Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Dec 1.
Published in final edited form as: Tuberculosis (Edinb). 2017 Sep 13;107:133–136. doi: 10.1016/j.tube.2017.09.003

Mechanisms of resistance against NITD-916, a direct inhibitor of Mycobacterium tuberculosis InhA

Matthew B McNeil 1, Devon Dennison 1, Catherine Shelton 1, Lindsay Flint 1, Aaron Korkegian 1, Tanya Parish 1
PMCID: PMC5679704  NIHMSID: NIHMS906782  PMID: 29050761

Summary

Isoniazid inhibits Mycobacterium tuberculosis InhA and is a key component of drug regimens that treat tuberculosis. However, the high rate of resistance against isoniazid is a contributing factor to the emergence of multi-drug resistance strains of M. tuberculosis. The 4-hydroxy-2-pyridine NITD-916 is a direct inhibitor of M. tuberculosis InhA that has comparable efficacy to isoniazid in mouse models of TB infection but a lower frequency of resistance. To characterize resistance mechanisms against NITD-916 we isolated resistant mutants in H37Rv (Euro-American lineage) and HN878 (East-Asian lineage) strains of M. tuberculosis. The resistance frequency was similar in both strains. Mutations were identified in residues within or near to the active of InhA or in the fabG1inhA promoter region. All mutants were resistant to NITD-916 but were not cross resistant to isoniazid, despite homology to SNPs identified in isoniazid resistant clinical isolates.

Keywords: Mycobacteria, Antimicrobial, Resistance, Isoniazid, InhA


Isoniazid (INH) is a key component in tuberculosis drug regimens against drug susceptible strains of Mycobacterium tuberculosis. INH inhibits the enoyl-ACP reductase, InhA, of M. tuberculosis following pro-drug activation by the catalase-peroxidase enzyme, KatG (1). However, a high rate of resistance to INH driven by mutations in the non-essential KatG is a contributing factor to the emergence and spread of drug resistant strains of M. tuberculosis. The proven druggability of InhA in the treatment of M. tuberculosis has prompted research into direct inhibitors of InhA that overcome such INH liabilities as the requirement for KatG activation and the high rate of resistance (2). Several direct InhA inhibitors have been identified, including the thiadiazoles (GSK693) (3), 2-(o-tolyloxy)-5-hexylphenol (PT70) (4), and the 4-hydroxy-2-pyridines (NITD-916 and NITD-113) (3–5). Unlike the INH-NAD adduct that competes with NADH binding to InhA, NITD-916 forms a ternary complex with InhA and NADH to block access to the fatty acyl substrate binding pocket (5). NITD-916 inhibition of InhA reduces the synthesis of mycolic acids and results in cell death (5). NITD-916 has a lower frequency of resistance in vitro than INH (1×10−8 compared to 1×10−5 for INH), is active against INH resistant clinical isolates with KatG mutations, and has efficacy in both acute and established mouse models of TB infection (5). Combined these results demonstrate that NITD-916 overcomes a key liability of INH and has promise as a novel TB therapeutic. Structural and biochemical studies have provided insights into the NITD-916 mode of action. However, there is limited information on the possible routes to resistance that might emerge in either an in vitro or clinical setting with only three single nucleotide polymorphisms (SNPs) being previously identified in M. tuberculosis (5). The aim for this current study was to expand upon our understanding of resistance mechanism(s) against NITD-916 M. tuberculosis.

We determined the minimum inhibitory concentration (MIC) of NITD-916 against M. tuberculosis H37Rv on Middlebrook 7H10 agar containing 10% v/v OADC supplement (oleic acid, albumin, dextrose, catalase; Becton Dickinson) (7H10-OADC); the concentration that prevented growth completely was 0.08 μM. We isolated resistant mutants by plating late log phase M. tuberculosis on 7H10-OADC containing 5X or 10X MIC of NITD-916 (0.4 μM and 0.8 μM respectively). Colonies were streaked onto 7H10-OADC containing 5X MIC NITD-916; 33 of 52 colonies were confirmed as resistant. The frequency of resistance was between 8.5 × 10−7 and 2.6 × 10−7. This rate of resistance is higher than previously reported, although still significantly lower than the frequency of resistance for INH (5; 6). The frequency of resistance to INH is high, since it is a prodrug, and mutations or deletions in the non-essential, activating enzyme KatG occur at a high frequency. We amplified and sequenced the fabG1-inhA genomic region using primers; TB-FabG1-MMF1 (TCAATACACCCGCAGCCA), InhA_F2(TTCATAGGTTCGGTCTCC) and InhA-R1 (GTGATACCCCACCGAAATGC). All isolates, except one, contained a mutation in inhA (Table 1); there were 19 different SNPs at 17 residues (Table 1). The remaining strain (LP-0532543 -RM30) had a C-T mutation upstream of the fabG1-inhA operon at position −15 to the translational start site (Table 1). This mutation is observed in approximately 19% of INH resistant clinical strains and leads to increased expression of InhA (7; 8), and would account for the resistance phenotype seen to NITD-916.

Table 1.

Genotypes and phenotypes of M. tuberculosis H37Rv mutants resistant to NITD-916

Strain InhA Number of isolates Solid medium MICA Liquid medium IC90 (fold shift vs WT)B
NITD-916 INH ETH TRI NITD-916 INH

H37Rv WT 0.08 μM 0.8 μM 6.3 μM 50 μM 0.1 μM 1 μM
LP-0532543-RM18 S19W 1 8x 4x - - 12x -
LP-0532543 RM28 I21M 1 8x 4x - - 4x -
LP-0532543-RM34 I21V 1 4x 4x - - 3x 2x
LP-0532543-RM13 F41L 1 8x - - - 13x -
LP-0532543-RM19 I47L 1 8x - - - 7x -
LP-0532543-RM1 S94A 2 8x 8x 8x - 10x 2x
LP-0532543-RM6 M103T 2 8x - - - 10x -
LP-0532543-RM2 D148E 1 8x - - - >10x -
LP-0532543-RM4 M161L 3 8x - - - >28x -
LP-0532543-RM41 R195G 1 8x 8x - - >10x 2x
LP-0532543-RM9 I202F 1 8x - - - 9x -
LP-0532543-RM7 G205A 2 8x - - - 12x -
LP-0532543-RM11 G205S 1 8x - - - 13x -
LP-0532543-RM3 A206E 4 8x - - - 19x -
LP-0532543-RM44 210 1 8x 8x - - ND ND
LP-0532543-RM14 G212D 1 8x - - - 24x -
LP-0532543-RM5 Q214P 1 8x 8x - - ND ND
LP-0532543-RM16 I215S 1 8x - - - 9x -
LP-0532543-RM37 L269R C-15T 6 8x 8x - - 11x -
LP-0532543-RM30 upstream of fabG1inhA 1 8x 4x 4x - 6x 5x
A

MIC for WT was determined on solid medium. For resistant isolates, strains were plated onto 4x and 8x MIC for each compound on solid medium and growth scored.

B

IC90 was determined in liquid medium. For resistant isolates, IC90, data are presented as the fold-change compared to WT.

- denotes no shift

ND - not determined

INH - isoniazid ETH –Ethionamide TRI - Triclosan

We determined the level of resistance for all strains on solid medium. Strains were arrayed into a 96-well plate and grown in Middlebrook 7H9 supplemented with 10% v/v OADC and 0.05% w/v Tween 80 (7H9-OADC-Tw) at 37°C for 7 days in duplicate. Cultures were diluted 1/100 in medium and 5 μL spotted onto rectangular agar plates containing 4X and 8X MIC. Plates were incubated for 3–4 weeks and spots were scored as growth or no growth. To confirm resistance, the IC90 was determined in liquid medium (7H9-OADC-Tw) as described (9). Bacterial growth was measured after 5 d at 37°C and the IC90 was defined as the concentration at which 90% of growth was inhibited. With the exception of I21V, strains were >4-fold resistant to NITD-916 in both solid and liquid media (Table 1).

Many of the SNPs we identified map to residues that are in the active site or in close proximity and several residues are known to interact with other direct inhibitors of InhA. M103 and I215 are active site residues, whilst I21 and F41 play a role in stabilizing NADH with which NITD-916 forms a ternary complex (10; 11). M103 and I215 interact with NITD-916 (5), whilst M161 and I202 form interactions with GSK625 and PT70 (3; 4). R195 is in close proximity to the active site residues G192 and G193, and Q214 is close to I215 (5). G205 and A206 are in close proximity to residues I202, V203 and L207 which interact with direct InhA inhibitors (12). The majority of the mutations we identified are novel, except S94, D148 and M161 which are known to provide resistance against NITD-916, and M103 which confers resistance to GSK693 (3; 5). These results highlight the overlapping binding sites of different InhA inhibitors. Our data indicate that mutations in the inhA coding region prevent the formation of the InhA-NADH-NITD916 ternary complex (either directly or indirectly through conformational changes), or confer resistance by increased expression of InhA.

Mutations in the InhA coding region, specifically in I21, I47 and S94, are seen in approximately 2% of INHR clinical isolates (7). Structural and biochemical studies suggest that I21V, I47T and S94A alter the active site of InhA and reduce affinity for the INH-NAD adduct (8; 13–15). Consistent with previous publications, the S94A mutations conferred resistance to INH on solid medium (Table 1) (8; 16). The S94A strain was also cross-resistant to ethionamide (Table 1). Mutations at S19, I21, R195, Q214 and L269 also conferred resistance to INH on solid medium (Table 1). Interestingly, none of the mutations conferred resistance against INH in liquid culture (Table 1). The lack of resistance for S94A against INH has previously been observed in liquid medium (5). The discordance in resistance phenotypes under different conditions requires further investigation. The one exception was the promoter mutant, which had a five-fold increase in IC90 (Table 1). The increased IC90 for the promoter mutant is consistent with the prevalence of this mutation in approximately 19% of INH resistant clinical isolates (7).

Over-expression of InhA mutant alleles can confer increased resistance to INH and NITD-916 as compared to over-expression of the wild-type allele (5). The C-15T promoter mutation results in a 20-fold increase in InhA (8). InhA coding region SNPs are often found together with inhA promoter mutations in clinical isolates (7; 17). The lack of resistance to INH for the isolated InhA SNPs in this current study questions the contribution of InhA mutations in isolation to INHR in clinical populations. We hypothesized that the InhA SNPs observed in clinical isolates are expressed at higher levels due to secondary C-15T fabG1inhA mutations (17). In order to investigate this further, we isolated resistant mutants in the strain carrying the promoter mutation. A total of 14 resistant mutants were isolated on 7H10-OADC containing 4.0 μM NITD-916 at a frequency of 6.2 × 10−8. All isolates contained a secondary mutation in inhA and demonstrated high level resistance to NITD-916 (36-fold increase relative to wild-type) (Table 2). Strains containing double mutations showed higher levels of resistance than the corresponding strains with a single mutation - for example, strains with mutations I47, M161 and G205 had increased MICs compared to the single inhA mutants (7-fold, >28-fold, and 12-fold respectively) (Table 2). This confirmed that overexpression of mutant allele resulted in increased resistance. In contrast, resistance to INH was not increased (Table 2), even in strains with mutant alleles previously shown to have reduced affinity for INH-NAD (13; 14).

Table 2.

Genotypes and phenotypes of M. tuberculosis H37Rv double mutants

Strain SNP Number of isolates IC90(fold-shift)A
fabG1inhA promoter InhA NITD-916 INH

H37Rv WT WT 0.032 μM 0.46 μM

LP-0532543-RM30 C-15T WT 6x 5x
LP-053254 -RM314 C-15T I47M 1 >36x 5x
LP-0532543-RM301 C-15T N159K 2 >36x 3x
LP-0532543-RM311 C-15T M161V 2 >36x 5x
LP-0532543-RM304 C-15T T162M 5 >36x 4x
LP-0532543-RM318 C-15T M199L 1 >36x 4x
LP-0532543-RM313 C-15T G205D 1 >36x 2x
LP-0532543-RM320 C-15T G208D 1 >36x 5x
A

IC90 was determined in liquid medium. For resistant isolates, data are presented as the fold-change compared to WT.

INH - isoniazid

Strains from the East Asian geographic lineage of M. tuberculosis, including the Beijing sub lineage, acquire resistance against rifampicin, isoniazid and ethambutol at a higher rate than strains from the Euro-American lineage (18). To determine if resistance mechanisms differed between geographic lineages, HN878 (Beijing lineage) resistant isolates were isolated using NITD-916; 19 confirmed resistant isolates were obtained on medium containing 5X and 10X MIC at a frequency of 9.1×10−7 and 2.1 × 10−7 respectively, similar to that seen in H37Rv. All isolates contained SNPs in inhA, with one SNP (R49H) not previously observed (Table 3). The C-T promoter mutation at position −15 was also observed in HN878 (Table 3). Consistent with results in H37Rv, all HN878 isolates had >4-fold resistance to NITD-916, but were not resistant to INH (Table 3).

Table 3.

Genotypes and phenotypes of M. tuberculosis HN878 mutants resistant to NITD-916

Strain SNP Number of isolates IC90 (fold shift)A
fabG1inhA promoter InhA NITD-916 INH

HN878 WT WT 0.14 μM 0.31 μM

HN-0532543-RM18 WT R49H 1 4x -
HN-0532543-RM10 WT M103T 1 >7x 2x
HN-0532543-RM7 WT M161L 1 >7x -
HN-0532543-RM2 WT T162M 10 >7x 2x
HN-0532543 -RM14 WT G205R 1 4x -
HN-0532543-RM9 WT G212D 1 >7x -
HN-0532543-RM17 C-15T WT 3 5x 8x
A

IC90 was determined in liquid medium. For resistant isolates, data are presented as the fold-change compared to WT.

- denotes no shift

INH - isoniazid

The reduced frequency of resistance to NITD-916 overcomes a major liability associated with the use of INH in current TB regimens. Although previous work has provided insights into the mechanism of inhibition, there was a limited understanding on the potential mechanisms of resistance against this promising class of compounds. This study demonstrates that mutations in a variety of residues within or neighboring the InhA active site are the primary route to resistance within different geographical lineages of M. tuberculosis. Mutations that increase the level of InhA expression also provided resistance against NITD-916. Although the increased expression of InhA provided cross-resistance to INH, there was a surprising lack of cross-resistance to INH for mutations in the InhA coding region. It is anticipated that the results from this current study will be useful in guiding the development of improved hydroxy-pyridines and other direct InhA inhibitors.

Acknowledgments

We thank Christopher Cooper and the TB Alliance for providing NITD-916. We thank Rhea N. Coler, Susan L. Baldwin and Dickon Alley for helpful discussions.

Funding

Research reported in this publication was supported in part by NIAID of the National Institutes of Health under award number R01AI09918, by the Bill and Melinda Gates Foundation, under grant OPP1024038 and by Anacor Pharmaceuticals. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Rawat R, Whitty A, Tonge PJ. The isoniazid-NAD adduct is a slow, tight-binding inhibitor of InhA, the Mycobacterium tuberculosis enoyl reductase: Adduct affinity and drug resistance. Proceedings of the National Academy of Sciences. 2003;100(24):13881–13886. doi: 10.1073/pnas.2235848100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Pan P, Tonge PJ. Targeting InhA, the FASII Enoyl-ACP Reductase: SAR Studies on Novel Inhibitor Scaffolds. Curr Top Med Chem. 2012;12(7):672–693. doi: 10.2174/156802612799984535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Martínez-Hoyos M, Perez-Herran E, Gulten G, Encinas L, Álvarez-Gómez D, Alvarez E, Ferrer-Bazaga S, García-Pérez A, Ortega F, Angulo-Barturen I, Rullas-Trincado J, Blanco D, Torres P, Castañeda P, Huss S, Fernández R, González S, Ballell L, Barros D, Modha S, Dhar N, Signorino-Gelo F, McKinney JD, García-Bustos JF, Luis J, Sacchettini JC, Jimenez MS, Martín-Casabona N, Castro-Pichel J, Mendoza-Losana A. Antitubercular drugs for an old target: GSK693 as a promising InhA direct inhibitor. EBiomedicine. 2016;8:291–301. doi: 10.1016/j.ebiom.2016.05.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Luckner SR, Liu N, Ende CW, Tonge PJ, Kisker C. A Slow, Tight Binding Inhibitor of InhA, the Enoyl-Acyl Carrier Protein Reductase from Mycobacterium tuberculosis. Journal of Biological Chemistry. 2010;285(19):14330–14337. doi: 10.1074/jbc.M109.090373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Manjunatha UH, Rao SPS, Kondreddi RR, Noble CG, Camacho LR, Tan BH, Ng SH, Ng PS, Ma NL, Lakshminarayana SB, Herve M, Barnes SW, Yu W, Kuhen K, Blasco F, Beer D, Walker JR, Tonge PJ, Glynne R, Smith PW, Diagana TT. Direct inhibitors of InhA are active against Mycobacterium tuberculosis. Science translational medicine. 2015;7(269):269ra263. doi: 10.1126/scitranslmed.3010597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bergval IL, Schuitema ARJ, Klatser PR, Anthony RM. Resistant mutants of Mycobacterium tuberculosis selected in vitro do not reflect the in vivo mechanism of isoniazid resistance. Journal of Antimicrobial Chemotherapy. 2009;64(3):515–523. doi: 10.1093/jac/dkp237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Seifert M, Catanzaro D, Catanzaro A, Rodwell TC. Genetic mutations associated with isoniazid resistance in Mycobacterium tuberculosis: A systematic review. PLoS ONE. 2015;10(3):e0119628–e0119628. doi: 10.1371/journal.pone.0119628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Vilchèze C, Wang F, Arai M, Hazbón MH, Colangeli R, Kremer L, Weisbrod TR, Alland D, Sacchettini JC, Jacobs WR. Transfer of a point mutation in Mycobacterium tuberculosis inhA resolves the target of isoniazid. Nature medicine. 2006;12(9):1027–1029. doi: 10.1038/nm1466. [DOI] [PubMed] [Google Scholar]
  • 9.Ollinger J, Bailey MA, Moraski GC, Casey A, Florio S, Alling T, Miller MJ, Parish T. A Dual Read-Out Assay to Evaluate the Potency of Compounds Active against Mycobacterium tuberculosis. PLoS ONE. 2013;8(4):e60531–e60531. doi: 10.1371/journal.pone.0060531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Rozwarski DA, Grant GA, Barton DHR, Jr, WRJ, Sacchettini JC. Modification of the NADH of the Isoniazid Target (InhA) from Mycobacterium tuberculosis. Science. 1993;279:98–101. doi: 10.1126/science.279.5347.98. [DOI] [PubMed] [Google Scholar]
  • 11.Dias MVB, Vasconcelos IB, Prado AMX, Fadel V, Basso LA, Jr, WFdA, Santos DS. Crystallographic studies on the binding of isonicotinyl-NAD adduct to wild-type and isoniazid resistant 2-trans-enoyl-ACP (CoA) reductase from Mycobacterium tuberculosis. Journal of structural biology. 2007;159:369–380. doi: 10.1016/j.jsb.2007.04.009. [DOI] [PubMed] [Google Scholar]
  • 12.Li H-j, Lai C-t, Pan P, Yu W, Liu N, Bommineni GR, Garcia-diaz M, Simmerling C, Tonge PJ. A Structural and Energetic Model for the Slow-Onset Inhibition of the Mycobacterium tuberculosis Enoyl-ACP Reductase InhA. ACS Chemical Biology. 2014;9:989–993. doi: 10.1021/cb400896g. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Oliveira JS, Pereira JH, Canduri F, Rodrigues NC, de Souza ON, de Azevedo WF, Basso LA, Santos DS. Crystallographic and Pre-steady-state Kinetics Studies on Binding of NADH to Wild-type and Isoniazid-resistant Enoyl-ACP(CoA) Reductase Enzymes from Mycobacterium tuberculosis. Journal of Molecular Biology. 2006;359(3):646–666. doi: 10.1016/j.jmb.2006.03.055. [DOI] [PubMed] [Google Scholar]
  • 14.Quemard A, Sacchettini JC, Dessen A, Vilcheze C, Bittman R, Jacobs WR, Blanchard JS. Enzymatic Characterization of the Target for Isoniazid in Mycobacterium tuberculosis. Biochemistry. 1995;34(26):8235–8241. doi: 10.1021/bi00026a004. [DOI] [PubMed] [Google Scholar]
  • 15.Parikh SL, Xiao G, Tonge PJ. Inhibition of InhA, the enoyl reductase from Mycobacterium tuberculosis, by triclosan and isoniazid. Biochemistry. 2000;39(26):7645–7650. doi: 10.1021/bi0008940. [DOI] [PubMed] [Google Scholar]
  • 16.Banerjee A, Dubnau E, Quemard A, Balasubramanian V, Um KS, Wilson T, Collins D, Lisle GD, WRJ inhA, a Gene Encoding a Target for Isoniazid and Ethionamide in Mycobacterium tuberculosis. Science. 1994;263(5144):227–230. doi: 10.1126/science.8284673. [DOI] [PubMed] [Google Scholar]
  • 17.Machado D, Ramos J, Couto I, Ritter C, Boettger EC, Viveiros M. High-level resistance to isoniazid and ethionamide in multidrug-resistant Mycobacterium tuberculosis of the Lisboa family is associated with inhA double mutations. Journal of Antimicrobial Chemotherapy. 2013;68(8):1728–1732. doi: 10.1093/jac/dkt090. [DOI] [PubMed] [Google Scholar]
  • 18.Ford CB, Shah RR, Maeda MK, Gagneux S, Murray MB, Cohen T, Johnston JC, Gardy J, Lipsitch M, Fortune SM. Mycobacterium tuberculosis mutation rate estimates from different lineages predict substantial differences in the emergence of drug-resistant tuberculosis. Nature Genetics. 2013;45(7):784–790. doi: 10.1038/ng.2656. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES