Skip to main content
BMC Genomics logoLink to BMC Genomics
. 2017 Nov 2;18:840. doi: 10.1186/s12864-017-4237-x

The complete mitochondrial genome of parasitic nematode Camallanus cotti: extreme discontinuity in the rate of mitogenomic architecture evolution within the Chromadorea class

Hong Zou 1, Ivan Jakovlić 2, Rong Chen 2, Dong Zhang 1,3, Jin Zhang 2, Wen-Xiang Li 1,✉, Gui-Tang Wang 1
PMCID: PMC5669012  PMID: 29096600

Abstract

Background

Complete mitochondrial genomes are much better suited for the taxonomic identification and phylogenetic studies of nematodes than morphology or traditionally-used molecular markers, but they remain unavailable for the entire Camallanidae family (Chromadorea). As the only published mitogenome in the Camallanina suborder (Dracunculoidea superfamily) exhibited a unique gene order, the other objective of this research was to study the evolution of mitochondrial architecture in the Spirurida order. Thus, we sequenced the complete mitogenome of the Camallanus cotti fish parasite and conducted structural and phylogenomic comparative analyses with all available Spirurida mitogenomes.

Results

The mitogenome is exceptionally large (17,901 bp) among the Chromadorea and, with 46 (pseudo-) genes, exhibits a unique architecture among nematodes. Six protein-coding genes (PCGs) and six tRNAs are duplicated. An additional (seventh) tRNA (Trp) was probably duplicated by the remolding of tRNA-Ser2 (missing). Two pairs of these duplicated PCGs might be functional; three were incomplete and one contained stop codons. Apart from Ala and Asp, all other duplicated tRNAs are conserved and probably functional. Only 19 unique tRNAs were found. Phylogenomic analysis included Gnathostomatidae (Spirurina) in the Camallanina suborder.

Conclusions

Within the Nematoda, comparable PCG duplications were observed only in the enoplean Mermithidae family, but those result from mitochondrial recombination, whereas characteristics of the studied mitogenome suggest that likely rearrangement mechanisms are either a series of duplications, transpositions and random loss events, or duplication, fragmentation and subsequent reassembly of the mitogenome. We put forward a hypothesis that the evolution of mitogenomic architecture is extremely discontinuous, and that once a long period of stasis in gene order and content has been punctuated by a rearrangement event, such a destabilised mitogenome is much more likely to undergo subsequent rearrangement events, resulting in an exponentially accelerated evolutionary rate of mitogenomic rearrangements. Implications of this model are particularly important for the application of gene order similarity as an additive source of phylogenetic information. Chromadorean nematodes, and particularly Camallanina clade (with C. cotti as an example of extremely accelerated rate of rearrangements), might be a good model to further study this discontinuity in the dynamics of mitogenomic evolution.

Electronic supplementary material

The online version of this article (doi: 10.1186/s12864-017-4237-x) contains supplementary material, which is available to authorized users.

Keywords: Gene order rearrangement, Gene duplication, tRNA duplication, Incomplete tRNA set, tRNA remolding, TDRL, Pseudogenes, Mitochondrial phylogenomics, Spirurida, Camallanina

Background

Metazoan invertebrate phylum Nematoda is likely to comprise as much as 90% of all living multicellular organisms [1–3]. Because of the parasitic lifestyles of many nematodes, which cause numerous human diseases and large financial losses to agriculture and livestock rearing, as well as their use as biodiversity indicators and model organisms (e.g. Caenorhabditis), nematodes have attracted ample scientific attention [4, 5]. Prior to the application of molecular data, nematode taxonomy and phylogeny relied on a very limited number of morphological characters and ecological features. This, along with the absence of informative fossil records [5, 6] and pervasive convergent evolution, has resulted in very poorly resolved and often inconsistent classification systems [2, 5, 7]. Thus, molecular data are much better suited for identification and phylogenetic studies of nematodes. The most often used genetic marker for this type of studies in nematodes is 18S rRNA (or nSSU) [1, 2, 5]. However, since the number of nematode taxa will soon exceed the number of nucleotides in this gene, it can be safely argued that even the theoretical resolving power of this approach is insufficient for the task [3]. Thus a marker with much higher resolving power shall have to be adopted by future studies. Complete mitogenomes appear as a strong candidate, as they can provide a phylogenetic resolution superior to the traditionally used molecular markers and precise divergence date estimates, and thus are becoming the marker of choice for the resolution of taxonomic controversies [2, 8–13].

The mitochondrion is a eukaryotic organelle descended about 1,000,000,000 years ago from an α-proteobacterium [14, 15], whose major function in the organism is energy production. Mitochondria contain their own genomes with a modified genetic code, which are usually very compact (no introns, little intergenic DNA, and most genes show signs of selection for small size) and highly conserved in terms of gene content and organisation [10, 16–18]. Mitogenomes of nematodes, however, are characterized by relatively frequent gene rearrangements [2, 7, 13], unique initiation codons [19, 20], fast nucleotide substitution rate, unconventional tRNAs [10], and sometimes even unique organisation [21, 22], which makes them a promising model for studying the mechanisms of mitochondrial gene rearrangements and genome architecture evolution [9]. So far, however, the main obstacle to their broad application has been a limited availability of sequenced mitochondrial genomes. Even though the number of complete mitogenomes deposited in public databases has grown exponentially during the last few years, many taxonomic categories remain poorly or not at all represented.

Among the non-represented taxa is the entire Camallanoidea superfamily (Camallanina suborder, Spirurida order, Chromadorea class). Spirurida order is composed of Spirurina and Camallanina suborders, the latter of which contains only Camallanoidea and Dracunculoidea superfamilies. Camallanidae (the only Camallanoidea family) are almost globally-distributed gastrointestinal parasites of poikilothermic vertebrates [1]. Only two Camallanus species parasitising Chinese freshwater fish are currently recognised: C. cotti and C. hypophthalmichthys [23]. The former, C. cotti (Fujita 1927; synonyms: C. zacconis Li 1941 and C. fotedari Raina & Dhar 1972) parasitises a large number of fish species, mostly belonging to Cypriniformes, Siluriformes and Perciformes orders [24]. Although native to Asia, as a result of the trade of ornamental fishes and the introduction of various poeciliids for mosquito control, it has become almost globally distributed during the last few decades [24, 25]. Its cosmopolitan dispersal, relatively high pathogenicity [24] and exceptional life history flexibility [25] have garnered ample scientific attention.

Single molecular markers, such as internal transcribed spacer of ribosomal DNA, have been employed to infer the phylogenetic relationships of Camallanidae [1, 23], but due to previously described limitations of this approach, phylogeny of this family and the entire Camallanina clade is poorly understood. Sequencing of the complete mitochondrial genome of C. cotti, and the associated phylogenomic analysis using all available mitogenomes belonging to Spirurida order, are meant to address this problem. More importantly, as both mitochondrial genomes that are currently available for the entire Camallanina suborder, Philometroides sanguineus [26] and Dracunculus medinensis (unpublished), exhibit unique gene orders [26, 27], we hypothesised that this mitogenomic architecture might be idiosyncratic to the entire Camallanina suborder. To establish whether the unique Dracunculoidea architecture is shared with the sister superfamily Camallanoidea, and thus contribute to the understanding of the evolution of mitochondrial genomic architecture of nematodes, we have sequenced and characterised the mitogenome of C. cotti and compared it structurally to the available Spirurida mitogenomes.

Results and discussion

The mitochondrial genome of C. cotti possesses a large number of duplicated genes, which makes it structurally unique among the nematodes. The mitogenome is accessible from the GenBank under the accession number MF580344. To make sure that these duplicated sequences are not artefacts from our own PCR amplification or numts [28], we have extracted DNA from an additional C. cotti specimen and amplified, sequenced and assembled its entire genome anew. The sequences were identical, apart from the minor variations expected among individual mitogenomes [29], thus excluding the possibility of a mistake in the sequencing and assembly process. Unfortunately, these two nematodes were obtained from the same fish specimen, so we cannot directly exclude the possibility of this unique architecture being a lineage-specific phenomenon. If identical, or very similar, architecture is not observed in other Camallanidae species in the future, it would be of interest to sequence another mitogenome belonging to this species to confirm that the architecture is species-specific.

Taxonomic identity and phylogeny

Following proposed guidelines for validation of new mitogenomes [30], along with a phylogenetic analysis using almost the entire mitogenomic sequence, we have also conducted a barcoding identification assessment using all 99 Camallanidae cox1 sequences available in the BOLD database [31]. The queried sequence was nested within the monophyletic Camallanus cotti clade (Additional file 1).

The two approaches (maximum-likelihood and Bayesian inference) used in this study to estimate the phylogenetic position of C. cotti within the Spirurida clade produced identical dendrogram topologies, so only the former is shown in Fig. 1. Statistical support values were very high, particularly in the BI analysis, where all posterior probability values were 1.0. In (partial) agreement with previous studies using both nSSU rRNA and mitochondrial phylogenomics approaches [1, 5, 27, 32]. Our results indicate that Spirurida order is divided into both morphologically [1] and genetically clearly defined Spirurina suborder, here comprised of (Physalopteridae + (Thelaziidae + (Gongylonematidae + (Setariidae [paraphyletic] + Onchocercidae)))), and a monophyletic clade comprising (Gnathostomatidae + (Camallanidae + (Dracunculidae + Philometridae))), henceforth referred to as Camallanina suborder (Fig. 1, Table 1). Sister group relationship between the Camallanoidea superfamily (Camallanidae family) and Dracunculoidea superfamily (Philometridae and Dracunculidae in this study) is well-established [1, 5, 33, 34]. Paraphyly of Thelaziidae family, and particularly the problematic taxonomy of Spirocerca and Thelazia genera was also observed before [1, 5, 27, 35]. A very similar topology of Spirurina clade, including the sister group relationship between Spirocerca and Gongylonema genera, was produced before using a smaller number of mitogenomes [32, 36]. Therefore it can be concluded with confidence that Spirocerca lupi is closely related to Gongylonema pulchrum and that it belongs to Gongylonematidae family.

Fig. 1.

Fig. 1

Phylogeny and mitogenomic architecture of the Spirurida order. Phylogenetic dendrogram constructed using gene sequences of 22 Spirurida mitochondrial genomes. Maximum likelihood and Bayesian inference approaches produced identical topologies, so only the former is shown. L. polyphemus and T. spiralis are outgroups. Scale bar corresponds to the estimated number of substitutions per site. Only the bootstrap values below 100 are shown. Mitogenomic architecture is shown to the right of the corresponding sequences. A1 and A2 are ancestral nodes. GenBank accession numbers are available in Table 1

Table 1.

Spirurida mitogenomes used for comparative and phylogenetic analyses in this study

Species name Family Accession No. Reference
Camallanus cotti Camallanidae MF580344 this study
Dracunculus medinensis Dracunculidae NC_016019 unpublished
Philometroides sanguineus Philometridae NC_024931 [26]b
Acanthocheilonema viteae Onchocercidae NC_016197 [112]
Brugia malayi NC_004298 [113]
Chandlerella quiscali NC_014486 [112]
Dirofilaria immitis NC_005305 [62]
Wuchereria bancrofti NC_016186 [112]
Loa loa NC_016199 [112]
Dirofilaria sp. ‘hongkongensis’ NC_031365 [36]
Dirofilaria repens NC_029975 unpublished
Onchocerca ochengi NC_031891 unpublished
Onchocerca volvulus NC_001861 [114]
Onchocerca flexuosa NC_016172 [112]
Setaria digitata Setariidae NC_014282 [63]
Gnathostoma spinigerum Gnathostomatidae NC_027726 [37]
Gnathostoma doloresi NC_032073 [38]
Gnathostoma nipponicum NC_034239 [38]
Heliconema longissimum Physalopteridae NC_016127 [2]
Gongylonema pulchrum Gongylonematidae NC_026687 [103]
Spirocerca lupi Thelazioidea NC_021135 [35]
Thelazia callipaeda NC_018363 [32]
Trichinella spiralisa Trichinellidae NC_002681 [50]
Limulus polyphemus a Limulidae NC_003057 [104]

aindicates outgroup

bThe reference for this sequence is about Philometra carassii (Nematoda: Philometridae). We presume that the name has been changed subsequently

Taxonomic position of the Gnathostoma genus, officially classified in the infraorder Gnathostomatomorpha of the suborder Spirurina [37], again proved to be contentious: in several studies using 18S rRNA, Gnathostomatomorpha formed a separate clade basal to all Spirurida [1, 4, 34], whereas in both studies reporting Gnathostoma mitogenomes [37, 38], phylogenomic analyses placed it within the Ascaridomorpha order. In our study, however, it formed a sister clade with (Camallanidae + (Dracunculidae + Philometridae)) within the Camallanina suborder. It is difficult to conclude which of these topologies are artefactual, as Ascaridomorpha were not included in our study. However, as Camallanina mitogenomes were not available for those two reports [37, 38], and as only amino acid sequences of protein-coding genes (PCGs) were used for their phylogenomic analyses, we suspect that the close relationship with Ascaridomorpha is an artefact likely to have been caused by long-branch attraction (LBA) [39, 40]. Amino acid sequences often exhibit too low variability in closely related species to allow a satisfactory level of phylogenetic resolution [11]. Furthermore, our results are much closer to the established phylogenetic position of Gnathostomatomorpha. Resolution of the intriguing taxonomic position of this infraorder thus warrants sequencing of further Camallanina mitogenomes, and inclusion of a much broader range of Nematoda families in future phylogenomic studies. An LBA artefact was also observed between the two outgroups used in this analysis: Limulus polyphemus (a basal arthropod) and Trichinella spiralis (a basal nematode), but it is not likely to have affected the topology of the Spirurida order.

Genome size

At 17901 bp in size, the mitogenome of C. cotti is by far the largest among the available Spirurida mitogenomes (Additional file 2). It is also exceptionally large among the chromadorean nematodes, whose mitogenomes are usually in the range between 13 and 15 Kb [9, 10]. Enoplean nematodes exhibit a much stronger heterogeneity in mitogenome size, and sizes around and over 20 Kb are not uncommon [9, 10, 13]. Although duplicated protein-coding genes are common in mitogenomes of some metazoan groups [41, 42], major variations in mitogenome sizes can usually be attributed to differences in the length of noncoding regions, rather than variations in gene content [10, 16]. In agreement with this, the few known chromadorean mitogenomes larger than C. cotti, mostly found in plant-parasitic nematodes, possess abnormally lengthy non-coding regions that harbor tandemly repeated sequences [13, 43–45]. Large duplicated coding regions haven’t been observed in chromadorean mitogenomes so far. The only comparable duplications, containing PCGs, have been observed in the enoplean family Mermithidae [45, 46]. Thus, as a vertebrate-parasitic nematode exhibiting a large number of duplicated PCGs and tRNAs (Fig. 1), C. cotti is an exception not only among chromadoreans, but also among almost all nematodes.

Genomic architecture

Most Nematoda mitogenomes contain 12 PCGs, as atp8 gene is missing in all Spirurida and other more derived nematode groups [32], 22 tRNAs and two rRNAs, but the total number of genes is relatively variable (37.6 ± 2.9) [10]. Nevertheless, with 46 (complete or pseudo) genes (Table 2), C. cotti mitogenome is (again) exceptional. All of these genes are encoded on the same strand, which is typical for Chromadorean mitogenomes [9, 10, 13]. Disregarding the duplicated genes, the mitogenome possesses all of the standard 12 PCGs and both rRNAs. However, despite our best efforts, which included careful manual searches within all intergenic regions (IGR) in the mitogenome, we could only identify 19 of the standard 22 tRNAs, with Leu1(CUN), Ser2(AGN) and Phe missing.

Table 2.

Organisation of the mitochondrial genome of Camallanus cotti

Position Codon
Gene Start End Size Start Stop Anticodon Strand IG/O
12S 1 714 714 +
tRNA-Trp-2 715 767 53 TCA +
tRNA-Asp 767 824 58 GTC + -1
pseudo-nad2 830 1640 811 ATT T-- +
tRNA-Tyr 1645 1698 54 GTA + 4
pseudo-nad1 1701 2110 410 + 2
pseudo-nad5 2390 2760 371 + 279
pseudo-tRNA-Ala 2834 2893 60 TGC + 73
tRNA-Gln 2883 2935 53 TTG + −11
tRNA-Ile 2934 2986 53 GAT + −2
cytb 2998 4081 1084 GTT T-- + 11
cox3 4126 4887 762 ATT TAA + 44
tRNA-Thr 4883 4937 55 TGT + −5
nad4 4938 6170 1233 GTT TAG +
tRNA-Trp 6170 6225 56 TCA + −1
tRNA-Asn 6226 6280 55 GTT +
tRNA-Glu 6282 6336 55 TTC + 1
pseudo-tRNA-Asp 6337 6369 33 –
nad2 6370 7180 811 ATT T-- +
tRNA-Tyr − 2 7189 7242 54 GTA + 8
nad1 7243 8118 876 TTG TAA +
tRNA-Lys 8117 8176 60 TTT + -2
tRNA-Leu2(UUR) 8177 8233 57 TAA +
tRNA-Ser1(UCN) 8234 8287 54 TCT +
atp6 8336 9002 667 TTG T-- + 48
cox1 9091 10,644 1554 TTG TAG + 88
tRNA-Cys 10,646 10,700 55 GCA + 1
tRNA-Met 10,704 10,757 54 CAT + 3
tRNA-Gly 10,758 10,813 56 TCC +
cox2 10,814 11,489 676 TTG T-- +
tRNA-His 11,493 11,543 51 GTG + 3
AT-rich 11,544 11,780 237 +
tRNA-Arg 11,781 11,833 53 ACG +
16S 11,881 12,818 938 + 47
nad3 12,808 13,141 334 TTG T-- + −11
nad5 13,142 14,725 1584 TTG TAG +
tRNA-Ala 14,750 14,803 54 TGC + 24
tRNA-Gln − 2 14,808 14,860 53 TTG + 4
tRNA-Ile-2 14,859 14,911 53 GAT + -2
cytb-2 14,909 16,007 1099 GTT T-- + −3
cox3–2 16,052 16,813 762 ATT TAA + 44
tRNA-Thr-2 16,809 16,863 55 TGT + −5
pseudo-nad4 16,879 17,121 243 + 15
tRNA-Pro 17,129 17,181 53 TGG + 7
tRNA-Val 17,181 17,239 59 TAC + −1
nad6 17,238 17,673 436 TTG T-- + −2
nad4L 17,668 17,901 234 TTG TAG + −6

IG/O: positive values indicate a non-coding intergenic segment, negative values indicate an overlap. Based on the hypothetical evolutionary history of genomic rearrangements (see Additional file 3 for details), we added a suffix ‘-2’ to the names of genes presumed to be copies of the original genes. Where sequence analysis indicated a loss of functionality, we added a prefix ‘pseudo-‘

In order to attempt to understand the evolutionary history of the unique mitogenomic architecture of C. cotti, we have compared it to other available Spirurida mitogenomes (Fig. 1). Gene order is almost perfectly conserved within the Spirurina suborder; minor exceptions are Heliconema longissimum, where tRNA-V and tRNA-M have switched places, and two species where minor rearrangements within the standard A-L2-N-M-K tRNA box can be observed: Chandlerella quiscali (M-L2-K-A-N) and Onchocerca volvulus (K-A-L2-N-M). As we suspected a possibility of an annotation artefact in H. longissimum (V and M), we have checked the two tRNAs: our results indicate that the genomic segment annotated as tRNA-Val [2] is not a functional tRNA. A deeper analysis of the entire mitogenome would be needed to determine the exact extent of its genomic architecture rearrangements.

In comparison to the Spirurina clade, genome architecture in the Camallanina clade is very different and very variable. A large number of gene rearrangements, including PCGs as well, can be observed, both between the two suborders and within the Camallanina clade. In terms of the order of PCGs (disregarding the tRNAs), three main patterns can be observed within the Camallanina clade: Gnathostomatidae pattern (perfectly conserved architecture among the three included species); Dracunculidae + Philometridae pattern exhibiting a transposition of the fragment containing nad6, nad4l and 12S rRNA genes and a large number of tRNA rearrangements (a large number of tRNA rearrangements can be also observed between the two included species, Philometroides sanguineus and Dracunculus medinensis); and finally the unique Camallanidae pattern exhibiting a large number of rearrangements in the order of PCGs, as well as PCG duplications. Whereas the mitogenomic gene order in vertebrates is almost invariant, in invertebrates it is relatively variable; however, this is mostly due to variation in the number and location of tRNAs, whereas the order of PCGs and rRNAs is considered to be stable [41]. Therefore, Camallanina clade is an intriguing outlier.

Characteristics of duplicated fragments of the mitogenome

To get a general idea about the origin and evolution of these duplicated fragments, we have compared the two nad5-A-Q-I-cytb-cox3-T-nad4 fragments (nad5-nad4 fragment henceforth). Because the two flanking genes (nad5-nad4) are not complete in both fragments (pseudogenes), only partial sequences of these two genes were included in the analysis. The upstream (in circular genomes this term can be ambiguous, so we use it here to refer specifically to the gene order as presented in Table 2) fragment was 2806 bp-long, and the downstream was 2767 bp; aligned, they were 2811 bp-long. The two fragments are highly conserved, with only 0.04 base substitutions per site between the two sequences. The difference in length was caused by the loss of 39 bases in the second fragment between positions 432 and 470 in the alignment. In the upstream fragment, the 39 bases are found in the intergenic region (73 bp) between pseudo-nad5 and tRNA-Ala, adjacent to the latter. The high similarity between the two segments indicates that they most probably originate from rearrangement events relatively recent in evolutionary terms.

Characteristics of duplicated genes

In the process of genomic rearrangements and/or subsequent sequence evolution several genes have lost fragments of their sequences, which is highly likely to have rendered them non-functional. We added a prefix ‘pseudo-‘to the names of those genes and did not indicate start/stop codons for them (Table 2). Among the six duplicated genes: nad1, nad4, nad5, nad2, cytb and cox3, only the latter three appear to possess two (mostly) complete copies. Both copies of cox3 use identical codons (ATT and TAA), are of identical length (762 bp), and have almost identical sequences, apart from five SNPs at positions 13, 29 and 109, 349, 398. Intriguingly, those translate into the equal number of mutations in the amino acid sequence, which is likely to be a sign of a relaxed purifying selection conferred by the functional redundancy. Pairwise comparison with related homologs showed that the cox3 copy (which we presume to be the original gene, Additional file 3A) appears to be the faster-evolving one. Regardless, both copies might still be functional.

Between the two cytb copies, the original one (cytb) lacks 15 bp at the 5′ end (1099 vs 1084 bp). This is an annotation artefact caused by a different start codon choice: as opposed to the 3 bp overlap between cytb-2 and the upstream flanking tRNA-Ile-2, there is an 11 bp IGR between the cytb and tRNA-Ile (Table 2). Although the GTT start codon is conserved at the 3′ end of tRNA-Ile, a deletion mutation in what is now the IGR between the two genes has caused a frameshift in the ORF of cytb. If this is not merely a sequencing artefact, the mutation may have rendered this (original) copy non-functional, or it simply uses the next GTT triplet as the start codon (as proposed in our annotation). Comparison with homologs indicates that several of them are merely one ATT triplet longer (the preceding triplet in C. cotti cytb is AAT), whereas Gnathostoma species even lack additional six amino acids at their 5′ end. Otherwise, both sequences are relatively similar, with merely 0.04 base substitutions per site, but these translate to nine polymorphic sites between the two amino acid sequences.

Our analyses suggest that nad2 gene is likely to be a part of a relatively large tRNA-Asp + nad1 + tRNA-Tyr + nad2 duplicated fragment (Additional file 3). With 0.09 base substitutions per site, the two fragments appear to be relatively highly conserved, but translated protein sequences exhibit 0.15 amino acid substitutions per site, suggesting unusually high number of non-synonymous mutations. Translated sequences revealed that the nad2 copy, hypothesised by us to be the original gene (Additional file 3), possesses internal stop codons and thus is most probably non-functional. To reflect this, although the sequence is complete, we have added the prefix ‘pseudo-‘to its name (Table 2). At the end of the same fragment, we found a highly conserved 410 bases-long fragment of the 5′ end of nad1 gene, including a conserved TTG start codon. The rest of the gene is highly degraded or missing. Pseudo-nad4 is a relatively well-conserved 243 bp 5′ fragment of the gene, whereas pseudo-nad5 is a highly degraded 3′ fragment of the gene. The pattern of conserved/deleted fragments for all three genes is in agreement with the hypothetical evolutionary history of genomic rearrangements, with deletions at the edges of the copied fragments (Additional file 3). Therefore, we hypothesise that the losses of the ends of these genes may have occurred during the rearrangement events.

Sequence duplications are non-adaptive events [47] likely to reduce the evolutionary fitness of the organism, and thus should be under an evolutionary pressure directed towards the loss of the superfluous duplicated genes and genomic regions [48], although experimental evidence indicates that this process is not always very efficient [49]. Different levels of conservation between these six duplicated genes indicate either that the speed of this process of removal of superfluous genomic regions varies between different parts, or that rearrangement events occurred over a relatively long time-period.

Transfer RNAs

Non-standard secondary structures of tRNAs, usually lacking either a TΨC or a DHU arm, are common in nematodes [9, 13, 50, 51]. Duplicated tRNAs are also not particularly rare [10], but usually it is merely one tRNA that is duplicated, e.g. [27], whereas C. cotti mitogenome possesses seven pairs of duplicated tRNAs: Trp, Tyr, Ala, Asp, Gln, Ile, and Thr. On the other hand, nematodes usually possess all 22 standard tRNAs [9, 10], whereas we could identify only 19, with tRNA-Leu1(CUN), Ser2(AGN) and tRNA-Phe missing. Generally, tRNAs are the gene category with the highest ‘dispensability’ in the mitochondrial genome, so mitogenomes of some animals don’t possess the full set of tRNAs [10, 52], which is believed to be compensated by the import of tRNAs from the cytoplasm [53]. We can only speculate that this may be the mechanism through which C. cotti compensates for the absence of these three tRNAs as well.

We have used the inferred hypothetical evolutionary history of genomic architecture rearrangements (Additional file 3) to attempt to search for traces of these missing tRNAs. Based on the gene orders in related species (Fig. 1), we expected tRNA-Leu1(CUN) to be found in the tRNA-Gln to nad4 duplicated fragment, between cytb and cox3 (Additional file 3). Indeed, a 44 bp-long IGR exists in both fragment copies in C. cotti (Table 2). Although the two IGRs are almost identical, with only G replaced with T at position 21 in the duplicated fragment, the alignment with tRNA-Leu1(CUN)homologs indicates low similarity, the absence of a conserved anticodon, and a large deletion at the 5′ end. The most probable position of tRNA-Phe would be downstream from tRNA-Arg, which is where we found a 47 bp IGR in C. cotti. The non-coding sequence did indeed exhibit similarity to related homologs, but a 6-bp deletion where the anticodon should be indicates that it has also lost its functionality. We presumed that tRNA-Ser2 should be in the place where tRNA-Trp-2 is found in the mitogenome (Additional file 3). Sequence comparison has indeed confirmed that the two tRNA-Trp genes don’t share evolutionary ancestry (Fig. 2), and that tRNA-Trp-2 is much more similar to tRNA-Ser2 homologs than to tRNA-Trp homologs. However, its anticodon base triplet has undergone a mutation from TGA to TCA. As a result, the mitogenome now possesses what appear to be two functional tRNA-Trp genes. Remolding of tRNAs is a well-documented process that involves a duplication of a tRNA gene, a mutation that changes the anticodon and the loss of the ancestral tRNA gene [54], but in this case there is no indication that tRNA-Ser2 was duplicated in the first place. Suspecting a sequencing artefact, we have checked the electropherogram, but there was no indication of poor sequencing quality either. This phenomenon should be further confirmed using a C. cotti specimen belonging to a different lineage.

Fig. 2.

Fig. 2

Comparison of duplicated tRNAs in the mitochondrial genome of C. cotti. Orange line indicates normal base pairing, lilac dot indicates non-standard base pairs, and red bases highlight where two tRNAs differ only in one base

Another indication of remolding was observed in tRNA-Val, as its sequence was very divergent from all remaining homologs, but the anticodon defined it as Valine. Comparison with other species indicates that its position is rather instable (Fig. 1). In the closely related D. medinensis, tRNA-Cys can be found in that position, but the sequence isn’t similar to tRNA-Cys homologs either. BLASTing of the sequence did not return any significant hits either. We can only speculate that this phenomenon might be a reflection of another tRNA remolding in the evolutionary history of this species, where a mutation in the anticodon has led to subsequent rapid evolution of the entire DNA sequence.

The status of the tRNA-Ala-2, presumed to be a part of the duplicated fragment with pseudo-nad5 gene, is also ambiguous: its anticodon and central part of the sequence are conserved among the related homologs, but its 5′ end exhibits a 6-bp deletion. It can still be folded into a tRNA-like structure, but a very non-standard one, and very different from the tRNA-Ala copy (Fig. 2). Thus we remain doubtful regarding its functionality.

The annotation of tRNA-Lys was also ambiguous: depending on the algorithm employed, it was predicted as both Asn and Lys (ARWEN indicated it could be Lys or Asn, and MITOs that it is Asn). Comparison with homologs was also ambiguous, as the two most similar sequences appeared to be D. medinensis tRNA-Lys and P. sanguineus tRNA-Asn. As the anticodon was UUU, the tRNA was identified as Lys. Alignment with related homologs indicated that these two tRNAs (Lys and Asn) in Camallanoidea and Dracunculoidea families are generally very different from other related homologs, which suggests a possibility of yet another remolding event(s) in the common ancestor of these two families.

Although the annotation of tRNA-Pro was not ambiguous, it was the only homolog that exhibited GGA anticodon, whereas the remaining spirurids all use GGG. tRNA-Thr, tRNA-Gln and tRNA-Ile were duplicated as a part of the large tRNA-Gln - nad4 fragment (Additional file 3). The two tRNA-Thr sequences were identical, whereas the latter two pairs of sequences both exhibited only one SNP (Fig. 2). tRNA-Tyr and tRNA-Asp were probably duplicated in a fragment also containing nad1 and nad2 (Additional file 3). However, possibly because tRNA-Tyr is located between the two PCGs, both copies are highly conserved, exhibiting only two SNPs and identical structure (Fig. 2). In contrast to this, one of the two tRNA-Asp copies has completely lost the 5′ part of its sequence (pseudo-tRNA-Asp in Table 2). The loss is likely to have occurred in the rearrangement process, as it is located on the edge of the copied fragment (Additional file 3). The rearrangement event is also likely to have been relatively recent in evolutionary terms, as the 33 bps adjacent to nad2 (3′ end) still exhibit a highly conserved sequence with only two polymorphic nucleotides in comparison to the corresponding fragment of the other tRNA-Asp copy.

Base composition and skewness

Mitogenomes of nematodes usually exhibit an A + T bias, often higher than 70% [35], and sometimes even higher than 80% [13]. Thus, despite its apparently high A + T bias of 70.8%, C. cotti actually exhibits the lowest bias among the available Spirurida mitogenomes, with the exception of Gnathostoma doloresi at 70.5% [38]. This might be a reflection of lower mutational constraints on the non-functional duplicated parts of the mitogenome. Intriguingly, in Spirurida and Tylenchida orders, this bias mostly appears to be driven by the extremely high T-content, with T base often representing more than 50% of the nucleotides [22]. Apart from the three Gnathostoma species and P. sanguineus, all available Spirurida mitogenomes exhibit T-bias values over 50%: from C. cotti at 51% to 56.9% in Dirofilaria repens (Additional file 2).

The studied mitogenome exhibits a negative AT-skew (−0.441) and a positive GC-skew (0.463). In this aspect it is also not an outlier among the available spirurid mitogenomes, which exhibit AT-skews between −0.4 and −0.5, and GC-skews between 0.35 and 0.52 (Additional file 2). In agreement with the T-base abundance findings, the three Gnathostoma species (−0.28, −0.29 and −0.33) and P. sanguineus (−0.21) exhibited lower AT-skew values. Surprisingly though, H. longissimum, which was not an outlier in terms of T-base abundance (52.9%), was an outlier in terms of AT-skew (−0.34). Additional intriguing observation is that the two mitogenomes belonging to the outgroup species, L. polyphemus and T. spiralis, exhibited an opposite skew trend, with positive AT-skew and negative GC-skew values.

Overlaps between genes

The thirteeen observed overlaps ranged from 1 to 11 bp (Table 2), but we consider only five of them relatively large (≥ 5 bp): pseudo-tRNA-Ala/tRNA-Gln and 16S/nad3 (both 11 bp), nad6/nad4l (6 bp), and both cox3/tRNA-Thr segments (5 bp). The first overlap is likely to be an annotation artefact caused by the previously discussed 6-bp deletion at the 5′ end of pseudo-tRNA-Ala. Although it may appear that the 16S/nad3 overlap is also likely to be an annotation artefact, as the exact boundaries of rRNAs are difficult to predict and thus usually presumed to extend to adjacent genes [55], alignment of 16S with other available spirurid homologs revealed that they are highly conserved, and that removing the overlap from the annotation would require truncating its relatively conserved 3′ end. As the C. cotti 16S rRNA, at 938 bp, is already the smallest reported so far, with comparable sizes observed only in Gnathostomatidae (Additional file 2), we decided to keep the overlap. Furthermore, an 8 bp-long overlap with nad3 was also proposed in two other spirurids: S. lupi and Thelazia callipaeda [35]. The cox3/tRNA-Thr overlap, also perfectly preserved in the duplicated fragment, can be reduced down to only 3 bp if cox3 uses the truncated T-- stop codon, presumed to be completed (UAA) by the addition of 3′ A residues to the mRNA [56–58]. Apart from nad6/nad4l, all of the overlaps in the studied mitogenome involve tRNA genes. This is common, and believed to be a consequence of lesser evolutionary constraints on tRNA sequences [59]. However, nad4l is a very small gene (234 bp in C. cotti), which also appears to be under lesser evolutionary constraints as mitogenomes of some groups of animals often exhibit overlaps involving this gene [60, 61]. Thus we don’t deem this overlap particularly suspicious. A large number of gene overlaps in mitochondrial genomes of metazoans are believed to be a reflection of strong selection for small size [19]. Although it may appear incongruous to observe as many as 13 gene overlaps in a mitogenome carrying such a large number of (presumably) unnecessary duplicated genes, they are most probably merely a remnant of a more stable (and compact) phase in the evolutionary history of this mitogenome.

Protein-coding genes: Length and codons

Gene lengths among the available Spirurida mitogenomes were not very conserved, with four genes exhibiting a difference of more than 50 bp between the largest and the smallest compared gene: nad3 was the most conserved with only 16 bp and nad2 the least with 228 bp (Additional file 2). None of the C. cotti PCGs were major outliers regarding the size. Most of the genes used the two start (8 TTG + 3 ATT) and three stop (4 TAG, 3 TAA, 7 T--) codons common for nematodes [9, 13, 20, 27]. The third observed start codon, GTT for cytb (and cytb-2) and nad4, was also observed in a number of closely related nematodes [38, 62, 63]. The length of nad4 remains ambiguous: we have selected the length of 1233 bp, identical to some Onchocerca species (Additional file 2), in which case there are no intergenic nucleotides between tRNA-Thr and nad4. On the other hand, as the 5′ end of the nad4 gene is GTTTTTTATGTTCTGTTT, the second GTT may also be used as the start codon, in which case there would be nine intergenic nucleotides and nad4 gene would be 1224 bp long, which is identical to G. doloresi.

Non-coding regions

The AT-rich region, believed to function as the control region containing the replication origin [64], is usually located between nad4 and tRNA-Met in mitogenomes of other nematodes [7]. In C. cotti these two genes are not adjacent and the AT-rich (237 bp) is located between tRNA-His and tRNA-Arg (Table 2). Notwithstanding the AT-rich, IGRs found in the mitogenome ranged from 1 to 279 bp in length (21 in total). These numbers are larger (both the total number and maximum size) than reported in several closely related Spirurida mitogenomes: 14–16 IGRs, 1 to 62 bp [32, 35], which is not unexpected for a mitogenome exhibiting such a large number of rearrangements.

Evolution of mitogenomic arschitecture

Mitogenomic gene rearrangements should be strongly selected against, as they can affect the replication and transcription mechanisms, and produce disruptions in the gene expression co-regulation [65]. In agreement with this, although mitogenomes of nematodes exhibit exceptional variability in the mitogenomic architecture, most of it is found in several families within the class Enoplea, whereas Chromadorea (containing the majority of Nematoda species) exhibit very few gene rearrangements [2, 7, 9, 10, 27, 43, 46, 66]. Frequent sequence rearrangements and long sequence duplications comparable to the ones found in the C. cotti mitogenome have been observed only in nematodes belonging to the Mermithidae family (Enoplea). Several species within this family exhibit hypervariability in conspecific size variation in mitogenome size (19–34 Kb), owing to long duplicated fragments of several Kb, containing both PCGs and tRNAs, present in different copy numbers within individual mitochondrial genomes [45, 46, 67]. The proposed mechanism explaining this hypervariability is mitogenomic recombination [68, 69]. Interspecific mitochondrial recombination has been observed in several animal lineages aside nematodes, including fishes [70] and birds [42], but it is believed to be accompanied by mitochondrial gene inversions (frequent exchange of the coding strand) [10]. Characteristics of the C. cotti mitogenome, especially the encoding of all genes on a single strand and almost identical sequences between some of the duplicated genes, suggest that interspecific recombination is an unlikely scenario. The most common mechanism of mitogenomic architecture rearrangements is believed to be slipped-strand mispairing mechanism leading to a tandem duplication and subsequent evolutionary loss of duplicated genes (TDRL) [10, 48, 49, 65, 71, 72]. However, the observed architecture and the conducted CREX analysis imply that the mechanism would require several duplications of the entire genome followed by extensive losses (Supplementary file 3C). As we did not observe traces of the latter process in the mitogenome (we would expect it to produce a much larger number of NCRs), we believe that transposals and duplications followed by transposals of duplicated fragments are a more parsimonious explanation for the observed mitogenomic architecture rearrangements (Additional file 3, A and B). The evolution of gene orders mostly driven by transpositions has been proposed in ascomycetes as well [73]. A fourth hypothesis would be fragmentation of the “standard” single-circle mitogenome into multipartite genomes, followed by subsequent re-organisation into a single circular molecule (we did not find any indications that the mitogenome is fragmented in C. cotti). Mitogenome fragmentation is common in higher plants [74, 75], and has occurred independently in some metazoans, including mesozoans [76], cnidaria [77], insects [78], rotifers [79, 80], as well as nematodes [21, 81]. A very similar scenario, preceded by an ancestral mitogenome duplication, has been proposed before for another nematode, Globodera ellingtonae [81]. Although the relative abundance of pseudogenes is in agreement with this course of events [81, 82] and a single genome duplication is more parsimonious than a series of duplications required for the TDRL process, it remains hypothetical.

Regardless of the exact rearrangement mechanism, mitogenomic architecture of C. cotti is unique not only among Chromadorea, but also among almost all nematodes. Although it is believed that lengthy sequence duplications are absent from mitogenomes of chromadorean nematodes [46] and that only rearrangements in tRNA order are common [27], our analysis shows that neither of the propositions is true for the families clustering in the Camallanina clade (as defined in this study). As gene order instability has been observed in another chromadorean order, Oxyurida [66], this hints towards a possibility that some chromadorean orders (or more precisely specific groups of families within them) might be particularly prone to mitogenomic rearrangements.

Based on the observation of high variability in mitogenomic architecture in several phylogenetically distant groups, it has been proposed that the acceleration of the rate of genomic rearrangements in the evolutionary history of metazoans has occurred independently on several occasions [10]. It is known that mitochondrial genomes of some lineages of vertebrates are evolutionary dynamic even at short timescales [83, 84]. For example, different duplication mechanisms were observed in highly dynamic mitogenomes of some salamanders [84]. As genomic rearrangements are random evolutionary events [72], not driven by positive selection [47], and as there is evidence for positive correlation between compactness of genomes and structural stability [85], there is mounting evidence that the evolution of mitogenomic architecture is highly discontinuous. Therefore we hypothesise that, although mitogenomic rearrangements are generally strongly selected against, which results in long evolutionary periods of stasis in gene content and arrangement in most metazoan lineages, once a rearrangement event has destabilized the genomic architecture, this is likely to be followed by an exponentially accelerated rate of mitogenomic rearrangements.

Conclusions

We have sequenced and characterised the complete mitochondrial genome of the fish-parasitising chromadorean nematode Camallanus cotti. It is exceptionally large among chromadoreans and exhibits a unique architecture, with a large number of duplicated genes (46 genes and pseudogenes were identified in the mitogenome). Among the six duplicated PCGs, three were incomplete, and one contained stop codons in its sequence; thus only two pairs are likely to be functional. Among the six duplicated tRNAs, five still appear to possess two functional copies. Regardless of the unusually large number of tRNAs found, only 19 unique ones were found in the mitogenome. A remolding event explains one missing tRNA, whereas intergenic regions provide clues for the other two tRNAs missing from the mitogenome. Although TDRL is considered to be the most common mechanism for gene order rearrangements, the most parsimonious explanation for the architecture observed would be either TDRL accompanied by transposals, or an even more unorthodox duplication-fragmentation-reassembly scenario.

Based on the observed rate of mitogenomic architecture rearrangements in Spirurida, as well as the evidence from other metazoans, we put forward a hypothesis that the evolution of mitogenomic architecture is highly discontinuous: once a long period of stasis in gene order and content has been punctuated by a rearrangement event, such a destabilised mitogenome is much more likely to undergo subsequent rearrangement events, resulting in an exponentially accelerated evolutionary rate of mitogenomic rearrangements. This hypothesis still needs to be tested using a large number of mitogenomes and appropriate statistical methods, but the implications of this model are particularly important for the gene order similarity analyses, which have often been used as an additive source of phylogenetic information for Chromadorea class [2, 10, 27, 43, 46, 66]. The mounting evidence for discontinuous evolution of mitogenomic order in this class indicates that the aforementioned approach is too prone to overinflated estimates of evolutionary distance to have practical usability.

Chromadorean nematodes might be a good model to further study this discontinuity in the dynamics of mitogenomic evolution, as the class is comprised mostly of orders exhibiting extreme (for nematodes) stability of mitogenomic architecture, interrupted by clades of taxa that exhibit varying degrees of accelerated mitogenomic architecture evolution. As C. cotti possesses a mitogenome exhibiting an extremely accelerated rate of rearrangements, future studies should aim to sequence more mitogenomes belonging to families comprising the Camallanina clade, with particular focus on the Camallanidae family.

Methods

Sampling

It is known from a previous study that Chinese hooksnout carp (Opsariichthys bidens Günther, 1873) is particularly susceptible to C. cotti infections, with mean prevalence of almost 50% in wild populations from a large reservoir in central China, Danjiangkou (32°82′50″ – 33°81′50″ N; 11°08′70″ – 11°18′60″ E) [86]. This is most probably in the native range of C. cotti [24]. Parasitic nematodes were obtained post mortem from hooksnout carp specimens caught by fishermen in the Danjiangkou and bought from the local market on 23/Apr/2016. Live nematodes were removed from the fish intestines, and then taxonomically identified by their morphological characteristics via dissecting microscopy, using several sources as guidance [25, 87, 88]. All nematodes were washed in 0.6% saline before being stored in absolute ethanol in the Museum of Aquatic Organisms, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China (Accession No. IHB20160324005).

Genome sequencing and assembly

Genome was sequenced broadly following the procedure described before [60, 80]. After soaking a single adult nematode (≈3.5 cm) in TE buffer (pH 8.0) overnight to remove the ethanol, total genomic DNA was extracted using the Aidlab DNA extraction kit (Aidlab Biotechnologies, Beijing). Eight degenerate primer pairs were designed (Table 3) to match the generally conserved regions of mtDNA genes and used to amplify and sequence short fragments of 12S, cytb, nad4, nad1, cox1, cox2, 16S and nad5 genes. These sequences were then used to design 12 specific primers for the amplification and sequencing of the remaining mitogenomic sequences in several PCR steps. Primers were designed to produce amplicons with overlaps of about 100 bp. Reaction volume of 50 μL contained 5 U/μL of TaKaRa LA Taq polymerase (TaKaRa, Japan), 10 × LATaq Buffer II, 2.5 μM of dNTP mixture, 0.2–1.0 μM of each primer, 60 ng of DNA template, and PCR-grade H2O. PCR conditions were optimized for each reaction, with the annealing temperature adjusted to suit the specific primer pair, extension time set to 1 min per Kb of the expected product size, and cycles (35 on average) adjusted depending on the amplification efficiency of primers. PCR products were sequenced on an ABI 3730 automatic sequencer using Sanger method [89]. When problems in sequencing were encountered, products were cloned into a pMD18-T vector (TaKaRa, Japan) and then sequenced. All obtained fragments were quality-proofed (electropherogram) and BLASTed [90] to confirm that the amplicon is the actual target sequence. Whenever the quality was sub-optimal, sequencing was repeated. Mitogenome was assembled stepwise with the help of DNAstar v7.1 [91] program, making sure that the overlaps were identical, and that no numts [28] were incorporated into the sequence. After it became obvious that the architecture of this mitogenome is very unusual, to further confirm that this is not a consequence of PCR artefacts, DNA pollution, numts, or a feature unique to the specimen from which the DNA was extracted, we have extracted DNA from another specimen (sampled as described above from the same fish specimen), and repeated the procedure using long-range PCR with the specific primers (Table 3).

Table 3.

Primers used for amplification and sequencing of the mitochondrial genome of C. cotti

Gene span Primer name Sequence (5′-3′)
nad6-12S DYF1 TTGCGGTGCTTTGCGTTCTG
DYR1 CTCTCGTTTAACAGTCAACC
12S XW12SF GTTCCAGATTAATCGGCTA
XW12SR CAATTGATGGATGATTTGTACC
12S–cytb DYF2 CACGAGTTTAGGTTGAGCCAC
DYR2 CAACGTAGAGCAAGAAACC
cytb XWCYTBF GRGCTCARATGAADTATTGAGC
XWCYTBR TATCACTCTGGCACHAYATG
cytb-nad4 DYF3 CCTTTTCTGATGGGGGATCC
DYR3 GAACACAACACAGCACCCAA
nad4 XWND4F GCYCATGTTGARGCACCTAC
XWND4R GAAGAATARGCAGCTAAWG
nad4-nad1 DYF4 GTTATTGTCGTTTTTGGGTGC
DYR4 GGGTAATACAAATCACAACATCAG
nad1 XWND1F GCGTRTTGGTCCTAAYAAGG
XWND1R TATCAWAACGGWAACGTGGG
nad1-cox1 DYF5 GTGTTCCTTTTGTTCTACTC
DYR5 GAACTTCCTGACAAACAACTAC
cox1 XWCOX1F ATYGGTGGATTYGGWAATTG
XWCOX1R TAAACCTCNGGGTGHCCAA
cox1-cox2 DYF6 ACTATGTTGTTACTAGATCG
DYR6 CCACAAGGCACCACACAACG
cox2 XWCOX2F CTGAACTTATGATTACAGA
XWCOX2R CCACAAATCTCWGAACAYTGACC
cox2-16S DYF7 GGCAGATGCTTTGTCTGGGG
DYR7 TTCCGAAGACTTATCTTTG
16S XW16SF ATGGCTGYTWTAGCGTGAGG
XW16SR TCTATCTCACGAYGAAYTAAAC
16S–nad5 DYF8 GTAGTTCTTATACATTTTCAGG
DYR8 ATGGTCAACAGACCAACA
nad5 XWND5F TAGCYTTAGGYAATCACCTAC
XWND5R GAGACAWGGTNCTCAAWGCCAC
nad5 DYF9 GGCTTTTTGTTTTTCTGATG
DYR9 CTACATGCAAAATAGGTATC
nad5-cytb-2 DYF10 GGTGCTGGATAGTTATTCTGG
DYR10 CAATCAACTCAAAACAACAG
cytb-2-nad6 DYF11 GTTCTGTTCCTAGGAAGATC
DYR11 CCACAAAAACTCAACAAAGGAC
nad6 DYF12 CTATGTTTCGCTTACAACG
DYF13 CTACTCATAACACAAAAAC

Primer names beginning with XW indicate a generic primer, whereas DY indicates a specific primer pair

For reasons we only partially understand, amplification and sequencing of this mitogenome was a comparatively difficult and laborious process, wherein obtaining both good quality PCR and sequencing results was not a straightforward process, especially for the duplicated segments. This was observed before for helminths, and suspected to be a result of high A + T content [92]. Further elements contributing to this may include the low amount of DNA that can be obtained from a single nematode, or even complex quaternary structure of the sequences.

Annotation

The mitogenome was annotated broadly following the procedure described before [61, 93]. Protein-coding genes were found by searching for ORFs (employing genetic code 5, invertebrate mitochondrial) and alignment against the adopted reference genome (D. medinensis) in Geneious [94]. Each gene was then aligned with homologous sequences of closely related species (Table 1) and annotation fine-tuned manually. The two ribosomal RNAs were annotated in a similar way, via comparison with homologs. MITOS [95] and ARWEN [96] tools were used to detect and fold the tRNAs in the genome. Folded tRNAs were further prepared for publication using Coreldraw (Corel Corp.). Because tRNAs of nematodes often exhibit non-standard secondary structures [50], after the automatic annotation by these algorithms, all non-coding regions larger than 30 bp were carefully examined for the existence of tRNA-like sequences. Ambiguous tRNAs were additionally visually aligned with homologs extracted from all analysed mitogenomes using a custom-made GUI-based program MitoTool [97]. Annotation of tRNAs proved to very ambiguous, mostly as a result of many tRNA genes with non-standard sequences and/or secondary structures. We have tweaked the annotation several times, but we remain non-confident that it is fully accurate. MitoTool was also used to extract the annotation manually recorded in a Word document and to generate tables with statistics for all analysed mitogenomes. Pairwise distances were computed using MEGA 7 [98]. NCBI’s Organelle Genome Resources were used to compare it with other published mitogenomes.

Phylogenetic and gene order analyses

Following the proposed guidelines for new mitogenome validation [30], we have conducted a barcoding identification assessment and a mitochondrial phylogenomic analysis using almost the entire new mitogenome. For the former, all 99 Camallanidae sequences were retrieved from the BOLD database [31]. Sequences were aligned by MAFFT [99], and raxmlGUI [100, 101] used to conduct maximum-likelihood phylogenetic analysis with 1000 bootstrap replications. For the phylogenomic analyses, all 21 available (June 2017) unique Spirurida mitogenomes were retrieved from the GenBank. It should be noted that sometimes Camallanida are elevated to a status of order [102], but the GenBank classification system includes them in Spirurida. Preliminary comparisons of mitogenomes retrieved from GenBank have indicated that Gongylonema pulchrum (NC_026687) [103] nad4 gene was misannotated. Hence, in order to be able to conduct phylogenetic and gene comparison analyses, we have re-annotated the gene by moving the start codon 15 bases in 5′ direction, and changing it from ATT to GTT, thus creating an overlap with the adjacent tRNA-Thr. In all analyses, two sequences were used as outgroups: a basal nematode [27, 43] T. spiralis (NC_002681) [50] and a basal arthropod L. polyphemus (NC_003057) [43, 104]. Complete mitogenomic sequences selected for the analysis were retrieved from the GenBank, genes extracted using MitoTool, and further handled with another custom-made GUI-based program, BioSuite [105]. Phylogenetic analyses were performed using concatenated 33 genes: 12 PCGs (atp8 missing), 2 rRNAs and 19 tRNAs (three missing from C. cotti). For duplicated genes, the one presumed to be functional, or original where both seemed to be functional (see Table 2 and discussion for details), were used. Each sequence was aligned separately (in batches) by MAFFT integrated into BioSuite: rRNAs and tRNAs were aligned using normal alignment mode, whereas codon-alignment mode was used for PCGs. Finally, BioSuite was used to concatenate the alignments and produce input files for the two programs used to conduct the phylogenetic analysis. Maximum-likelihood analysis (with 1000 bootstrap replications) was conducted using raxmlGUI, and Bayesian inference using MrBayes 3.2.6 [106] with default settings and 5 × 106 generations (average SD of split frequencies = 0.000054). GTR + G + I evolution model, selected using ModelGenerator [107], was used in both analyses. Saturation analysis results, conducted using DAMBE program [108], indicate low saturation for all three codon positions. Finally, phylograms and gene orders were visualised and annotated by iTOL [109] with the help of several dataset files generated by MitoTool.

To make it easier for the readers to visualise the extent of rearrangements in the Camallanina clade, we present some of the hypothetical rearrangement scenarios in the Additional file 3. However, these results should be interpreted with caution. Using the obtained BI phylogram, we conducted an ancestral character gene order state reconstruction using MLGO web server [110]. None of the available tools to infer genome rearrangements (among those we could find) could handle mitogenomes with both gene deletions and duplications. Therefore, we have inferred the approximate number of gene order rearrangements needed between Camallanus cotti and ancestral node A1, and shown them in the Additional file 3A. As the putative gene orders of the ancestral nodes A2 and A1 (as defined in Fig. 1) inferred by MLGO did not contain duplicated genes, CREX algorithm [111] was used to infer the hypothetical evolutionary history of gene order rearrangements (Additional file 3C). However, the results suggest three duplications of the entire mitogenome followed by a random loss of genes. As we could not find evidences supporting this scenario, i.e. numerous NCRs, we are skeptical about this result. Therefore, we have also visualised (Additional file 3B) the extent of gene order rearrangements between the two nodes following the same logic as in the Additional file 3A.

Additional files

Additional file 1: (40.6KB, pdf)

Taxonomic identification of the studied C. cotti nematode using cox1 barcoding. Maximum likelihood analysis was conducted on 100 Camallanidae cox1 sequences, with GenBank accession numbers shown in the figure. The clade containing the queried sequence (‘Camallanus cotti this study’) is shaded purple. (PDF 40 kb)

Additional file 2: (18.7KB, xlsx)

Statistics and gene features of Spirurida mitogenomes. Worksheet A lists all the species, GenBank accession numbers, genome sizes in bp, base composition and skew. Worksheet B lists gene sizes for all species, and their corresponding (putative) start and terminal codons. Species are represented by acronyms of their binomial scientific names. (XLSX 18 kb)

Additional file 3: (514.1KB, pdf)

Mitogenomic gene order rearrangements in the Camallanina suborder. (A). A hypothetical outline of gene order rearrangements between Camallanus cotti and ancestral node A1. Ancestral node A1 is shown in Fig. 1. Genes and mitogenome fragments presumed to have undergone rearrangements are highlighted by different colours. Hypothetical rearrangement mechanism is indicated on the left, and arrows are used to indicate the putative translocation pathways. Where the presumed mechanism is duplication + transposal, arrows indicate the positions of both fragments in the downstream genome, where the fragment presumed to be translocated is labelled with the letter C. Where colouring is insufficiently unambiguous, fragments undergoing a rearrangement event are additionally underlined. The order in which the events are shown is (mostly) random. A star is used to indicate a deletion and a thick blue arrow to indicate a tRNA remolding event. (B) A hypothetical outline of gene order rearrangements between ancestral nodes A2 and A1. Ancestral nodes are shown in Fig. 1. Genes and mitogenome fragments presumed to have undergone rearrangements are highlighted by different colours. Hypothetical rearrangement mechanism is indicated on the left, and arrows are used to indicate the putative translocation pathways. Where colouring is insufficiently unambiguous, fragments undergoing a rearrangement event are additionally underlined. The order in which the events are shown is (mostly) random. MLGO was used to infer the putative ancestral gene orders. (C). Hypothetical evolutionary history of gene order rearrangements between ancestral nodes A2 and A1 inferred by CREX algorithm. Ancestral nodes are shown in Fig. 1. Tdrl indicates a tandem duplication and random loss event, where a duplication event (not shown) is followed by the loss of some elements (orange-shaded). This results in the remaining copies (blue-shaded) being moved to the front. (PDF 514 kb)

Acknowledgments

Lab technicians Tuo Du and Wei-Mu Xuan helped conduct a part of the molecular lab work. We’d like to thank Adam Casciaro for insightful discussions regarding the English language-related issues, and two anonymous reviewers for the time and expertise they have invested into reviewing our manuscript.

Funding

This study was funded by the Earmarked Fund for China Agriculture Research System (CARS-45-15), the National Natural Science Foundation of China (31572658), and the Major Scientific and Technological Innovation Project of Hubei Province (2015ABA045). The funders had no role in the design of the study, collection, analysis and interpretation of data, and in writing the manuscript.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article and its additional file, as well as in the GenBank repository under the accession number MF580344 [28].

Abbreviations

Bp

Base pair

IGR

Intergenic region

Kb

Kilobase

LBA

Long branch attraction

ORF

Open reading frame

PCGs

Protein-coding genes

SD

Standard deviation

SNP

Single-nucleotide polymorphism

TDRL

Tandem duplication and random loss

Authors’ contributions

ZH collected the samples, participated in the design of the study, lab work, data analysis, and helped write the manuscript; IJ participated in the design of the study, data analysis, data visualisation, and co-wrote the manuscript; RC participated in the molecular lab work, data analysis, and carried out sequence alignments; DZ contributed custom–made software and codes, and participated in sample collection, data analysis and data visualisation; JZ participated in the design of the study and in the molecular lab work; GTW and WXL conceived and coordinated the study, and reviewed the manuscript. All authors contributed comments to the final version of the manuscript. All Authors read and approved the final manuscript.

Ethics approval

All experimental procedures involving animals were reviewed, approved and supervised by the Animal Care Committee of the Institute of Hydrobiology, Chinese Academy of Sciences. As the study did not involve any (live) vertebrates, nor regulated invertebrates, no special permits were required to retrieve and process the samples.

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Footnotes

Electronic supplementary material

The online version of this article (doi: 10.1186/s12864-017-4237-x) contains supplementary material, which is available to authorized users.

Contributor Information

Hong Zou, Email: zouhong@ihb.ac.cn.

Ivan Jakovlić, Email: ivanjakovlic@yahoo.com.

Rong Chen, Email: chenrong2S@163.com.

Dong Zhang, Email: dongzhang0725@gmail.com.

Jin Zhang, Email: zhangjin2001@163.com.

Wen-Xiang Li, Email: liwx@ihb.ac.cn.

References

  • 1.Černotíková E, Horák A, Moravec F. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences. Folia Parasitol (Praha) 2011;58:135–148. doi: 10.14411/fp.2011.013. [DOI] [PubMed] [Google Scholar]
  • 2.Park J-K, Sultana T, Lee S-H, Kang S, Kim HK, Min G-S, et al. Monophyly of clade III nematodes is not supported by phylogenetic analysis of complete mitochondrial genome sequences. BMC Genomics. 2011;12:1–16. doi: 10.1186/1471-2164-12-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Koutsovoulos GD. Reconstructing the phylogenetic relationships of nematodes using draft genomes and transcriptomes: University of Edinburgh, PhD Thesis. Edinburgh: University of Edinburgh, PhD Thesis; 2015.
  • 4.Meldal BHM, Debenham NJ, De Ley P, De Ley IT, Vanfleteren JR, Vierstraete AR, et al. An improved molecular phylogeny of the Nematoda with special emphasis on marine taxa. Mol Phylogenet Evol. 2007;42:622–636. doi: 10.1016/j.ympev.2006.08.025. [DOI] [PubMed] [Google Scholar]
  • 5.van Megen H, van den Elsen S, Holterman M, Karssen G, Mooyman P, Bongers T, et al. A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences. Nematology. 2009;11:927–950. doi: 10.1163/156854109X456862. [DOI] [Google Scholar]
  • 6.Poinar G. Trends in the evolution of insect parasitism by nematodes as inferred from fossil evidence. J Nematol. 2003;35:129–132. [PMC free article] [PubMed] [Google Scholar]
  • 7.Liu G-H, Shao R, Li J-Y, Zhou D-H, Li H, Zhu X-Q. The complete mitochondrial genomes of three parasitic nematodes of birds: a unique gene order and insights into nematode phylogeny. BMC Genomics. 2013;14:414. doi: 10.1186/1471-2164-14-414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Duchêne S, Archer FI, Vilstrup J, Caballero S, Morin PA. Mitogenome phylogenetics: the impact of using single regions and partitioning schemes on topology, substitution rate and divergence time estimation. PLoS One. 2011;6:e27138. doi: 10.1371/journal.pone.0027138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hu M, Gasser RB. Mitochondrial genomes of parasitic nematodes--progress and perspectives. Trends Parasitol. 2006;22:78–84. doi: 10.1016/j.pt.2005.12.003. [DOI] [PubMed] [Google Scholar]
  • 10.Gissi C, Iannelli F, Pesole G. Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species. Heredity (Edinb) 2008;101:301–32062. doi: 10.1038/hdy.2008.62. [DOI] [PubMed] [Google Scholar]
  • 11.Cameron SL. Insect mitochondrial genomics: implications for evolution and phylogeny. Annu Rev Entomol. 2014;59:95–117. doi: 10.1146/annurev-ento-011613-162007. [DOI] [PubMed] [Google Scholar]
  • 12.Nelson LA, Lambkin CL, Batterham P, Wallman JF, Dowton M, Whiting MF, et al. Beyond barcoding: a mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae) Gene. 2012;511:131–142. doi: 10.1016/j.gene.2012.09.103. [DOI] [PubMed] [Google Scholar]
  • 13.Sun L, Zhuo K, Lin B, Wang H, Liao J. The complete mitochondrial genome of Meloidogyne Graminicola (Tylenchina): a unique gene arrangement and its phylogenetic implications. PLoS One. 2014;9:e98558. doi: 10.1371/journal.pone.0098558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Andersson SGE, Karlberg O, Canbäck B, Kurland CG. On the origin of mitochondria: a genomics perspective. Philos. Trans. R. Soc. B biol. Sci. 2003;358:165–179. doi: 10.1098/rstb.2002.1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sagan L. On the origin of mitosing cells. J Theor Biol. 1967;14:225–IN6. doi: 10.1016/0022-5193(67)90079-3. [DOI] [PubMed] [Google Scholar]
  • 16.Boore JL. Animal mitochondrial genomes. Nucleic Acids Res. 1999;27:1767–1780. doi: 10.1093/nar/27.8.1767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rand DM. “Why genomes in pieces?” revisited: sucking lice do their own thing in mtDNA circle game. Genome Res Cold Spring Harbor Lab Press. 2009;19:700–702. doi: 10.1101/gr.091132.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Taanman J-W. The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta - Bioenerg. 1999;1410:103–123. doi: 10.1016/S0005-2728(98)00161-3. [DOI] [PubMed] [Google Scholar]
  • 19.Wolstenholme DR. Animal mitochondrial DNA: structure and evolution. Int Rev Cytol. 1992;141:173–216. [DOI] [PubMed]
  • 20.Okimoto R, Macfarlane JL, Wolstenholme DR. Evidence for the frequent use of TTG as the translation initiation codon of mitochondrial protein genes in the nematodes, Ascaris suum and Caenorhabditis Elegans. Nucleic Acids Res. 1990;18:6113–6118. doi: 10.1093/nar/18.20.6113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Armstrong MR, Blok VC, Phillips MS. A multipartite mitochondrial genome in the potato cyst nematode Globodera pallida. Genetics. 2000;154:181–192. doi: 10.1093/genetics/154.1.181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gibson T, Farrugia D, Barrett J, Chitwood DJ, Rowe J, Subbotin S, et al. The mitochondrial genome of the soybean cyst nematode, Heterodera glycines. Genome. 2011;54:565–574. doi: 10.1139/g11-024. [DOI] [PubMed] [Google Scholar]
  • 23.Wu S-G, Wang G-T, Xi B-W, Gao D, Nie P, Wu SG, et al. Molecular characteristics of Camallanus Spp. (Spirurida: Camallanidae) in fishes from China based on its rDNA sequences. J Parasitol. 2008;94:731–736. doi: 10.1645/GE-1219R2.1. [DOI] [PubMed] [Google Scholar]
  • 24.Wu S, Wang G, Gao D, Xi B, Yao W, Liu M. Occurrence of Camallanus Cotti in greatly diverse fish species from Danjiangkou reservoir in central China. Parasitol Res. 2007;101:467–471. doi: 10.1007/s00436-007-0472-4. [DOI] [PubMed] [Google Scholar]
  • 25.Levsen A, Berland B. The development and morphogenesis of Camallanus Cotti Fujita, 1927 (Nematoda: Camallanidae), with notes on its phylogeny and definitive host range. Syst Parasitol. 2002;53:29–37. doi: 10.1023/A:1019955917509. [DOI] [PubMed] [Google Scholar]
  • 26.Su Y-B, Kong S-C, Wang L-X, Chen L, Fang R. Complete mitochondrial genome of Philometra carassii (Nematoda: Philometridae) Mitochondrial DNA Taylor & Francis. 2016;27:1397–1398. doi: 10.3109/19401736.2014.947598. [DOI] [PubMed] [Google Scholar]
  • 27.Kim J, Lee SH, Gazi M, Kim T, Jung D, Chun JY, et al. Mitochondrial genomes advance phylogenetic hypotheses for Tylenchina (Nematoda: Chromadorea) Zool Scr BioMed Central. 2015;44:446–462. [Google Scholar]
  • 28.Hazkani-Covo E, Zeller RM, Martin W. Molecular poltergeists: mitochondrial DNA copies (numts) in sequenced nuclear genomes. PLoS Genet. 2010;6(2): e1000834. https://doi.org/10.1371/journal.pgen.1000834. [DOI] [PMC free article] [PubMed]
  • 29.Kikuchi T, Afrin T, Yoshida M. Complete mitochondrial genomes of four entomopathogenic nematode species of the genus Steinernema. Parasit Vectors. 2016;9:430. doi: 10.1186/s13071-016-1730-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Botero-Castro F, Delsuc F, Douzery EJP. Thrice better than once: quality control guidelines to validate new mitogenomes. Mitochondrial DNA. 2014;1736:1–6. doi: 10.3109/19401736.2014.900666. [DOI] [PubMed] [Google Scholar]
  • 31.Ratnasingham S, Hebert PDN. A DNA-based registry for all animal species: the barcode index number (BIN) system. PLoS One. 2013;8:e66213. doi: 10.1371/journal.pone.0066213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Liu GH, Gasser RB, Otranto D, Xu MJ, Shen JL, Mohandas N, et al. Mitochondrial genome of the Eyeworm, Thelazia callipaeda (Nematoda: Spirurida), as the first representative from the family Thelaziidae. PLoS Negl Trop Dis. 2013;7:1–9. doi: 10.1371/annotation/c64f02de-c1f1-48ee-ac79-06b5a6c7b65a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Smythe AB, Sanderson MJ, Nadler SA. Nematode small subunit phylogeny correlates with alignment parameters. Syst Biol. 2006;55:972–992. doi: 10.1080/10635150601089001. [DOI] [PubMed] [Google Scholar]
  • 34.Nadler SA, Carreño RA, Mejía-Madrid H, Ullberg J, Pagan C, Houston R, et al. Molecular phylogeny of clade III nematodes reveals multiple origins of tissue parasitism. Parasitology. 2000;134:1421–1442. doi: 10.1017/S0031182007002880. [DOI] [PubMed] [Google Scholar]
  • 35.Liu G-H, Wang Y, Song H-Q, Li M-W, Ai L, Yu X-L, et al. Characterization of the complete mitochondrial genome of Spirocerca lupi: sequence, gene organization and phylogenetic implications. Parasit Vectors. 2013;6:45. doi: 10.1186/1756-3305-6-45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yilmaz E, Fritzenwanker M, Pantchev N, Lendner M, Wongkamchai S, Otranto D, et al. The mitochondrial genomes of the Zoonotic canine filarial parasites Dirofilaria (Nochtiella) repens and Candidatus Dirofilaria (Nochtiella) Honkongensis provide evidence for presence of cryptic species. Makepeace BL, editor. PLoS Negl Trop Dis.; 2016;10:e0005028.DE GRUYTER. [DOI] [PMC free article] [PubMed]
  • 37.Liu G-H, Shao R, Cai X-Q, Li W-W, Zhu X-Q. Gnathostoma Spinigerum mitochondrial genome sequence: a novel gene arrangement and its Phylogenetic position within the class Chromadorea. Sci Rep Nature Publishing Group. 2015;5:12691. doi: 10.1038/srep12691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sun M-M, Ma J, Sugiyama H, Ando K, Li W-W, Xu Q-M, et al. The complete mitochondrial genomes of Gnathostoma doloresi from China and Japan. Parasitol. Res. Springer. Berlin Heidelberg. 2016;115:4013–4020. doi: 10.1007/s00436-016-5171-6. [DOI] [PubMed] [Google Scholar]
  • 39.Bergsten J. A review of long-branch attraction. Cladistics. 2005;21:163–193. doi: 10.1111/j.1096-0031.2005.00059.x. [DOI] [PubMed] [Google Scholar]
  • 40.Graybeal A. Is it better to add taxa or characters to a difficult phylogenetic problem? Syst Biol. 1998;47:9–17. doi: 10.1080/106351598260996. [DOI] [PubMed] [Google Scholar]
  • 41.Breton S, Milani L, Ghiselli F, Guerra D, Stewart DT, Passamonti M. A resourceful genome: updating the functional repertoire and evolutionary role of animal mitochondrial DNAs. Trends Genet. 2014;30:555–564. doi: 10.1016/j.tig.2014.09.002. [DOI] [PubMed] [Google Scholar]
  • 42.Sammler S, Bleidorn C, Tiedemann R. Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae) provide evidence for pervasive mitochondrial DNA recombination. BMC Genomics. 2011;12:35. doi: 10.1186/1471-2164-12-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Sultana T, Kim J, Lee S-H, Han H, Kim S, Min G-S, et al. Comparative analysis of complete mitochondrial genome sequences confirms independent origins of plant-parasitic nematodes. BMC Evol Biol. 2013;13:1–17. doi: 10.1186/1471-2148-13-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Humphreys-Pereira DA, Elling AA. Mitochondrial genomes of Meloidogyne Chitwoodi and M. Incognita (Nematoda: Tylenchina): comparative analysis, gene order and phylogenetic relationships with other nematodes. Mol. Biochem. Parasitology. 2014;194:20–32. doi: 10.1016/j.molbiopara.2014.04.003. [DOI] [PubMed] [Google Scholar]
  • 45.Azevedo JLB, Hyman BC. Molecular characterization of lengthy mitochondrial DNA duplications from the parasitic nematode Romanomermis culicivorax. Genetics. 1993;133:933–942. doi: 10.1093/genetics/133.4.933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hyman BC, Lewis SC, Tang S, Wu Z. Rampant gene rearrangement and haplotype hypervariation among nematode mitochondrial genomes. Genetica. 2011;139:611–615. doi: 10.1007/s10709-010-9531-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Marlétaz F, Le Parco Y, Liu S, Peijnenburg KT. Extreme Mitogenomic variation in natural populations of Chaetognaths. Genome Biol Evol. 2017;9:1374–1384. doi: 10.1093/gbe/evx090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.San Mauro D, Gower DJ, Zardoya R, Wilkinson M. A hotspot of gene order rearrangement by tandem duplication and random loss in the vertebrate mitochondrial genome. Mol Biol Evol. 2006;23:227–234. doi: 10.1093/molbev/msj025. [DOI] [PubMed] [Google Scholar]
  • 49.Shi W, Gong L, Wang S-Y, Miao X-G, Kong X-Y. Tandem duplication and random loss for mitogenome rearrangement in Symphurus (Teleost: Pleuronectiformes) BMC Genomics. 2015;16:355. doi: 10.1186/s12864-015-1581-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Lavrov DV, Brown WM. Trichinella spiralis mtDNA: a nematode mitochondrial genome that encodes a putative ATP8 and normally structured tRNAs and has a gene arrangement relatable to those of Coelomate metazoans. Genetics. 2001;157(2):621–37. [DOI] [PMC free article] [PubMed]
  • 51.Jacob JEM, Vanholme B, Van Leeuwen T, Gheysen G. A unique genetic code change in the mitochondrial genome of the parasitic nematode Radopholus Similis. BMC Res Notes. 2009;2:192. doi: 10.1186/1756-0500-2-192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Lavrov DV, Pett W. Animal mitochondrial DNA as we do not know it: Mt-genome organization and evolution in Nonbilaterian lineages. Genome biol. Evolution. 2016;8:2896–2913. doi: 10.1093/gbe/evw195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Duchêne AM, Pujol C, Maréchal-Drouard L. Import of tRNAs and aminoacyl-tRNA synthetases into mitochondria. Curr Genet. 2009;55(1):1–18. [DOI] [PubMed]
  • 54.Sahyoun AH, Hölzer M, Jühling F, Höner Zu Siederdissen C, Al-Arab M, Tout K, et al. Towards a comprehensive picture of alloacceptor tRNA remolding in metazoan mitochondrial genomes. Nucleic Acids Res. 2015;43:8044–8056. doi: 10.1093/nar/gkv746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Kilpert F, Podsiadlowski L. The complete mitochondrial genome of the common sea slater, Ligia Oceanica (Crustacea, isopoda) bears a novel gene order and unusual control region features. BMC Genomics. 2006;7:241. doi: 10.1186/1471-2164-7-241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Temperley RJ, Wydro M, Lightowlers RN, Chrzanowska-Lightowlers ZM. Human mitochondrial mRNAs-like members of all families, similar but different. Biochim Biophys Acta - Bioenerg Elsevier. 2010;1797:1081–1085. doi: 10.1016/j.bbabio.2010.02.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Ojala D, Montoya J, Attardi G. tRNA punctuation model of RNA processing in human mitochondria. Nature. 1981;290:470–474. doi: 10.1038/290470a0. [DOI] [PubMed] [Google Scholar]
  • 58.Schuster G, Stern D. RNA Polyadenylation and decay in mitochondria and chloroplasts. Prog Mol Biol Transl Sci. 2009;85:393–422. [DOI] [PubMed]
  • 59.Doublet V, Ubrig E, Alioua A, Bouchon D, Marcade I, Marechal-Drouard L. Large gene overlaps and tRNA processing in the compact mitochondrial genome of the crustacean Armadillidium vulgare. RNA Biol. 2015;12:1159–1168. doi: 10.1080/15476286.2015.1090078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Wen HB, Cao ZM, Hua D, Xu P, Ma XY, Jin W, et al. The complete maternally and paternally inherited mitochondrial genomes of a freshwater mussel Potamilus Alatus (Bivalvia: Unionidae). Waller RF, editor. PLoS One Public Lib Sci. 2017;12:e0169749. doi: 10.1371/journal.pone.0169749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Wang J-G, Zhang D, Jakovlić I, Wang W-M. Sequencing of the complete mitochondrial genomes of eight freshwater snail species exposes pervasive paraphyly within the Viviparidae Family (Caenogastropoda) PLoS One Public Lib Sci (PLoS) 2017;12:e0181699. doi: 10.1371/journal.pone.0181699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Hu M, Gasser RB, Abs El-Osta YG, Chilton NB. Structure and organization of the mitochondrial genome of the canine heartworm, Dirofilaria immitis. Parasitology. 2003;127:37–51. doi: 10.1017/S0031182003003275. [DOI] [PubMed] [Google Scholar]
  • 63.Yatawara L, Wickramasinghe S, Rajapakse RPVJ, Agatsuma T. The complete mitochondrial genome of Setaria Digitata (Nematoda: Filarioidea): mitochondrial gene content, arrangement and composition compared with other nematodes. Mol Biochem Parasitol. 2010;173:32–38. doi: 10.1016/j.molbiopara.2010.05.004. [DOI] [PubMed] [Google Scholar]
  • 64.Bernt M, Braband A, Schierwater B, Stadler PF. Genetic aspects of mitochondrial genome evolution. Mol Phylogenet Evol. 2013;69:328–338. doi: 10.1016/j.ympev.2012.10.020. [DOI] [PubMed] [Google Scholar]
  • 65.Boore JL. The duplication/random loss model for gene rearrangement exemplified by mitochondrial genomes of Deuterostome animals. Netherlands: Springer; 2000. pp. 133–147. [Google Scholar]
  • 66.Kang S, Sultana T, Eom KS, Park YC, Soonthornpong N, Nadler SA, et al. The mitochondrial genome sequence of Enterobius Vermicularis (Nematoda: Oxyurida) - an idiosyncratic gene order and phylogenetic information for chromadorean nematodes. Gene. 2009;429:87–97. doi: 10.1016/j.gene.2008.09.011. [DOI] [PubMed] [Google Scholar]
  • 67.Tang S, Hyman BC. Mitochondrial genome haplotype hypervariation within the isopod parasitic nematode Thaumamermis cosgrovei. Genetics. 2007;176:1139–1150. doi: 10.1534/genetics.106.069518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Lunt DH, Hyman BC. Animal mitochondrial DNA recombination. Nature. 1997;387:247. doi: 10.1038/387247a0. [DOI] [PubMed] [Google Scholar]
  • 69.Lunt DH, Kumar S, Koutsovoulos G, Blaxter ML. The complex hybrid origins of the root knot nematodes revealed through comparative genomics. PeerJ. 2014;2:e356. doi: 10.7717/peerj.356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Ciborowski KL, Consuegra S, García de Leániz C, Beaumont MA, Wang J, Jordan WC. Rare and fleeting: an example of interspecific recombination in animal mitochondrial DNA. Biol Lett. 2007;3:554–557. doi: 10.1098/rsbl.2007.0290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Dowton M, Austin AD. Evolutionary dynamics of a mitochondrial rearrangement hot spot in the hymenoptera. Mol Biol Evol. 1999;16:298–309. doi: 10.1093/oxfordjournals.molbev.a026111. [DOI] [PubMed] [Google Scholar]
  • 72.Wei S, Shi M, He J, Sharkey M, Chen X. The complete mitochondrial genome of Diadegma semiclausum (hymenoptera: ichneumonidae) indicates extensive independent evolutionary events. Genome. 2009;52:308–319. doi: 10.1139/G09-008. [DOI] [PubMed] [Google Scholar]
  • 73.Duò A, Bruggmann R, Zoller S, Bernt M, Grünig CR. Mitochondrial genome evolution in species belonging to the Phialocephala fortinii s.L. - Acephala applanata species complex. BMC Genomics. 2012;13:166. doi: 10.1186/1471-2164-13-166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Wu Z, Cuthbert JM, Taylor DR, Sloan DB. The massive mitochondrial genome of the angiosperm Silene Noctiflora is evolving by gain or loss of entire chromosomes. Proc Natl Acad Sci U S A. 2015;112:10185–10191. doi: 10.1073/pnas.1421397112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Kitazaki K, Kubo T, Kitazaki K, Kubo T. Cost of having the largest mitochondrial genome: evolutionary mechanism of plant mitochondrial genome. J Bot. 2010;2010:1–12. doi: 10.1155/2010/620137. [DOI] [Google Scholar]
  • 76.Watanabe KI, Bessho Y, Kawasaki M, Hori H. Mitochondrial genes are found on minicircle DNA molecules in the mesozoan animal Dicyema. J Mol Biol. 1999;286:645–650. doi: 10.1006/jmbi.1998.2523. [DOI] [PubMed] [Google Scholar]
  • 77.Pont-Kingdon G, Vassort CG, Warrior R, Okimoto R, Beagley CT, Wolstenholme DR. Mitochondrial DNA of Hydra Attenuata (Cnidaria): a sequence that includes an end of one linear molecule and the genes for l-rRNA, tRNA (f-met), tRNA (Trp), COII, and ATPase8. J Mol Evol. 2000;51:404–415. doi: 10.1007/s002390010103. [DOI] [PubMed] [Google Scholar]
  • 78.Shao R, Kirkness EF, Barker SC. The single mitochondrial chromosome typical of animals has evolved into 18 minichromosomes in the human body louse, Pediculus humanus. Genome Res. 2009;19:904–912. doi: 10.1101/gr.083188.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Suga K, Mark Welch DB, Tanaka Y, Sakakura Y, Hagiwara A. Two circular chromosomes of unequal copy number make up the mitochondrial genome of the rotifer Brachionus Plicatilis. Mol Biol Evol. 2008;25:1129–1137. doi: 10.1093/molbev/msn058. [DOI] [PubMed] [Google Scholar]
  • 80.Nie ZJ, Gu RB, Du FK, Shao NL, Xu P, Xu GC. Monogonont rotifer, Brachionus Calyciflorus, possesses exceptionally large, fragmented mitogenome. Yue B-S, editor. PLoS One Pub Lib Sci. 2016;11:e0168263. doi: 10.1371/journal.pone.0168263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Phillips WS, Brown AMV, Howe DK, Peetz AB, Blok VC, Denver DR, et al. The mitochondrial genome of Globodera ellingtonae is composed of two circles with segregated gene content and differential copy numbers. BMC Genomics. 2016;17:706. doi: 10.1186/s12864-016-3047-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Wei DD, Shao R, Yuan ML, Dou W, Barker SC, Wang JJ. The multipartite mitochondrial genome of liposcelis bostrychophila: insights into the evolution of mitochondrial genomes in bilateral animals. PLoS One. 2012;7 [DOI] [PMC free article] [PubMed]
  • 83.Fujita MK, Boore JL, Moritz C. Multiple origins and rapid evolution of duplicated mitochondrial genes in Parthenogenetic geckos (Heteronotia Binoei; Squamata, Gekkonidae) Mol Biol Evol. 2007;24:2775–2786. doi: 10.1093/molbev/msm212. [DOI] [PubMed] [Google Scholar]
  • 84.Mueller RL, Boore JL. Molecular mechanisms of extensive mitochondrial gene rearrangement in Plethodontid salamanders. Mol Biol Evol. 2005;22:2104–2112. doi: 10.1093/molbev/msi204. [DOI] [PubMed] [Google Scholar]
  • 85.Lagisz M, Poulin R, Nakagawa S. You are where you live: parasitic nematode mitochondrial genome size is associated with the thermal environment generated by hosts. J Evol Biol. 2013;26:683–690. doi: 10.1111/jeb.12068. [DOI] [PubMed] [Google Scholar]
  • 86.Wu SG, Wang GT, Xi BW, Gao D, Nie P. Population dynamics and maturation cycle of Camallanus Cotti (Nematoda: Camallanidae) in the Chinese hooksnout carp Opsariichthys Bidens (Osteichthyes: Cyprinidae) from a reservoir in China. Vet Parasitol. 2007;147:125–31. [DOI] [PubMed]
  • 87.Menezes RC, Tortelly R, Tortelly-Neto R, Noronha D, Pinto RM. Camallanus Cotti Fujita, 1927 (Nematoda, Camallanoidea) in ornamental aquarium fishes: pathology and morphology. Mem Inst Oswaldo Cruz. 2006;101:683–687. doi: 10.1590/S0074-02762006000600018. [DOI] [PubMed] [Google Scholar]
  • 88.Wu S-G. Population biology and molecular ecology of the nematode Camallanus Cotti. Doctoral dissertation (in Chinese): Chinese Academy of Sciences. Chinese Academy of Sciences; 2007.
  • 89.Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci. 1977;74:5463–5467. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–402. [DOI] [PMC free article] [PubMed]
  • 91.Burland TG. DNASTAR’s Lasergene Sequence Analysis Software. In: Misener S., Krawetz S.A. (eds) Bioinformatics Methods and Protocols. Methods in Molecular Biology™. Totowa: Humana Press. 2000;132:71-91. https://doi.org/10.1385/1-59259-192-2:71. ISBN 978-1-59259-192-3. [DOI] [PubMed]
  • 92.Hu M, Jex AR, Campbell BE, Gasser RB. Long PCR amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nat Protoc. 2007;2:2339–2344. doi: 10.1038/nprot.2007.358. [DOI] [PubMed] [Google Scholar]
  • 93.Zhang D, Zou H, Wu SG, Li M, Jakovlić I, Zhang J, et al. Sequencing, characterization and phylogenomics of the complete mitochondrial genome of Dactylogyrus Lamellatus (Monogenea: Dactylogyridae). J Helminthol. 2017:1–12. [DOI] [PubMed]
  • 94.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–1649. doi: 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Bernt M, Donath A, Jühling F, Externbrink F, Florentz C, Fritzsch G, et al. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol Phylogenet Evol. 2013;69:313–319. doi: 10.1016/j.ympev.2012.08.023. [DOI] [PubMed] [Google Scholar]
  • 96.Laslett D, Canbäck B. Arwen: a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics. 2008;24:172–175. doi: 10.1093/bioinformatics/btm573. [DOI] [PubMed] [Google Scholar]
  • 97.Zhang D. MitoTool [Internet]. [cited 2017 Jun 26]. Available from: https://github.com/dongzhang0725/MitoTool.
  • 98.Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Silvestro D, Michalak I. RaxmlGUI: a graphical front-end for RAxML. Org Divers Evol. 2012;12:335–337. doi: 10.1007/s13127-011-0056-0. [DOI] [Google Scholar]
  • 101.Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312–1313. doi: 10.1093/bioinformatics/btu033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.ITIS. Integrated Taxonomic Information System (ITIS) [Internet]. [cited 2017 May 8]. Available from: http://www.itis.gov.
  • 103.Liu G-H, Jia Y-Q, Wang Y-N, Zhao G-H, Zhu X-Q. The complete mitochondrial genome of the gullet worm Gongylonema pulchrum: gene content, arrangement, composition and phylogenetic implications. Parasit Vectors. 2015;8:100. doi: 10.1186/s13071-015-0697-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Lavrov DV, Boore JL, Brown WM. The complete mitochondrial DNA sequence of the horseshoe crab Limulus Polyphemus. Mol. Biol. Evolution. 2000;17:813–824. doi: 10.1093/oxfordjournals.molbev.a026360. [DOI] [PubMed] [Google Scholar]
  • 105.Zhang D. Biosuite [Internet]. [cited 2017 Jun 26]. Available from: https://github.com/dongzhang0725/BioSuite.
  • 106.Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:1572–1574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  • 107.Keane TM, Creevey CJ, Pentony MM, Naughton TJM, Mclnerney JO. Assessment of methods for amino acid matrix selection and their use on empirical data shows that ad hoc assumptions for choice of matrix are not justified. BMC Evol Biol. 2006;6:29. doi: 10.1186/1471-2148-6-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 108.Xia X, Xie Z. DAMBE: software package for data analysis in molecular biology and evolution. J Hered. 2001;92:371–373. doi: 10.1093/jhered/92.4.371. [DOI] [PubMed] [Google Scholar]
  • 109.Letunic I, Bork P. Interactive tree of life (iTOL): an online tool for phylogenetic tree display and annotation. Bioinformatics. 2007;23:127–128. doi: 10.1093/bioinformatics/btl529. [DOI] [PubMed] [Google Scholar]
  • 110.Hu F, Lin Y, Tang J. MLGO: phylogeny reconstruction and ancestral inference from gene-order data. BMC Bioinformatics. 2014;15:354. doi: 10.1186/s12859-014-0354-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 111.Bernt M, Merkle D, Ramsch K, Fritzsch G, Perseke M, Bernhard D, et al. CREx: inferring genomic rearrangements based on common intervals. Bioinformatics. 2007;23:2957–2958. doi: 10.1093/bioinformatics/btm468. [DOI] [PubMed] [Google Scholar]
  • 112.McNulty SN, Vaughan JA, Tkach VV, Mullin AS, Weil GJ, Fischer PU. Comparing the mitochondrial genomes of Wolbachia-dependent and independent filarial nematode species. BMC Genomics. 2012;13:145. doi: 10.1186/1471-2164-13-145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113.Ghedin E, Wang S, Spiro D, Caler E, Zhao Q, Crabtree J, et al. Draft genome of the filarial nematode parasite Brugia malayi. Science. 2007;317:1756–1760. doi: 10.1126/science.1145406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114.Keddie EM, Higazi T, Unnasch TR. The mitochondrial genome of Onchocerca volvulus: sequence, structure and phylogenetic analysis. Mol Biochem Parasitol. 1998;95:111–127. doi: 10.1016/S0166-6851(98)00102-9. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1: (40.6KB, pdf)

Taxonomic identification of the studied C. cotti nematode using cox1 barcoding. Maximum likelihood analysis was conducted on 100 Camallanidae cox1 sequences, with GenBank accession numbers shown in the figure. The clade containing the queried sequence (‘Camallanus cotti this study’) is shaded purple. (PDF 40 kb)

Additional file 2: (18.7KB, xlsx)

Statistics and gene features of Spirurida mitogenomes. Worksheet A lists all the species, GenBank accession numbers, genome sizes in bp, base composition and skew. Worksheet B lists gene sizes for all species, and their corresponding (putative) start and terminal codons. Species are represented by acronyms of their binomial scientific names. (XLSX 18 kb)

Additional file 3: (514.1KB, pdf)

Mitogenomic gene order rearrangements in the Camallanina suborder. (A). A hypothetical outline of gene order rearrangements between Camallanus cotti and ancestral node A1. Ancestral node A1 is shown in Fig. 1. Genes and mitogenome fragments presumed to have undergone rearrangements are highlighted by different colours. Hypothetical rearrangement mechanism is indicated on the left, and arrows are used to indicate the putative translocation pathways. Where the presumed mechanism is duplication + transposal, arrows indicate the positions of both fragments in the downstream genome, where the fragment presumed to be translocated is labelled with the letter C. Where colouring is insufficiently unambiguous, fragments undergoing a rearrangement event are additionally underlined. The order in which the events are shown is (mostly) random. A star is used to indicate a deletion and a thick blue arrow to indicate a tRNA remolding event. (B) A hypothetical outline of gene order rearrangements between ancestral nodes A2 and A1. Ancestral nodes are shown in Fig. 1. Genes and mitogenome fragments presumed to have undergone rearrangements are highlighted by different colours. Hypothetical rearrangement mechanism is indicated on the left, and arrows are used to indicate the putative translocation pathways. Where colouring is insufficiently unambiguous, fragments undergoing a rearrangement event are additionally underlined. The order in which the events are shown is (mostly) random. MLGO was used to infer the putative ancestral gene orders. (C). Hypothetical evolutionary history of gene order rearrangements between ancestral nodes A2 and A1 inferred by CREX algorithm. Ancestral nodes are shown in Fig. 1. Tdrl indicates a tandem duplication and random loss event, where a duplication event (not shown) is followed by the loss of some elements (orange-shaded). This results in the remaining copies (blue-shaded) being moved to the front. (PDF 514 kb)

Data Availability Statement

The datasets supporting the conclusions of this article are included within the article and its additional file, as well as in the GenBank repository under the accession number MF580344 [28].


Articles from BMC Genomics are provided here courtesy of BMC

RESOURCES