower levels of drug resistance.9–13 Moreover, cycling endothelial cells may be more sensitive to certain chemotherapeutic drugs than other normal cell types and/or tumor cells, the reason for which remains unclear.14 Activated endothelial cells in tumor vessels are reported to have a reduced susceptibility to drug resistance driven by genetic instabilities associated with the cancer cell genome.15 Additionally, paclitaxel appears to be a strong candidate for metronomic chemotherapy given its broad-spectrum antitumor activities and ability to inhibit angiogenic functions of endothelial cells in vitro at extraordinarily low concentrations.16,17

However, it is noteworthy that, in some cases, low-dose chemotherapy protocols are not effective on their own. Contrarily, low-dose chemotherapy alone might even stimulate tumor growth partially due to the aggravation of tumor hypoxia.18

The hypoxia-inducible factor 1 (HIF-1), a master regulator responding to low oxygen levels,19–21 is composed of a constitutive β subunit and an oxygen-regulated α subunit. While transcribed constitutively, HIF-1α has a very low protein level under normoxic condition due to its rapid degradation via the ubiquitin–proteasome pathway.22 After dimerization and nuclear translocation, HIF-1α controls the expression of more than 60 target genes associated with metabolism, angiogenesis, and apoptosis, including vascular endothelial growth factor (VEGF), a well-known HIF-1α target gene and a key regulator of angiogenesis, glucose transporter 1 (GLUT-1), which is reported to be upregulated by hypoxia and associated with poor prognosis in some tumors, and P-glycoprotein (P-gp), a target gene of HIF-1α producing chemoresistance-related drug efflux pump in some tumor cells.23–25 In addition to hypoxia, several growth factors and/or genetic alterations, such as oncogene activation and loss-of-function mutations of tumor suppressor genes, are also shown to be related to the stimulation of HIF-1α activities. The HIF-1α is ubiquitous in most solid tumors, high levels of which are often linked with poor prognosis.26,27 As a master mediator of angiogenesis and energy metabolism under hypoxic conditions, HIF-1α is expected to be an important regulator in tumor growth. Over the past several years, HIF-1α has emerged as an attractive target for cancer therapy. The regulatory functions of HIF-1α in tumor growth have been assessed by approaches including antisense messenger RNA (mRNA), small molecular inhibitors, dominant-negative mutant transfection, RNA interference (RNAi), and so on, and slow tumor growths were observed to be highly correlated with inhibition of HIF-1α activities.28–32 Therefore, we hypothesize that HIF-1α inhibition might resensitize the response of hypoxic tumor to antiangiogenesis therapy, which could lead to a more profound antitumor efficacy. However, despite the great potential of these combined strategies for cancer treatments, rigorous in vivo tests are needed. The purpose of our study is to determine the therapeutic efficacy of metronomic administration of paclitaxel combined with specific short hairpin RNAs (shRNAs), which silences HIF-1α expression in a human colon carcinoma xenograft model.

Materials and Methods

Construction of shRNA Expression Plasmids

Short hairpin RNA targeting to HIF-1α and scrambled RNA were ligated separately into pSilencer 2.1-U6 hygro (Ambion; Invitrogen, Carlsbad, California), according to the manufacturer’s instruction. The target site in HIF-1α mRNA was determined according to the GenBank sequence of HIF-1α (NM_001530) following the rules of Tuschl.33,34 The cloned constructs were confirmed by DNA sequencing.

Cell Culture and Transfection

The HT-29 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium containing 10% heat-inactivated fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin in a humidified incubator of 5% CO2 at 37°C. For hypoxic experiments, cells were incubated in an airtight chamber with a gas mixture of 94% nitrogen, 5% carbon dioxide, and 1% oxygen at 37°C. For transfection, HT-29 cells at subconfluent were transfected with HIF-1α shRNA and scramble shRNA vectors (Table 1) using Lipofectamine 2000 as previously described.35 The stable transfectants were selected by adding hygromycin (100 μg/mL) into cell medium and cultured for 2 weeks. The HT-29 cells transfected with shRNA HIF-1α and scramble shRNA were named HT-29-ih and HT-29-c, respectively.

Table 1.

Oligonucleotides Used in the Construction of shRNA Expression Vectors.

Vector Sequences of Oligonucleotides
HIF-RNAi 5′-GATCCCGTGTGAGTTCGCATCTTGAT TTCAAGAGAATCAAGATGCGAACTC ACATTTTTTGGAAA-3′
5′-AGCTTTTCCAAAAAATGTGAGTTCG CATCTTGATTCTCTTGAAATCAAGA TGCGAACTCACACGG-3′
Scramble-RNAi 5′-GATCCCGTTCTCCGAACGGTGCACGT TTCAAGAGAACGTGCACCGTTCGGA GAATTTTTTGGAAA-3′
5′-AGCTTTTCCAAAAAATTCTCCGAAC GGTGCACGTTCTCTTGAAACGTGCA CCGTTCGGAGAACGG-3′

Abbreviations: HIF, hypoxia-inducible factor; RNAi, RNA interference; shRNA, short hairpin RNA.

aRNAi target sequences were indicated in bold italic type.

Assays for Cell Proliferation and Apoptosis

The colorimetric Cell Counting Kit-8 (CCK-8) assay (Dojindo, Japan) was used to determine cell proliferation following the manufacturer’s instruction. Briefly, the cells tested were plated in 96-well microtiter plate (10 000 cells/well). After incubation for 2 hours at 37°C, 10 μL CCK-8 solutions were added to each well, and the plates were further incubated for another 2 hours. The optical density was then determined at 450 nm using a microplate reader. To quantify apoptosis, the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) technique was used to detect apoptotic cell death using the In situ Cell Death Detection Kit, AP (Roche Diagnostics, Indianapolis, Indiana) following the manufacturer’s instruction. Briefly, chamber slides were fixed with 4% paraformaldehyde for 1 hour and permeabilized in 0.1% Triton-100, 0.1% sodium citrate at 4°C for 2 minutes. The slides were incubated with TUNEL reaction mixture for 1 hour at 37°C. After washing, the slides were incubated with alkaline phosphatase-conjugated antifluorescein antibody for 30 minutes at 37°C. Slides were developed with Fast Red (DAKO, Carpinteria, California) and lightly counterstained with hematoxylin. The apoptotic cells were counted and expressed as the ratio of positively stained tumor cells to all tumor cells. For each case, 1000 tumor cells randomly selected in 5 areas were counted under 400-fold magnification.

Cell Invasion Assays

Transwell invasion assay (BD Biosciences, Franklin Lake, New Jersey) was used to measure the effects of HIF-1α knockdown on the invasion of HT-29 cells. For cell invasion assay, the cells were seeded on the top chamber of each insert with complete medium added to the bottom chamber. After 48 hours, cells on the membrane were wiped off with a cotton swab. Fixed and stained with trypan blue dye, cells on the underside of the membrane were counted from 5 microscope fields (magnification, ×200). The mean number of invading cells was expressed as a percentage relative to the control.

Xenograft Tumor and Chemotherapy

A 6- to 8-week-old male BALB/c nude mice were obtained from the Vital River Company (Beijing, China). The HT-29-c or HT-29-ih cells (1 × 105) were harvested by trypsinization, washed twice with phosphate-buffered saline (PBS), and resuspended in 0.2 mL Hanks’ balanced salt solution followed by right flank subcutaneous injections into nude mice. All of the procedures were performed in accordance with institutional and national ethical guidelines. The tumor sizes reached about 100 mm3 after approximately 2 weeks after tumor cell inoculation, and the mice were randomized into 6 groups (12 mice in each group): HT-29-c saline control group and HT-29-ih saline group (intraperitoneal injection of 0.2 mL saline daily), HT-29-c MTD group and HT-29-ih MTD group (intraperitoneal injection of 20 mg/kg paclitaxel [Taxol; Bristol-Myers Squibb Company, Germany] once a week), and HT-29-c LDM group and HT-29-ih LDM group (intraperitoneal injection of 1.5 mg/kg paclitaxel daily). The doses of paclitaxel were chosen according to previous studies.16,36 Body weight and tumor sizes of mice were recorded twice a week. The perpendicular tumor diameters were measured using a micrometer, and the tumor volumes were estimated using the formula for ellipsoid: (long dimension) × (short dimension)2/2. Blood samples were collected via tail vein once a week to count white blood cells (WBCs). Mice were sacrificed whenever the tumor in mice reached 2000 mm3 or the mice showed signs of stress or discomfort (about 42 days). After sacrifice, tumors were dissected free of stromal tissue and weighted. Then, the tumor tissues were either flash frozen for biochemical analyses, or fixed in 10% neutral-buffered formalin prior to embedding in paraffin.

Quantitative Reverse Transcription Polymerase Chain Reaction

Total RNA isolation and reverse transcription were performed using EZ1 RNA cell mini kit (Qiagen, Frankfurt, German) and iScript reverse transcription supermix (Bio-Rad, Hercules, California), respectively, following the manufacturer’s instruction. The sequences of primers are described in Table 2. The reverse transcription polymerase chain reaction (RT-PCR) was performed in a 20 μL reaction system including 0.5 μL complementary DNA (cDNA) from RT reaction.37 The amplification conditions were 95°C for 5 minutes, then 23 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds, followed by 72°C for 8 minutes. The cDNA products were then analyzed by electrophoresis in 2% agarose gel. For quantitation of mRNA, quantitative RT-PCR was carried out in a 25 μL reaction system containing 0.5 μL template cDNA, 12.5 μL 2 × SYBR Green I Master Mix (Qiagen), and 200 nmol/L sense/antisense primers. The real-time PCR program, run on ABI PRISM 7500 Sequence Detector (Applied Biosystems, Invitrogen, USA), included a predenaturation step at 95°C for 10 seconds followed by 40 cycles of 95°C for 5 seconds and 60°C for 40 seconds. The gene expression levels in cells tested after hypoxic or normoxic exposure for 24 hours were normalized against β-actin expression. Melting curve analysis was carried out to validate the specificity of the amplification products.

Table 2.

Nucleotide Sequences of the Primers Used in RT-PCR and Real-Time RT-PCR.

Gene Sense Primer Antisense Primer Length (bp)
HIF-1α 5′-ACAAGTCACCAC AGGACAG-3′ 5′-AGGGAGAAAAT CAAGTCG-3′ 168
HIF-1β 5′-GACGGAACAAG ATGACAGCCT-3′ 5′-GTTCAAAACAG GAGTCACGGAG-3′ 293
VEGF 5′-TTCATGGATGT CTATCAGCG-3′ 5′-CATCTCTCCTA TGTGCTGGC-3′ 234
GLUT-1 5′-AGGTGATCGA GGAGTTCTAC-3′ 5′-TCAAAGGACTT GCCCAGTTT-3′ 247
P-gp 5′-AACGGAAGCCA GAACATTCC-3′ 5′-AGGCTTCCTGTG GCAAAGAG-3′ 180
β-Actin 5′-GAGACCTTCAA CACCCCAGCC-3′ 5′-AATGTCACGCAC GATTTCCC-3′ 264

Abbreviations: bp, base pair; GLUT-1, glucose transporter; HIF-1α, hypoxia-inducible factor 1α; HIF-1β, hypoxia-inducible factor 1β; P-gp, P-glycoprotein; RT-PCR, reverse transcription polymerase chain reaction; VEGF, vascular endothelial growth factor.

Immunoassay and Western Blotting

Quantitation of VEGF in the supernatant was performed using a Quantikine ELISA kit (R&D Systems, Minneapolis, Minnesota). The conditioned medium was cleared using high-speed centrifugation (20 000g for 20 minutes) before measurement. The VEGF concentrations were denoted as pg/106 cells for conditional medium. The total protein contents of HIF-1α, E-cadherin, Vimentin, B-cell lymphoma 2 (Bcl-2), and Bax protein in cellular lysates were analyzed by Western blotting. Thirty micrograms of total proteins from each cell lysate sample were loaded, and specific protein bands transferred to polyvinylidene fluoride membrane were detected with an anti-HIF-1α, anti-E-cadherin, anti-Vimentin, anti-Bcl-2, and anti-Bax antibody (Santa Cruz, California).

Immunohistochemistry

For the assessment of microvascular density, tumor was washed quickly in ice-cold PBS and embedded in OCT. Frozen sections (8 μm) were air dried and fixed with acetone (−20°C) for 10 minutes. The sections were rinsed in PBS and blocked with 10% normal goat serum and then stained overnight at 4°C with rat antimouse CD31 antibodies (Santa Cruz, California). Sections were then stained with Alexa Fluor 568-labeled goat antirat immunoglobulin G (1:1000, Invitrogen) at room temperature for 2 hours. Stained vessels in 10 randomly chosen fields were counted in each slide at ×200 magnifications. Mean vessel density in tumors was determined by averaging the vessel counts from individual fields.

Statistical Analysis

Results are presented as mean ± standard error of the mean (SEM). Statistical analysis was carried out using Student t test, analysis of variance, or Student-Newman-Keuls test for multiple comparisons (using SPSS 10.0). P values <.05 were considered significant.

Results

Hypoxia Increases Expression of HIF-1α Protein and HIF-1 Target Genes

The HIF-1α protein expression was assessed in HT-29 cells under normoxic and hypoxic conditions by Western blotting. Expression of HIF-1α protein in HT-29 was very weak under normoxic condition, whereas it is accumulated in HT-29 exposed to hypoxia for 48 hours (Figure 1A). The mRNA levels of HIF-1α and its target genes in HT-29 were determined by real-time RT-PCR (Figure 1B and 1C). The HIF-1α mRNA levels remained similar in HT-29 cell cultured under normoxic and hypoxic conditions, whereas the mRNA levels of VEGF, GLUT-1, and P-gp increased in HT-29 under hypoxia condition for 48 hours (all P < .05 vs normoxia group).

Figure 1.

Figure 1.

Vector-based RNAi system reduced the expression of HIF-1α in HT-29 cells. The HT-29 cells stably transfected with or without HIF-1α shRNAs were treated in normoxia and/or hypoxia (1% O2) as indicated. A, The protein levels of HIF-1α were analyzed by Western blot after 48-hour treatments. β-Actin was used as control. B, HIF-1α mRNA levels were analyzed by qRT-PCR after 48-hour treatments. C, The mRNA levels of downstream target genes of HIF-1α, that is, VEGF, GLUT-1, and P-gp, in nontransfected HT-29 cells were analyzed by qRT-PCR after 48-hour treatments. *Significant differences; **highly significant differences. GLUT-1 indicates glucose transporter; HIF-1α, hypoxia-inducible factor-1α; mRNA, messenger RNA; P-gp, P-glycoprotein; qRT-PCR, quantitative reverse transcription polymerase chain reaction; RNAi, RNA interference; shRNAs, short hairpin RNAs; VEGF, vascular endothelial growth factor.

Effective Knockdown of HIF-1α Expression by shRNA

Three random clones from either HT-29-ih or HT-29-c group were used in all the experiments, and no significant differences among different clones were observed (data not shown). So that data from only one of them in each group were shown in this article. The HIF-1α mRNA levels in the HT-29-ih were significantly repressed, whereas that in the scramble control group (HT-29-c) remained similar to that in parental HT-29 cells. Exposure to hypoxia had no effect on knockdown efficiency in either HT-29-ih or HT-29-c groups (Figure 1B). The HIF-1α in HT-29-ih cells was undetectable under both normoxic and hypoxic conditions, whereas that in HT-29 or HT-29-c cells was significantly upregulated when cells were cultured under hypoxic condition (Figure 1A).

Downregulation of HIF-1α Target Gene Expression by Knockdown of HIF-1α

The HIF-1α mRNA and protein in HT-29-ih cells were diminished under both normoxia and hypoxia, whereas HIF-1α protein in HT-29-c was significantly increased under hypoxia comparing to normoxia (data shown above). We further explored the expression of HIF-1α downstream target genes including VEGF, GLUT-1, and P-gp in HT-29-ih and control cells under hypoxia. The quantitative real-time RT-PCR showed that the mRNA levels of VEGF, GLUT-1, and P-gp were significantly decreased in HT-29-ih comparing to HT-29-c cells under hypoxic condition (Figure 2; P < .05). No significant difference in HIF-1β mRNA expression was seen between HT-29-ih and HT-29-c, demonstrating the specificity of HIF-1α RNAi system used in this study.

Figure 2.

Figure 2.

Downregulation of expression of HIF-1α target genes by knockdown of HIF-1α. After 48-hour exposure to 1% O2, the mRNA levels of HIF-1α, VEGF, GLUT-1, P-gp, and HIF-1β in HT-29-c and HT-29-ih cells were detected by real-time Q-PCR analysis normalized by β-actin. Folds of expression values of HT-29-ih cells were compared to HT-29-c cells. Assays were triplicated. *Significant differences; **highly significant differences. GLUT-1 indicates glucose transporter; HIF-1α, hypoxia-inducible factor-1α; mRNA, messenger RNA; P-gp, P-glycoprotein; Q-PCR, quantitative polymerase chain reaction; VEGF, vascular endothelial growth factor.

Downregulation of VEGF Protein In Vitro by Knockdown of HIF-1α

The VEGF is highly involved in tumor angiogenesis, and its expression is increased in tumor cells especially when tumor cells grow under hypoxic condition,38 which is one of the mechanisms of chemoresistance. We aimed to address how the expression of VEGF protein was influenced by HIF-1α knockdown in cells cultured under normoxic and hypoxic conditions. Specific immunoassay for VEGF was used to determine the concentrations of VEGF in conditioned medium and cell lysates. As shown in Figure 3A and B, the concentrations of VEGF were not significantly different between HT-29-ih and HT-29-c under normoxic condition. After cells were cultured at 1% O2 for 48 hours, VEGF protein levels in either HT-29-ih or HT-29-c groups were significantly higher than those in normoxia (P < .05 for both). More interestingly, VEGF protein level in HT-29-c was markedly higher than that in HT-29-ih cells (P < .05). These data demonstrate that HIF-1α knockdown in HT-29-ih cells partially represses the production of VEGF induced by hypoxia.

Figure 3.

Figure 3.

Downregulation of VEGF synthesis and secretion in vitro by knockdown of HIF-1α. The HT-29-c and HT-29-ih cells were incubated under normoxic or hypoxic conditions for 48 hours. A, Protein levels of VEGF in cell lysate were detected by Western blot, and data represent 3 independent assays. B, Protein concentrations of VEGF in culture medium were measured by ELISA and normalized by cell numbers. Data represent 3 independent experiments. *Significant differences. ELISA indicates enzyme-linked immunosorbent assay; HIF-1α, hypoxia-inducible factor-1α; VEGF, vascular endothelial growth factor.

Knockdown of HIF-1α Has Significant Impact on Proliferation, Apoptosis, and Invasiveness of HT29 Cells

Phenotypic changes upon knockdown of HIF-1α in HT-29 were examined using various functional assays. The viability of transfected cell was measured using CCK-8 assay. The HT-29-ih has significantly lower viability compared with HT-29-c, indicating that knockdown of HIF-1α significantly reduces cell proliferation (Figure 4A). In addition to the inhibitory effect on cell proliferation, HIF-1α knockdown also induces apoptosis in HT-29 (Figure 4B). The enhanced cell motility and invasiveness is highly indicative of malignant progression, which was determined in this study by Transwell invasion assay. The HT-29-ih had a reduction of around 70% in invasion, compared with that of HT-29-c (Figure 4C and D). Besides, the expression alternations of Vimentin, E-cadherin, Bcl-2, and Bax protein, which was associated with cell invasion and apoptosis, were detected (Figure 4E). Results showed that E-cadherin protein expression was upregulated while Vimentin expression was downregulated in response to HIF-1α knockdown. In addition, the ration of Bcl-2/Bax protein was downregulated. These data showed that HIF-1α knockdown could inhibit cell proliferation and invasion and induce cell apoptosis through acting on these proteins.

Figure 4.

Figure 4.

Knockdown of HIF-1α mediates significant impact on proliferation, apoptosis, and invasion of HT29 cells. The HT-29-c and HT-29-ih cells were incubated under hypoxic conditions for 48 hours. A, The proliferation rates of transfected cells were assessed by CCK-8 and calculated according to the optical density values. B, Cellular apoptosis in 2 groups were stained by TUNEL assay. C and D, The invasion ability of cells was tested by Transwell assay with Matrigel. Trypan-staining figures and cell-counting data were presented. *Significant differences. CCK-8 indicates Cell Counting Kit-8; HIF-1α, hypoxia-inducible factor-1α; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling. E, the expression of Vimentin, E-cadherin, Bcl-2 and Bax were determined by Western blotting.

Combinational HIF-1α shRNA and Paclitaxel LDM Therapy Enhances Antitumor Activity

The LDM chemotherapy has been proven to be more effective than MTD therapy, especially in regard to targeting endothelial cells of tumor vasculature and delaying tumor progression.5,10 Recent studies showed that antiangiogenic therapy may cause tumor hypoxia and resulted in substantial elevation of HIF-1α expression in tumor cells.28 We further tested whether knockdown of HIF-1α using HIF-1α shRNA or combinational HIF-1α shRNA and LDM chemotherapy with paclitaxel has enhanced antitumor activities in vivo. Xenograft tumor models showed that HT-29-ih-resulted tumor grows dynamically slower than HT-29-c at any indicated time point. As shown in Figure 5, the tumors in the HT-29-c-saline group reached 2000 ± 179 mm3 in 42 days after implantation, whereas the tumors in the HT-29-ih saline group at the same time point were 1532 ± 179 mm3. The difference was statistically significant as tested by unpaired Student t test (P < .05). Both chemotherapies used in this study (HT-29-c LDM and HT-29-c MTD) effectively suppressed tumor growth compared with nonchemotherapy group—but LDM therapy is more effective than MTD. The tumor sizes reached 2000 ± 179 mm3, 1371 ± 191 mm3, and 883 ± 117 mm3 at 42 days after implantation in the HT-29-c saline, HT-29-c MTD, and HT-29-c LDM groups, respectively (P < .05). Knockdown of HIF-1α by HIF-1α shRNA substantially delayed tumor growth. The suppression on tumor growth is further enhanced when either LDM or MTD therapy was used in combination with HIF-1α shRNA in this study. The tumors size was 2000 ± 179 mm3, 1208 ± 140 mm3, and 524 ± 143 mm3 at 42 days after implantation in the HT-29-c saline, HT-29-ih MTD, and HT-29-ih LDM groups, respectively (P < .05). Combination of HIF-1α shRNA and LDM chemotherapy with paclitaxel was the most effective against HT-29-resulted tumor in any therapeutic regime used in this study. The combination of HIF-1α shRNA and MTD chemotherapy only displayed marginal increase in antitumor activities compared with MTD alone, whereas the combination of HIF-1α shRNA and LDM chemotherapy showed significantly increasing antitumor activities compared with LDM alone.

Figure 5.

Figure 5.

Combinational HIF-1α shRNA and paclitaxel LDM therapy enhances antitumor activity. The HT-29 xenograft tumors were established in BALB/c nude mice and grouped into 6 treatment groups: HT-29-c saline, HT-29-ih saline, HT-29-c MTD, HT-29-ih MTD, HT-29-c LDM, and HT-29-ih LDM. Tumor sizes were recorded and compared every 7 days for up to 56 days after implantation as shown above. *Significant differences of tumor volumes from the HT-29-c saline group; #significant differences from the HT-29-ih MTD group; and ‡significant differences from the HT-29-c LDM group. HIF-1α indicates hypoxia-inducible factor-1α; LDM, low-dose metronomic; MTD, maximum tolerated dose; shRNA, short hairpin RNA.

Angiogenesis of Tumors Treated by Different Therapies

To understand the mechanisms by which HIF-1α knockdown suppresses tumor growth and to improve LDM treatment efficacy, we studied microvessel densities in tumor tissues dissected from xenograft models under various therapeutic regimes. The HIF-1α knockdown resulted in dramatic reduction in microvessel densities (Figure 6A, B, and G). The average microvessel densities were 10.6 ± 4.1 and 8.1 ± 3.4/field in HT-29-c- and HT-29-ih-derived tumors, respectively. The difference was statistically significant as tested by unpaired Student t test. The LDM therapy alone was more effective on reduction of tumor angiogenesis than HIF-1α silencing by shRNA. The average microvessel densities were 8.1 ± 3.4 and 4.0 ± 1.9/field in the HT-29-ih saline and HT-29-c LDM groups, respectively (P < .05; Figure 6B, E, and G). The HIF-1α shRNA and LDM therapy resulted in average reduction of about 25% and 65% of microvessel densities of nontreated, control tumors (HT-29-c saline group), respectively (Figure 6A, B, E, and G). The MTD therapy alone had no impact on suppression of tumor angiogenesis. The microvessel densities were similar in tumors derived from the HT-29-c MTD group compared with those from the HT-29-c saline group (Figure 6A and C). The combined therapy of HIF-1α shRNA with LDM almost completely diminished microvessel and reduced about 80% of untreated tumors in this study (Figure 6F and G). The microvessel densities were the lowest in tumors from any groups tested by multivariable analysis (P < .01). The average microvessel densities were 11.2 ± 4.1, 8.2 ± 3.4, 4.0 ± 1.9, and 2.1 ± 1.8/field in untreated tumors (HT-29-c saline), HIF-1α shRNA (HT-29-ih saline) or LDM (HT-29-c LDM) alone, combinational therapy of HIF-1α shRNA, and LDM (HT-29-ih LDM), respectively.

Figure 6.

Figure 6.

Angiogenesis of tumors treated by different therapies. A-F, Tumor specimens from the mice in the HT-29-c saline (A), HT-29-ih saline (B), HT-29-c MTD (C), HT-29-ih MTD (D), HT-29-c LDM (E), and HT-29-ih LDM (F) groups were prepared and stained with an anti-CD31 Ab, 42 days after implantation (200×). G, The microvessel numbers were counted to calculate microvessel density. **Highly significant differences from HT-29-c saline; #significant differences from the HT-29-ih MTD group. LDM indicates low-dose metronomic; MTD, maximum tolerated dose.

Hypoxia-Inducible Factor-1α shRNA and LDM Therapies Have Low Side Effects

Most of the side effects from chemotherapy are due to inhibiting the proliferation of rapidly dividing noncancer cells, such as bone marrow cells or intestinal mucosa damage, resulting in significant loss of WBCs and body weight due to poor intake of food. In the present study, LDM therapy with paclitaxel alone showed less degree in loss of body weight and reduction of WBC count than MTD therapy. Paclitaxel LDM therapy caused slighter damage on small intestines, which was as shown in Figure 7A, the 6 groups of mice had similar body weight in the beginning. However, about 2 weeks after initiation of therapies, obvious decrease in body weight was observed in the HT-29-c MTD and HT-29-ih MTD groups, partially associated with diarrhea. Forty-two days after tumor implantation, the average body weight of mice in the HT-29-c MTD group and HT-29-ih group was 18.9 ± 0.3 g and 18.5 ± 0.4 g, respectively, lower than that of the mice in the control (22.2 ± 0.3 g), HT-29-c LDM (21.2 ± 0.3 g), and HT-29-ih LDM (21.4 ± 0.5 g) groups (all P < .05). Similarly, as shown in Figure 7B, marked reduction in WBC counts was observed in mice in 2 MTD groups. However, no significant differences in either body weight records or WBC quantities were observed among the other 4 groups, revealing that LDM could induce less side effects than MDT therapy.

Figure 7.

Figure 7.

The HIF-1α shRNA and LDM therapies have low side effects. A, Body weight of HT-29 xenograft mice was recorded and compared. B, Blood samples were collected at indicated time points, and white blood cells were quantified and statistically analyzed. *Significant differences of body weight or the amounts of white blood cell from the HT-29-c saline group. HIF-1α indicates hypoxia-inducible factor-1α; LDM, low-dose metronomic; shRNA, short hairpin RNA.

Discussion

It has recently been clarified that tumor endothelial cells are sensitive to conventional cytotoxic drugs if the regimen doses are altered. The concept of metronomic chemotherapy has been testified in preclinical animal tumor models.38 While targeting the proliferating endothelial cells in tumors, like most common chemotherapies, traditional MTD regimens, due to its obligatory rest periods, are thought to allow the recovery of endothelial cells, during which the activation of intact p53-based damage sensor could cause G1 arrest of cell cycle for DNA repairment diminishing the antiangiogenic effects of the treatment consequently. Interestingly, it is reported that metronomic cisplatin therapy-related aggravation of tumor hypoxia does stimulate tumor growth due to the increased expressions of VEGF and tumor cell-associated epidermal growth factor receptors. Accounting for this, a more frequent administration of low-dose cytotoxic agents without breaks is developed to inhibit tumors indirectly by suppressing angiogenesis, instead of targeting tumor cells. For instance, LDM chemotherapy may offer several advantages over the MTD approach, including its reduced cytotoxicity and less drug resistance reports.39 Hence, we established a combined treatment of empirical metronomic paclitaxel regimen with HIF-1α knockdown to explore a novel therapeutic procedure of cancers in the present study, and the results revealed significant and durable antitumor responses of this therapy without overt toxicity.

In our study, the potential therapeutic value of metronomic chemotherapy was further confirmed suggesting a novel synergetic strategy of its antiangiogenic function by knocking down HIF-1α. Few toxic effects of LDM-used groups were observed during the treatment period. More importantly, these preclinical results might also explain some clinical cases in which patients irresponsive to standard MTD chemotherapy could show responses to the same drug but at a lower dose and with a higher administration frequency. In the past, such modifications were used mainly for palliation to reduce its severe side effects.

Previous studies of the inhibitory effects of HIF-1α on tumor growth failed to reach consistent results, possibly due to multiple functions of HIF-1α in different contexts of genes, tumor types, and experimental approaches.40–43 In this study, we validated the role of HIF-1α in colon tumor growth by RNAi and the possible mechanisms. As results, disruption of the HIF-1α pathway alone provoked a significant retardation of tumor growth but failed to completely eliminate the process. Well known as a key regulator of angiogenesis, VEGF has long been supposed to function in the oncogenic activities of HIF-1α. Consistent with HIF-1α knockdown, statistically significant decreases in VEGF expression were observed at both mRNA protein levels during hypoxia in vitro. The E-cadherin protein expression was upregulated, whereas Vimentin expression was downregulated in response to HIF-1α interference. In addition, the ration of Bcl-2/Bax protein was downregulated, suggesting that HIF-1α interference could inhibit cell proliferation and invasion and induce cell apoptosis through the effect on these proteins. Decreased angiogenesis levels in HIF-1α knockdown xenografts were also visualized by CD31 immunostaining. However, several recent studies have also pointed out that in some tumor types, it is the tumor growth rate that was slowed by HIF-1α pathway disruption while angiogenesis unaffected. Ryan et al43 proved that the loss of HIF-1α in H-ras-transformed cell lines negatively affected tumor expansion via mechanisms unrelated to its regulatory role in VEGF expression. Subcutaneous xenografts of DLD-1 cells, a HIF-1α knockdown colon cancer cell line, showed impaired tumor growth rate with unchanged microvessel densities, compared with wild-type tumors.44 Thus, oncogenic effects of HIF-1α might not be entirely attributed to its impacts on VEGF expression. Additional mechanisms must have existed in HIF-1α-regulated tumor growth, which we are addressing in our ongoing studies.

In conclusion, the results presented here have evaluated a more effective and safer strategy for tumor treatment using paclitaxel LDM chemotherapy combined with HIF-1α knockdown in respect of its suppressive functions on tumor growth and the side effects in xenograft tumor models of HT-29 cells. Despite potential advantages of metronomic therapeutic approach, especially when integrated with HIF-1α knockdown, several challenges must be overcome to verify its entire benefits in the clinic, such as low and schedule optimization. Further preclinical studies and clinical trials will hopefully provide answers for these and similar questions about the application of antiangiogenic therapies to malignant colon cancers.

Abbreviations

CCK-8

Cell Counting Kit-8

cDNA

complementary DNA

GLUT-1

glucose transporter 1

HIF-1α

hypoxia-inducible factor-1α

LDM

low-dose metronomic

mRNA

messenger RNA

MTD

maximum tolerated dose

P-gp

P-glycoprotein

Q-PCR

quantitative polymerase chain reaction

qRT-PCR

quantitative reverse transcription polymerase chain reaction

RNAi

RNA interference

SEM

standard error of the mean

shRNAs

short hairpin RNAs

TUNEL

terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling

VEGF

vascular endothelial growth factor

WBC

white blood cells.

Footnotes

Declaration of Conflicting Interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The work was supported by the National Natural Science Foundation of China, (81301972).

References

  • 1. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87–108. [DOI] [PubMed] [Google Scholar]
  • 2. Braun AH, Achterrath W, Wilke H, Vanhoefer U, Harstrick A, Preusser P. New systemic frontline treatment for metastatic colorectal carcinoma. Cancer. 2004;100(8):1558–1577. [DOI] [PubMed] [Google Scholar]
  • 3. Morse MA. Adjuvant therapy of colon cancer: current status and future developments. Clin Colon Rectal Surg. 2005;18(3):224–231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Yamaguchi K, Ogata Y, Akagi Y, Shirouzu K. Identification of high-risk factors as indicators for adjuvant therapy in stage II colon cancer patients treated at a single institution. Oncol Lett. 2013;6(3):659–666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Kim JJ, Tannock IF. Repopulation of cancer cells during therapy: an important cause of treatment failure. Nat Rev Cancer. 2005;5(7):516–525. [DOI] [PubMed] [Google Scholar]
  • 6. Gasparini G. Metronomic scheduling: the future of chemotherapy? Lancet Oncol. 2001;2(12):733–740. [DOI] [PubMed] [Google Scholar]
  • 7. Bocci G, Nicolaou KC, Kerbel RS. Protracted low-dose effects on human endothelial cell proliferation and survival in vitro reveal a selective antiangiogenic window for various chemotherapeutic drugs. Cancer Res. 2002;62(23):6938–6943. [PubMed] [Google Scholar]
  • 8. Jary M, Borg C, Bouché O, Kim S, André T, Bennouna J. Anti-angiogenic treatments in metastatic colorectal cancer: does a continuous angiogenic blockade make sense? B Cancer. 2015;102(9):758–771. [DOI] [PubMed] [Google Scholar]
  • 9. Klement G, Baruchel S, Rak J, et al. Continuous low-dose therapy with vinblastine and VEGF receptor-2 antibody induces sustained tumor regression without overt toxicity. J Clin Invest. 2000;105(8):R15–R24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Rozados VR, Sanchez AM, Gervasoni SI, Berra HH, Matar P, Graciela Scharovsky O. Metronomic therapy with cyclophosphamide induces rat lymphoma and sarcoma regression, and is devoid of toxicity. Ann Oncol. 2004;15(10):1543–1550. [DOI] [PubMed] [Google Scholar]
  • 11. Orlando L, Cardillo A, Rocca A, et al. Prolonged clinical benefit with metronomic chemotherapy in patients with metastatic breast cancer. Anticancer Drug. 2006;17(8):961–967. [DOI] [PubMed] [Google Scholar]
  • 12. Sheng Sow H, Mattarollo SR. Combining low-dose metronomic chemotherapy with anticancer vaccines: a therapeutic opportunity for lymphomas. Oncoimmunol. 2013;2(12):e27058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Spugnini EP, Buglioni S, Carocci F, et al. High dose lansoprazole combined with metronomic chemotherapy: a phase I/II study in companion animals with spontaneously occurring tumors. J Transl Med. 2014;12:1491–1495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Drevs J, Fakler J, Eisele S, et al. Antiangiogenic potency of various chemotherapeutic drugs for metronomic chemotherapy. Anticancer Res. 2004;24(3a):1759–1763. [PubMed] [Google Scholar]
  • 15. Xiong YQ, Sun HC, Zhang W, et al. Human hepatocellular carcinoma tumor-derived endothelial cells manifest increased angiogenesis capability and drug resistance compared with normal endothelial cells. Clin Cancer Res. 2009;15(15):4838–4846. [DOI] [PubMed] [Google Scholar]
  • 16. Ng SS, Sparreboom A, Shaked Y, et al. Influence of formulation vehicle on metronomic taxane chemotherapy: albumin-bound versus cremophor EL-based paclitaxel. Clin Cancer Res. 2006;12(14 pt 1):4331–4338. [DOI] [PubMed] [Google Scholar]
  • 17. Jiang H, Tao W, Zhang M, Pan S, Kanwar JR, Sun X. Low-dose metronomic paclitaxel chemotherapy suppresses breast tumors and metastases in mice. Cancer Invest. 2010;28(1):74–84. [DOI] [PubMed] [Google Scholar]
  • 18. Klement G, Huang P, Mayer B, et al. Differences in therapeutic indexes of combination metronomic chemotherapy and an anti-VEGFR-2 antibody in multidrug-resistant human breast cancer xenografts. Clin Cancer Res. 2002;8(1):221–232. [PubMed] [Google Scholar]
  • 19. Kizaka-Kondoh S, Inoue M, Harada H, Hiraoka M. Tumor hypoxia: a target for selective cancer therapy. Cancer Sci. 2003;94(12):1021–1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Semenza GL. Hypoxia-inducible factor 1 (HIF-1) pathway. Sci STKE. 2007;2007(407):cm8. [DOI] [PubMed] [Google Scholar]
  • 21. Plavetić ND, Pleština S. Hypoxia in solid tumors: biological responses to hypoxia and implications on therapy and prognosis. Period Biol. 2014;116(4):361–364. [Google Scholar]
  • 22. Bardos JI, Ashcroft M. Negative and positive regulation of HIF-1: a complex network. Biochim Biophys Acta. 2005;1755(2):107–120. [DOI] [PubMed] [Google Scholar]
  • 23. Greijer AE, van der Wall E. The role of hypoxia inducible factor 1 (HIF-1) in hypoxia induced apoptosis. J Clin Pathol. 2004;57(10):1009–1014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Semenza GL, Shimoda LA, Prabhakar NR. Regulation of gene expression by HIF-1. Novartis Found Symp. 2006;272:2–8. [PubMed] [Google Scholar]
  • 25. Tang CM, Yu J. Hypoxia-inducible factor-1 as a therapeutic target in cancer. J Gastroen Hepatol. 2013;28(3):401–405. [DOI] [PubMed] [Google Scholar]
  • 26. Semenza GL. Targeting HIF-1 for cancer therapy. Nat Rev Cancer. 2003;3(10):721–732. [DOI] [PubMed] [Google Scholar]
  • 27. Quintero M, Mackenzie N, Brennan PA. Hypoxia-inducible factor 1 (HIF-1) in cancer. Eur J Surg Oncol. 2004;30(5):465–468. [DOI] [PubMed] [Google Scholar]
  • 28. Mazure NM, Brahimi-Horn MC, Berta MA, et al. HIF-1: master and commander of the hypoxic world. A pharmacological approach to its regulation by siRNAs. Biochem Pharmacol. 2004;68(6):971–980. [DOI] [PubMed] [Google Scholar]
  • 29. Semenza GL. Evaluation of HIF-1 inhibitors as anticancer agents. Drug Discov Today. 2007;12(19-20):853–859. [DOI] [PubMed] [Google Scholar]
  • 30. Semenza GL. Development of novel therapeutic strategies that target HIF-1. Expert Opin Ther Targets. 2006;10(2):267–280. [DOI] [PubMed] [Google Scholar]
  • 31. Liu F, Wang P, Jiang X, et al. Antisense hypoxia-inducible factor 1alpha gene therapy enhances the therapeutic efficacy of doxorubicin to combat hepatocellular carcinoma. Cancer Sci. 2008;99(10):2055–2061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Xue SB, Wang D, Liu W. Recent advances in the correlation studies of hypoxia inducible factor 1 and hypoxia pulmonary artery hypertension. Med Recapitulate. 2013;19(19):3474–3477. [Google Scholar]
  • 33. Elbashir SM, Harborth J, Weber K, Tuschl T. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods. 2002;26(2):199–213. [DOI] [PubMed] [Google Scholar]
  • 34. Tuschl T. RNA interference & small interfering RNAs. Chembiochem. 2001;2(4):239–245. [DOI] [PubMed] [Google Scholar]
  • 35. Zhao Z, Liao L, Cao Y, Jiang X, Zhao RC. Establishment and properties of fetal dermis-derived mesenchymal stem cell lines: plasticity in vitro and hematopoietic protection in vivo. Bone Marrow Transplant. 2005;36(4):355–365. [DOI] [PubMed] [Google Scholar]
  • 36. Inoue K, Slaton JW, Perrotte P, et al. Paclitaxel enhances the effects of the anti-epidermal growth factor receptor monoclonal antibody ImClone C225 in mice with metastatic human bladder transitional cell carcinoma. Clin Cancer Res. 2000;6(12):4874–4884. [PubMed] [Google Scholar]
  • 37. Gibson UE, Heid CA, Williams PM. A novel method for real time quantitative RT-PCR. Genome Res. 1996;6(10):995–1001. [DOI] [PubMed] [Google Scholar]
  • 38. Koizumi T, Abe MT, Ohizumi Y, Hitotsuyanagi Y, Takeya K, Sato Y. Metronomic scheduling of a cyclic hexapeptide RA-VII for anti-angiogenesis, tumor vessel maturation and anti-tumor activity. Cancer Sci. 2006;97(7):665–674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Kerbel RS, Kamen BA. The anti-angiogenic basis of metronomic chemotherapy. Nat Rev Cancer. 2004;4(6):423–436. [DOI] [PubMed] [Google Scholar]
  • 40. Carmeliet P, Dor Y, Herbert JM, et al. Role of HIF-1 alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature. 1998;394(6692):485–490. [DOI] [PubMed] [Google Scholar]
  • 41. Stoeltzing O, McCarty MF, Wey JS, Fan F, Liu W, Belcheva A. Role of hypoxia-inducible factor 1 alpha in gastric cancer cell growth, angiogenesis, and vessel maturation. J Natl Cancer Inst. 2004;96(12):946–956. [DOI] [PubMed] [Google Scholar]
  • 42. Dang DT, Chen F, Gardner LB, et al. Hypoxia-inducible factor-1 alpha promotes nonhypoxia-mediated proliferation in colon cancer cells and xenografts. Cancer Res. 2006;66(3):1684–1693. [DOI] [PubMed] [Google Scholar]
  • 43. Ryan HE, Poloni M, McNulty W, et al. Hypoxia-inducible factor-1 alpha is a positive factor in solid tumor growth. Cancer Res. 2000;60(15):4010–4015. [PubMed] [Google Scholar]
  • 44. Mizukami Y, Jo WS, Duerr EM, et al. Induction of interleukin-8 preserves the angiogenic response in HIF-1 alpha-deficient colon cancer cells. Nat Med. 2005;11(9):992–997. [DOI] [PubMed] [Google Scholar]

Articles from Technology in Cancer Research & Treatment are provided here courtesy of SAGE Publications

RESOURCES