Maintenance Therapy with Low-Dose Azacitidine after Allogeneic Hematopoietic Stem Cell Transplantation for Relapsed AML or MDS: a Dose and Schedule Finding Study

Abstract

Background

Recurrence is a major cause of treatment failure after allogeneic transplantation for AML and MDS, and treatment options are very limited. Azacitidine is a DNA methyltransferase inhibitor with activity in myeloid disease. We hypothesized that low-dose azacitidine administered after transplant would reduce relapse rates, and conducted a study to determine a safe dose/schedule combination.

Methods

Forty-five high-risk patients were treated. Median age was 60 years; median number of comorbidities was three; 67% were not in remission. Using a Bayesian adaptive method to determine the best dose/schedule combination based on time to toxicity, we investigated combinations of five daily azacitidine doses: 8, 16, 24, 32 and 40 mg/m², and four schedules: 1, 2, 3 or 4 cycles, each with 5 days of drug and 25 days of rest. Cycle 1 started on day +40.

Results

Reversible thrombocytopenia was the dose-limiting toxicity. The optimal combination was 32 mg/m² given for 4 cycles. Median follow-up is 20.5 months. One-year event-free and overall survival were 58% and 77%, justifying further studies to estimate long-term clinical benefit. No dose significantly affected DNA global methylation.

Conclusions

Azacitidine at 32 mg/m² given for 5 days is safe and can be administered after allogeneic transplant for at least 4 cycles to heavily pre-treated AML/MDS patients. Our trial also suggested that this treatment may prolong event-free and overall survival, and that more cycles may be associated with greater benefit.

Introduction

Patients with acute myelogenous leukemia (AML) or advanced myelodysplastic syndrome (MDS) who fail to achieve a complete remission (CR) or are otherwise refractory to therapy have a poor prognosis. Allogeneic hematopoietic stem cell transplantation (HSCT) is frequently considered a salvage option for these patients, but disease recurrence and non-relapse mortality remain a major cause of treatment failure for patients transplanted without remission.(1;2) Preparative regimen dose escalation has failed to improve results significantly, in large part due to a direct relationship between dose intensity and treatment related mortality. The CR rate with HSCT, however, is high and most patients transplanted in relapse will be in morphologic remission after HSCT, but these remissions are usually short-lived. Because most relapses occur early, any preventative intervention must be implemented during the first 3 months after HSCT in order to be effective. In this scenario, new strategies for maintaining remission are needed.

Pharmacologic maintenance is difficult to achieve with traditional agents due to multiple drug interactions and myelosuppression risk. An ideal drug should have activity against the disease, without excessive myelosuppression. Azacitadine is effective in MDS in doses that are likely to induce severe pancytopenia after HSCT.(3) This hypomethylating agent appears to reverse DNA hypermethylation, leading to silencing of tumor suppressing genes in malignant cells. Azacitidine and decitabine may also cause phenotypic modification of leukemic cells (including increased expression of MHC-class I and HLA-DR), and induction of expression of cancer antigens that could potentially enhance the graft-versus-leukemia effect.(4–9) We have shown that low-dose azacitidine is moderately active in re-inducing remission and donor chimerism for patients with indolent AML/MDS relapses after HSCT, using doses ranging from 16–40 mg/m² for 5 days in 28–30-day cycles.(10)

We therefore hypothesized that azacitidine might decrease the relapse rate after HSCT. However, it might worsen graft-versus-host disease (GVHD), compromise graft function and immune recovery, or induce other adverse effects. A phase I study consequently was necessary. We were also interested in demonstrating that the drug can be administered repeatedly after transplant, assuming that patients treated early on, when grafts are vulnerable to myelosuppression, would be able to safely receive longer administration schedules in future studies. Herein we present the results of such study.

Methods

Eligibility

Eligible were adult patients with AML or high-risk MDS (IPSS(11) intermediate-2 or high-risk) aged 18–75 years, not in first CR (CR1), who were not candidates for myeloablative transplant regimens due to older age or comorbidities. After establishing the low toxicity profile of azacitidine, we amended the protocol to allow inclusion of high-risk CR1 patients. Donors could be related or unrelated, matched at HLA-A, B, C, DRB1 and DQB1 (one mismatch allowed), typed as previously described.(12)

Other eligibility criteria included a LVEF >40%, a FEV1, FVC and DLCO >40%, creatinine <1.6 mg/dL, bilirubin <1.6 mg/dL, HIV seronegativity, negative pregnancy test, absence of active infection, and ability to undergo the informed consent process. The protocol was approved by the M. D. Anderson Cancer Center IRB.

A reduced-intensity regimen of gemtuzumab ozogamicin 2 mg/m² (given to 40 CD33 positive patients on day −12), fludarabine 30mg/m², (days −5, −4, −3, and −2), and melphalan 140 mg/m² (day −2) was used.(13) Patients with unrelated or mismatched-related donor received rabbit anti-thymocyte globulin (ATG) 0.5 mg/kg (day −3) and 1.25 mg/kg (days −2,−1). GVHD prophylaxis was tacrolimus and mini-methotrexate (5 mg/m2 on days 1, 3, 6 and 11), or sirolimus, mycophenolate mofetil and ATG (n=5). Supportive care was as previously described. (13)

Eligibility to receive azacitidine

Patients in CR by HSCT day +30 were eligible to receive azacitidine, while patients with persistent disease or without donor engraftment were removed from study. Other eligibility criteria to start azacitidine were as follows: creatinine <1.6 mg/dL, bilirubin <1.6 mg/dL, SGPT ≤3 X upper limit of normal, platelet count >15,000/mm³ and absolute neutrophil count (ANC)>1,000/mm³. Patients could not have bleeding, uncontrolled infection or grade III/IV acute GVHD. If not eligible for treatment during the first three months post transplant patients went off protocol.

Azacitidine was given for one to four 30-day cycles. In each cycle, the drug was administered subcutaneously for 5 days, starting on the 6^th week after HSCT at one of five dose levels (8, 16, 24, 32 or 40 mg/m2).

Development of drug-related grade 3 or 4 organ toxicity or severe infection led to azacitidine discontinuation. Azacitidine was also discontinued if platelet count dropped below 10,000/mm3 with 50% dose reduction if platelet count dropped below 20,000/mm3, or if ANC dropped to <500/mm3, not responsive to growth factor. G-CSF administration was allowed.

Evaluation of response and definitions

Patients had a bone marrow aspiration on transplant day +30, +100–120, at nine and twelve months after transplantation. CR was defined as <6% bone marrow blasts and evidence of donor chimerism (>80%) by DNA microsatellite polymorphism analysis.

Bone marrow or peripheral blood donor-recipient chimerism was evaluated using DNA microsatellite polymorphism analysis by polymerase chain reaction. We also used conventional cytogenetic analysis with G-banding or fluorescent in-situ hybridization studies for the Y-chromosome in sex-mismatched transplants. Mixed chimerism was defined as the presence of any detectable percentage of unsorted recipient cells or DNA.

Analysis of DNA methylation

We studied long interspersed nuclear elements (LINE) methylation, a marker of global DNA methylation using bisulfite pyrosequencing.(14) Methods for bisulfite modification of DNA and subsequent PCR techniques are described in http://www3.mdanderson.org/leukemia/methylation and in Table 1. The degree of methylation was calculated using the PSQHS 96A 1.2 software (Biotage AB, Sweden). Blood samples were obtained on days 1, 5 and 21 of treatment with azacitidine (n=38 patients).

Table 1.

Primers and conditions used for PCR of Pyrosequencing

Primer	Sequences	Gene Bank accession number	Temperature °C, (cycles)
LINE	F: 5- TTTTGAGTTAGGTGTGGGATATA -3 * R: 5- AAAATCAAAAAATTCCCTTTC -3 Sequencing: 5-AGTTAGGTGTGGGATATAGT-3	X58075	56 (45)

^*Biotin-labeled

Statistical Methods

The primary goal was to find the best combination of per-administration dose (PAD) and schedule of azacitidine. Each patient was assigned one (PAD/Schedule) combination, with “schedule”= 1, 2, 3, or 4 cycles. The first cycle started approximately on day 40 post transplant. Under schedule 1, the assigned PAD was given on transplant days (40,41,42,43,44); under schedule 2 on days (40,41,42,43,44, 68,69,70,71,72), and similarly for schedules 3 and 4. The outcome was the time to toxicity, where “toxicity” was defined as any of the following adverse events occurring within 116 days from the start of the first cycle: (1) NCI grade 3 or higher renal, hepatic, cardiac, pulmonary or neurologic toxicity; (2) grade III–IV acute GVHD; (3) serious infection; (4) severe hematologic toxicity/graft failure, or (5) >two dose reductions for any reason. The Bayesian method of Braun et al.(15) was used to adaptively choose each new patient’s (PAD/Schedule) combination, based on the probability of toxicity within 116 days from the start of therapy, “ptox,” with the goal to choose the (PAD/Schedule) combination having posterior mean ptox closest to .30, a criterion similar to that used by the Continual Reassessment Method.(16) Additional safety rules were (1) a (PAD/Schedule) pair was “acceptably safe” if the posterior probability of (ptox >.30) was no > .80, with no unacceptable pairs administered, and (2) when escalating to a (PAD/Schedule) pair that had not yet been tried, it was allowed to increase either the PAD or schedule, a “do not skip” rule.

The trial was conducted as follows, where “escalation” (“de-escalation”) means increasing (decreasing) PAD, schedule or both:

1. Treat the first patient at the lowest (dose, schedule) pair, (8 mg/m², 1 cycle);

2. For each patient after the first, based on the current data under the Bayesian model, determine the set of acceptably safe (PAD/Schedule) combinations;

3. If none of the (PAD/Schedule) combinations are acceptably safe, then stop the trial and conclude that none of (PAD/Schedule) combinations are acceptable;

4. If one or more (PAD/Schedule) combinations are acceptably safe, then assign the next patient to the combination for which, based on the current data, the posterior mean of ptox is closest to the targeted value .30, subject to the escalation constraint of the “do not skip” rule;

5. If the safe dose with ptox closest to the targeted value .30 is below the current (PAD/Schedule) combination, then there was no constraint on de-escalation.

It was planned initially to study the three PAD’s 8, 16, 24 mg/m2. When only one toxicity was observed in the first 27 patients, the design was extended to include four higher PAD’s 32, 40, 48 or 56 mg/m2, of which 48 and 56 mg/m2 were not studied.

Unadjusted probabilities of overall survival (OS) and event-free survival (EFS) were estimated using the Kaplan-Meier method.(17) The log-rank test(18) was used to compare unadjusted OS or PFS between subgroups. A Bayesian log-normal regression model was used to assess the effects of covariates and treatment on OS and PFS. Covariates included log(bone marrow blast), number of previous chemotherapy regimens (>=2 vs. <=1), cytogenetics, number of comorbidities, dose and number of cycles of azacitidine. The lognormal regression model was selected using the Bayes Information Criterion and the Bayesian chi-squared method.(19) Each covariate parameter in the lognormal model linear term was assumed to follow a normal prior with mean 0 and variance 10000, denoted N(0,10000), and the dispersion parameter followed a non-informative inverse-Gamma prior with mean 1 and variance 10000. A Bayesian logistic regression model was fit for the binary indicator of chronic GVHD, with each parameter in the linear term of covariates following a non-informative N(0,10000) prior. The Bayesian model fits were carried out in WinBugs1.4(20); all other analyses were carried out in Splus6.1.(21) The Bayesian parametric model underlying the method(15) was fit to the final data to assess the joint effects of PAD and schedule on the risk of toxicity.

Results

Patients

Median age was 60.6 years (range, 24.3 – 73.8 years). Diagnoses were AML (n=37) or MDS (n=8); 67% of the patients were not in CR at HSCT. The median number of prior chemotherapy regimens was 2, 39 patients previously received high-dose Ara-C-based chemotherapy, and 18% of the patients had failed a previous allogeneic HSCT. The median number of clinical comorbidities was 3 (Table 2), and median performance status was 1 (range, 0–2).

Table 2.

Patient characteristics.

Variable	N (%)	Median (range)
Age (years)	45	60.6 (24.3 – 73.8)
Bone marrow blast at transplant (%) (all patients)	N=45	6 (0 – 80)
Median bone marrow blasts at transplant (patients with active disease)	N=30	10(6–80%)
Gender
Female	21 (46.7)
Male	24 (53.3)
Diagnosis
AML	37 (82.2)
MDS	8 (17.8)
Cytogenetics(11;35)
Bad#	18 (40.0)
Intermediate	26 (57.8)
Good	1 (2.2)
Number of Chemotherapy regimens received prior to transplant
0	2 (4.4)
1	18 (40.0)
2	17 (37.8)
3	5 (11.1)
4	3 (6.7)
Complete remission at transplant
No	30 (66.7)
Primary induction failure	16
first and second relapse	11 and 1
Untreated high-risk MDS	2
Yes	15 (33.3)*
Number of comorbidities**(36)
0	5 (11.1)
1	7 (15.6)
2	5 (11.1)
3	9 (20.0)
4	10 (22.2)
5	2 (4.4)
6	4 (8.9)
7	1 (2.2)
8	2 (4.4)
Median performance status at transplant		1 (0–2)
Donor type
Unrelated	19 (42.2)
Related	26 (57.8)
Stem cell source
Bone marrow	11 (24)
Peripheral blood	34 (76)
Azacitidine dose
8	7 (15.6)
16	4 (8.9)
24	17 (37.8)
32	15 (33.3)
40	2 (4.4)
Number of Azacitidine cycles
1	13 (28.9)
2	13 (28.9)
3	10 (22.2)
4	9 (20.0)

^*First CR: n=5 (without cytogenetic CR, n=2; with minimal residual disease by flow cytometry and poor prognosis cytogenetics, n=1; requiring 2 or more cycles of chemotherapy to enter CR, n=2); second CR, n=7; third CR, n=3.

^#Included 7 patients with chromosome 7 deletions.

^**Co-morbidities were scored as in reference 36.

Donors, grafts and engraftment

Donors were unrelated (42%) and related (58%). All but three donor-recipient pairs were fully matched. Median number of infused CD34 positive and total nucleated cells was 4.3×10⁶ (range, 1.04–13.3) and 8.0×10⁸ (range, 0.4–26.9). Median time to neutrophil and platelet engraftment was 12 days (n=45; range, 10–23) and 17 days (n=43; range, 10–66). As expected with this preparative regimen, most patients (96%) exhibited 100% donor chimerism on day 30–40. Azacitidine did not affect engraftment (median of 100% donor chimerism for evaluable patients at 6 and 12 months after HSCT).

Preparative regimen and azacitidine

Ninety patients were enrolled. Four never started the conditioning due to death or serious infections, ten patients died early (up to day +60), and two did not respond to transplant. Of the 74 patients potentially eligible to receive azacitidine, 45 actually received it (60%), and comprise the group described here. Reasons for never receiving azacitidine were refusal (n=3), GVHD (n=5), pancytopenia (n=6), elevated creatinine (n=4), and infections (n=11). Patients received a total of 105 cycles of azacitidine.

Event-free and overall survival

Median follow-up is 20.5 months (range, 7.7–39.6 months). Nineteen patients have died (42%) at a median of 30.8 months (95% CI: 14.3 months–upper limit not estimable; Figure 1). Causes of death included GVHD (n=3), pneumonia and pulmonary hemorrhage (n=1), and disease relapse (n=15). Non-relapse mortality rate was 9% (n=4).

Figure 1.

Kaplan-Meier estimates of overall survival (n=45): (all patients: figure 1a – with 95% confidence band); by cytogenetics risk group (figure 1b); by donor type (figure 1c); by remission (CR) status at transplant (figure 1d). There is no significant difference among subgroups for any of the three variables, with log-rank p-values of 0.55, 0.50 and 0.10, respectively.

Figure 1a​

Figure 1b. Cyto = cytogenetics.

Figure 1c. Donor type (sib=sibling; MUD = unrelated donor).

Figure 1d. CR= complete remission.

Twenty-four patients have relapsed (53%). Seven relapses occurred while on azacitidine: at 16 mg/m² for two cycles (n=1, AML in CR3, second HSCT), 24 mg/m² for one cycle (n=3, in first relapse), 32 mg/m² for one cycle (n=2, primary induction failure (PIF) and first relapse), and 40 mg/m² for two cycles (n=1, PIF).

Twenty-eight patients (62%) died or relapsed. Median EFS was 18.2 months (95% CI: 11.9 months–upper limit not estimable; Figure 2). Cytogenetics or donor type did not affect EFS. There was however a significant EFS difference favoring patients in CR versus those with active disease (median of 27.2 versus 12 months; p=0.05, log rank test).

Figure 2.

Kaplan-Meier estimates of event-free survival (n=45): (all patients: figure 2a, with 95% confidence band ); by cytogenetics risk group (figure 2b); by donor type (figure 2c); by remission status at transplant (figure 2d). There was no significant difference among subgroups for cytogenetics or donor type (p=0.97 and p=0.50, log-rank test). However, there was a significant difference in EFS favoring patients in CR (six events; median of 27.2 months with lower 95% CI 12.1 months), versus those with active disease at HSCT (22 events; median of 12.0 months with 95% CI: 8.4 – 24.4 months; p=0.05; log-rank test).

Figure 2a.​

Figure 2b. Cyto= cytogenetics.

Figure 2c. Donor type: sib = sibling; MUD = unrelated donor.

Figure 2d. Disease status at transplant (CR= complete remission; BMT = bone marrow transplant).

The fitted Bayesian model indicates that longer OS was significantly associated with having less bone marrow blasts, a smaller number of previous chemotherapies, less comorbidities and more cycles of azacitidine (posterior probability 0.95 of a beneficial effect; Table 3). There was no significant association between azacitidine dose and OS. Similar results were noted in the EFS model (Table 4).

Table 3. Fitted Bayesian log-normal survival model for overall survival (N=45).

Values in the column “Probability of a Beneficial Effect” close to either 1 or 0 correspond to a significant effect. Higher number of administered cycles of azacitidine, but not dose, was associated with improved survival.

Variable	Mean	SD	Posterior 95% Credible Interval		Probability of a Beneficial Effect
			2.5%	97.5%
Intercept	1.474	0.337	0.787	2.174	-
log(BM blast)	−0.108	0.062	−0.253	−0.003	0.022
Number of chemotherapy regimens >=2 (versus 0, 1)	−0.334	0.187	−0.707	−0.005	0.023
Number of comorbidities	−0.086	0.041	−0.176	−0.013	0.010
Azacitidine dose	0.006	0.009	−0.010	0.026	0.716
Number of cycles	0.118	0.074	−0.029	0.263	0.946
r	0.676	0.272	0.247	1.293	-

Table 4. Fitted Bayesian log-normal model for event-free survival (N=45).

Values in the column “Probability of a Beneficial Effect” close to either 1 or 0 correspond to a significant effect. Higher number of administered cycles of azacitidine, but not dose, was associated with improved EFS.

Variable	Mean	SD	Posterior 95% Credible Interval		Probability of a Beneficial Effect
			2.50%	97.50%
Intercept	1.573	0.327	0.937	2.213	-
log(BM blast)	−0.140	0.058	−0.264	−0.030	0.007
Number of chemotherapy regimens >=2 (versus 0, 1)	−0.429	0.183	−0.798	−0.078	0.006
Number of comorbidities	−0.085	0.040	−0.169	−0.015	0.008
Azacitidine dose	−0.006	0.008	−0.020	0.011	0.208
Number of cycles	0.137	0.076	−0.003	0.299	0.971
r	0.816	0.260	0.390	1.402	-

Acute and chronic GVHD

Grade II–III, and grade III acute GVHD rate was 27% and 9%, respectively. Since most GVHD started before azacitidine initiation, and patients that developed severe GVHD earlier were excluded, these results should be interpreted with caution.

Eighteen of 43 patients at risk developed chronic GVHD (37%). The probability of developing chronic GVHD decreased significantly with the number of azacitidine cycles, but was unaffected by dose (Table 5).

Table 5.

Fitted Bayesian logistic regression model for chronic GVHD (N=43; 2 patients were inevaluable due to early deaths).

Variable	Mean	SD	Posterior 95% Credible Interval		Probability of a Beneficial Effect
			2.50%	97.50%
Intercept	0.582	0.779	−0.887	2.111	-
Azacitidine dose	−0.0145	0.036	−0.083	0.057	0.658
Number of cycles	−0.439	0.311	−1.073	0.159	0.928

Toxicities and infections

Median platelet count at the start of AZA was 113,000/mm³ (range, 16,000–302,000; lower quartile, 69,500), while median WBC was 5,600/mm³ (range, 2,800–18,000) and median absolute neutrophil count was 3,000/mm³ (range, 1,220 – 15,800). There was no correlation in this relatively small series between white cell or platelet count at the start of maintenance, and development of hematologic toxicities. Hematologic toxicities associated/possibly associated with azacitidine included reversible grade I/II or III thrombocytopenia (n=7 and n=2), which was documented more often with 32 mg/m², and in one of two patients receiving 40 mg/m². Grade I/II neutropenia was documented in 7 cases.

Other toxicities included grade I nausea (n=9), grade II fatigue (n=6), grade I/II transaminases elevation (n=3), pruritus (n=1), grade I confusion (n=2), grade II creatinine elevation (n=1), and oral ulcers (n=2). There were three cases of possible ocular toxicity: conjunctival erythema, retina hemorrhage with platelet count drop to 50,000/mm³ (possibly pre-existing), and papilledema. One patient developed cholecystitis. The most serious possibly drug-related adverse event was one case of pulmonary hemorrhage due to fungal pneumonia, which occurred in a patient receiving a second HSCT, who evolved with thrombocytopenia, and multiorgan failure. Infections that occurred during the treatment period were considered to be within the expected profile seen in this population.

The fitted model for the risk of toxicity as a function of PAD and number of cycles that was used as a basis for choosing (PAD/Schedule) pairs during the trial is summarized in Table 6. The risk of toxicity from one administration at a given dose is characterized by three parameters that determine a triangular hazard function. The three parameters are the hazard triangle’s area, days to peak, and days from peak to the end. Additional details of the statistical model and method are given in Braun et al.(15) Table 8 gives the posterior mean of the probability of toxicity by day 116 from the first administration of azacitidine, as a function of PAD and number of cycles (“ptox”). The design targeted a (PAD/Schedule) combination having posterior mean ptox closest to 0.30. Tables 6 and Table 7 show that, in terms of proximity to the targeted mean ptox of 0.30, two equally “optimal” safe combinations were (32 mg/m², 4 cycles), which had posterior mean ptox=0.26, and (40mg/m², 3 cycles), which had posterior mean ptox=0.34. The dose 32 mg/m² for 4 cycles combination was chosen due to thrombocytopenia observed with 40 mg/m².

Table 6.

Posterior values of Prob(ptox > 0.30), for ptox = the probability of toxicity within 116 days. A (dose, schedule) combination was considered to be excessively toxic if this probability exceeded 0.80. For each combination of (Number of Cycles, Per-Administration Dose), A = acceptable toxicity, T = unacceptable toxicity.

	Per Administration Dose of Vidaza (mg/m2)
Number of Cycles	8	16	24	32	40	48	56
4	0.006 A	0.034 A	0.148 A	0.269 A	0.783 A	0.920 T	0.970 T
3	0.001 A	0.005 A	0.030 A	0.083 A	0.558 A	0.755 A	0.883 T
2	0.000 A	0.000 A	0.001 A	0.004 A	0.220 A	0.371 A	0.541 A
1	0.000 A	0.000 A	0.000 A	0.000 A	0.025 A	0.045 A	0.076 A

Table 8.

Posterior mean ptox = probability of toxicity by day 116.

	Per Administration Dose of Vidaza (mg/m2)
Number of Cycles	8	16	24	32	40	48	56
4	0.105	0.164	0.225	0.260	0.407	0.475	0.531
3	0.082	0.129	0.180	0.211	0.339	0.394	0.445
2	0.056	0.089	0.125	0.148	0.246	0.289	0.331
1	0.029	0.046	0.065	0.077	0.134	0.160	0.186

Although the pair two courses and dose 48 mg/m² had predicted mean ptox 0.289 it was not selected as best because no patients were treated at this dose level.

Table 7.

Posterior mean and standard deviation of the per-administration hazard parameters in the Bayesian model for the probability of toxicity as a function of per-administration dose (PAD) and number of cycles.

	Area a	Days to Peak of Hazard b	Days from Peak of Hazard to End c	Duration (Days) b + c
PAD	Mean (Std Dev)	Mean (Std Dev)	Mean (Std Dev)	Mean (Std Dev)
8	0.0058 (0.0034)	14.5 (24.1)	8.7 (12.8)	23.2 (27.8)
16	0.0095 (0.0041)	14.9 (22.9)	14.4 (21.6)	29.4 (31.5)
24	0.0138 (0.0049)	11.7 (25.7)	20.3 (38.9)	32.0 (47.3)
32	0.0163 (0.0054)	15.9 (12.4)	31.3 (29.4)	47.3 (26.6)
40	0.0295 (0.0160)	14.0 (11.9)	32.0 (29.0)	46.0 (26.5)

Induction of DNA hypomethylation

As shown in figure 3, we were unable to detect any significant induction of global DNA hypomethylation.

Figure 3.

Mononuclear cell DNA global methylation before and after azacitidine administration. Abbreviations: C = cycle; D=day of the administration cycle.

Global hypomethylation induction was analyzed using the LINE bisulfite pyrosequencing assay. LINE methylation has measured on day 1 prior to therapy and on days 5 and 21 of therapy. As shown in panel A, when all patients and dose levels/schedules were analyzed, no evidence induction of LINE hypomethylation was observed. In B, the effect per dose level is shown: a non–significant hypomethylation trend was observed in patients treated at 8 mg/m².

Discussion

Relapse is a major cause of treatment failure after transplant.(22–26) Results of most therapies given to treat recurrence are very poor. In view of this observation, we proposed to evaluate post-transplant azacitidine as a strategy for remission consolidation/maintenance.

We demonstrated that it is possible to administer azacitidine early after allogeneic HSCT to the majority of a group of high-risk AML/MDS patients. Approximately 60% of our cohort of heavily pre-treated patients was able to receive at least one cycle of the drug. Our study was designed with only a maximum of four cycles due to logistics of a phase I trial, but there are no reasons to believe we could not prolong the duration of treatment, considering that longer exposure may be important with hypomethylating agents. We used an innovative trial design that allowed us to determine dose and schedule of administration, overcoming a major limitation of traditional phase I studies that do not address the issue of number of ‘cycles’ that can be delivered with a given dose.

A maintenance of remission study does not provide direct evidence of drug activity. However, direct substantiation of anti-leukemia effectiveness of low-dose azacitidine has been reported.(27) We have treated AML/MDS patients relapsing after allogeneic HSCT with doses ranging from 16–40 mg/m² for up to two years, and preliminary experience indicates 20% long-term disease control rate for patients with ‘indolent’ relapses, even without the need for immunosuppression withdrawal.(10)

Given the timing of drug administration we could not determine if there was any effect on acute GVHD. However, the probability of developing chronic GVHD may have been decreased with longer schedules of azacitidine administration. This possible effect is intriguing and deserves further investigation.

There was no change in global DNA methylation with therapy, which is in contrast to studies in patients receiving standard-dose azacitidine.(14) Others have been unable to document a relationship between hypomethylation induction and disease response, however,(28) and it is possible that the potential therapeutic effects observed here are not directly related to hypomethylation.

It has been shown by other authors that epigenetic changes may lead to decreased expression of cancer testis antigens in malignant cells.(29),(30),(31) It seems reasonable to hypothesize that DNA hypomethylating agents could magnify the graft-versus-leukemia effect of allogeneic HSCT by increasing the ‘immunogenicity’ of cancer cells through increased expression of tumor antigens. Azacitidine and decitabine may also induce increased FoxP3 expression and regulatory T lymphocyte generation, which could conceivably influence GVHD incidence. (32)

As expected, EFS was negatively influenced by disease burden, extent of prior treatment and comorbidities. Longer schedules of azacitidine administration were associated with prolongation of EFS and OS, even with a median number of two cycles per patient. It is unlikely that patient selection per se explains the results. Although we excluded patients from receiving azacitidine for reasons described here, the final study cohort consisted of patients with a median age of 60 years, mostly with relapsed disease, and that had received a median of two chemotherapy regimens prior to transplant, a poor prognosis variable in the setting of refractory AML/MDS.(33) (34)

Feasibility of maintenance therapy is likely higher than documented here. We arbitrarily limited eligibility to start azacitidine to the first 2.5 months after HSCT, a decision made due to logistic reasons only. If patients are allowed to start the treatment in a more flexible schedule during the first 40–100 days, a larger fraction will be eligible to receive it. These findings provide the basis for an ongoing randomized trial comparing azacitidine given for one year after HSCT versus no maintenance.

In conclusion, azacitidine 32 mg/m² daily for five days in each of four 30-day cycles is associated with acceptable toxicities when given after HSCT. Our trial also suggested that this treatment may prolong EFS and OS, and that more cycles may be associated with greater benefit.