Abstract
A fascinating characteristic of most members of the genus Flavobacterium is their ability to move over surfaces by gliding motility. Flavobacterium psychrophilum, an important pathogen of farmed salmonids worldwide, contains in its genome the 19 gld and spr genes shown to be required for gliding or spreading in Flavobacterium johnsoniae; however, their relative role in its lifestyle remains unknown. In order to address this issue, two spreading deficient mutants were produced as part of a Tn4351 mutant library in F. psychrophilum strain THCO2-90. The transposons were inserted in gldD and gldG genes. While the wild-type strain is proficient in adhesion, biofilm formation and displays strong proteolytic activity, both mutants lost these characteristics. Extracellular proteome comparisons revealed important modifications for both mutants, with a significant reduction of the amounts of proteins likely transported through the outer membrane by the Type IX secretion system, indicating that GldD and GldG proteins are required for an effective activity of this system. In addition, a significant decrease in virulence was observed using rainbow trout bath and injection infection models. Our results reveal additional roles of gldD and gldG genes that are likely of importance for the F. psychrophilum lifestyle, including virulence.
Keywords: Flavobacterium psychrophilum, fish-pathogenic bacteria, gliding motility, secretion, T9SS, virulence, Oncorhynchus mykiss
Introduction
Many members of the phylum Bacteroidetes show gliding motility, the movement of cells over surfaces without the aid of pili or flagella. This phenomenon has been studied in detail mainly in Flavobacterium johnsoniae (McBride and Nakane, 2015), and more recently in the marine bacterium Cellulophaga algicola (Zhu and McBride, 2016). The components involved in the gliding process have been identified by screening for gliding defects using transposition mutant libraries in F. johnsoniae. Twelve gld genes (gldA, gldB, gldD, gldF, gldG, gldH, gldI, gldJ, gldK, gldL, gldM, gldN) are required for gliding, seven spr genes (sprA, sprB, sprC, sprD, sprE, sprF, and sprT) are involved in colony spreading but dispensable for cell individual movement, and several rem genes encode proteins with redundant motility functions (Hunnicutt et al., 2002; Braun and McBride, 2005; Braun et al., 2005; Liu et al., 2007; Nelson et al., 2007, 2008; Rhodes et al., 2011a,b; Shrivastava et al., 2012). Strikingly, some of these genes (i.e., gldK, gldL, gldM, gldN, sprA, sprE, and sprT) are orthologs of porK, porL, porM, porN, sov, porW, and porT genes, respectively, encoding the core secretion machinery of the newly described Type IX secretion system (T9SS) identified in the non-gliding periodontal pathogen Porphyromonas gingivalis (Sato et al., 2010, 2013). Additional components of T9SS have been also identified such as PorP, the PorU signal peptidase (Glew et al., 2012), PorV (Kharade and McBride, 2015), the PG1058 lipoprotein (Heath et al., 2016), and the PorZ surface component (Lasica et al., 2016), for which the exact roles in protein secretion remain unknown. Most of the T9SS proteins showed homologs only in Bacteroidetes genomes such as those of Flavobacterium, Capnocytophaga, Cellulophaga, Cytophaga, and Tannerella species, suggesting that this transport system is apparently restricted to this phylum (McBride and Zhu, 2013). It has been demonstrated that the T9SS is required for the secretion, cell surface exposition, attachment, or the external release of proteins with various functions in diverse Bacteroidetes species (Sato et al., 2010; Shrivastava et al., 2013; Narita et al., 2014; Tomek et al., 2014; Zhu and McBride, 2014; Kita et al., 2016). Moreover, most of these proteins secreted by the T9SS possess conserved C-terminal domains (CTDs) required for their translocation across the outer membrane. These 70–100 amino acids long CTDs mainly belong to the TIGR04183 or TIGR04131 protein domain families (McBride and Nakane, 2015; Kulkarni et al., 2017). However, other T9SS-mediated proteins have been identified, such as the F. johnsoniae chitinase ChiA, that display different CTDs in their sequence (Kharade and McBride, 2014). Importantly, motility and secretion systems appear to be intertwined since it has been shown that the T9SS is essential for the secretion of several surface-exposed motility adhesins in F. johnsoniae (Rhodes et al., 2011b; Shrivastava et al., 2013) and Capnocytophaga ochracea (Kita et al., 2016). Indeed, some F. johnsoniae adhesins are important for gliding. They are rapidly propelled along the cell surface by the rest of the motility machinery (Nakane et al., 2013; Shrivastava et al., 2015). This process appears to be driven by a proton-motive force-dependent trans-envelope motor (Nakane et al., 2013; McBride and Nakane, 2015; Shrivastava and Berg, 2015; Shrivastava et al., 2015).
Flavobacterium psychrophilum is an important fish pathogen. This bacterium is the etiologic agent of rainbow trout fry syndrome (RTFS) and bacterial cold-water disease (BCWD), two conditions of utmost significance for freshwater-reared salmonids. Outbreaks occur at temperatures below 14°C and cause important economic losses for salmonid fish farms worldwide (Nematollahi et al., 2003a; Starliper, 2011). Despite extensive research, no commercial vaccine against the infections provoked by F. psychrophilum is available, except in Chile, resulting in the administration of antibiotics to treat outbreaks (Gómez et al., 2014). Furthermore, the mechanisms of pathogenicity of this microorganism are still poorly understood (Álvarez et al., 2006, 2008; Pérez-Pascual et al., 2011, 2015; Nakayama et al., 2015). Several improvements have been reported during the last decades in bacterial physiology (Álvarez et al., 2004; Pérez-Pascual et al., 2009), molecular diagnosis (Cepeda and Santos, 2000; del Cerro et al., 2002; Fujiwara-Nagata and Eguchi, 2009; Strepparava et al., 2014), molecular epidemiology (Nicolas et al., 2008; Siekoula-Nguedia et al., 2012; Fujiwara-Nagata et al., 2013; Avendaño-Herrera et al., 2014; Nilsen et al., 2014; Van Vliet et al., 2016; Ngo et al., 2017), genome analysis (Duchaud et al., 2007; Wiens et al., 2014; Wu et al., 2015; Rochat et al., 2017a,b), and development of genetic tools (Álvarez et al., 2006; Pérez-Pascual et al., 2011; Gómez et al., 2012, 2015), opening the way for functional genomics studies.
Gliding motility has not been previously studied in detail in F. psychrophilum. Analyses of F. psychrophilum genomes revealed that all the above-mentioned gliding genes as well as T9SS-encoding genes studied in F. johnsoniae or P. gingivalis so far are well-conserved (Duchaud et al., 2007; Rochat et al., 2017a). With the aim of achieving a deeper insight into these two intertwined biological processes, as well as their relevance into the pathogenesis of F. psychrophilum, a set of mutants deficient in spreading were isolated using Tn4351-mutagenesis in strain THCO2-90. Using in vitro and in vivo phenotyping as well as proteomics, we performed an exhaustive analysis of two of these mutants and identified important defects in extracellular proteolytic activities, adhesion, biofilm formation, and exoproteome composition. Importantly, these mutations provoked a high attenuation of the virulence of F. psychrophilum in rainbow trout (Oncorhynchus mykiss), a natural-host infection model.
Materials and methods
Bacterial strains and growth conditions
The strains, plasmid and primers used in this study are listed in Table 1. Escherichia coli strains S17-1, BW19851 (Metcalf et al., 1994) or MFDpir (Rochat et al., 2017b) were used to transfer DNA into F. psychrophilum THCO2-90 by conjugation. E. coli strains were grown at 37°C in Luria Bertani (LB) with 15 g of agar per liter added for solid medium. F. psychrophilum THCO2-90 was grown at 18°C in tryptone yeast extract salts (TYES) broth [0.4% (w/v) tryptone, 0.04% yeast extract, 0.05% (w/v) MgSO4 7H2O, 0.02% (w/v) CaCl2 2H2O, 0.05% (w/v) D-glucose, pH 7.2] or in modified Bushnell-Haas broth (BH; Sigma-Aldrich Co.) supplemented with a vitamin cocktail at pH 7 (5 mg L−1 pyridoxamine, 1 mg L−1 nicotinic acid, 1 mg L−1 thiamine, 1 mg L−1 riboflavine, 1 mg L−1 D,L-panthotenic acid, 10 mg L−1 4-aminobenzoic acid, 1 mg L−1 D-biotine, 1 mg L−1 folic acid, 1 mg L−1 vitamin B12, 5 mg L−1 orotic acid anhydrous, 5 mg L−1 thymidine, 5 mg L−1 inosine and 2.5 mg L−1 thioctic acid), 100 μM FeCl3, 50 μM CaCl2 and 0.5% (w/v) casein or gelatin when needed. Growth in liquid culture was carried out at 200 rpm and 18°C and evaluated by measuring OD600 nm at different times. Stock cultures were preserved in TYES broth containing 20% (v/v) glycerol at −80°C. To observe colony spreading, F. psychrophilum strains were grown on 1/5 TYES with 15 g L−1 of agar (Pérez-Pascual et al., 2009). Extracellular proteolytic activity on solid medium was visualized by using TYES containing 15 g L−1 of agar and supplemented with 0.75% (w/v) gelatin or casein (Álvarez et al., 2006). For selective growth of E. coli strains carrying pEP4351 and pCP-derivative plasmids, transformants were selected with 20 μg mL−1 chloramphenicol and 100 μg mL−1 ampicillin, respectively. Cultures of E. coli MFDpir were supplemented with 0.3 mM diaminopimelic acid (Sigma-Aldrich Co.). Selection of F. psychrophilum transconjugants was carried out with 10 μg mL−1 of gentamycin or erythromycin.
Table 1.
Bacterial strains, plasmids, and primers used in this study.
| Plasmid, strain, primer | Description/Sequence (5′ -> 3′) | Source or References |
|---|---|---|
| PLASMIDS | ||
| pEP4351 | Ori R6K dependent protein pir,; RP4 oriT; Cmr Tcr (Emr); Tn4351 vector transfer | Cooper et al., 1997 |
| pCP23 | E. coli–F. psychrophilum shuttle plasmid; ColE1 ori (pCP1 ori), Apr (Tcr) | Agarwal et al., 1997 |
| pCPGmR | pCP23-derivative carrying aac(6′)-aph(2′) gentamycin resistance gene; Apr (Gmr) | This study |
| pCPGmR-gldD | pCPGmR-derivative carrying Porf1-gldD; Apr (Gmr) | This study |
| pCPGmR-gldG | pCPGmR-derivative carrying Porf1-gldG; Apr (Gmr) | This study |
| F. psychrophilum STRAINS | ||
| OSU THCO2-90 | F. psychrophilum isolated from Coho salmon | Bertolini et al., 1994 |
| TRV107 | THCO2/90 gldD::Tn4351; (Emr) | This study |
| TRV103 | THCO2/90 gldG::Tn4351; (Emr) | This study |
| TRV272 | THCO2/90 pCPGmR (Gmr) | This study |
| TRV323 | THCO2/90 gldD::Tn4351 pCPGmR (Emr; Gmr) | This study |
| TRV339 | THCO2/90 gldG::Tn4351 pCPGmR (Emr; Gmr) | This study |
| TRV329 | THCO2/90 gldD::Tn4351 pCPGmR-gldD (Emr; Gmr) | This study |
| TRV338 | THCO2/90 gldG::Tn4351 pCPGmR-gldG (Emr; Gmr) | This study |
| E. coli STRAINS | ||
| S17-1 | recA pro hsdR RP4-2(Tcr::Mu-Kmr::Tn7 Strr) | Simon et al., 1983 |
| MFDpir | MG1655 RP4-2-Tc::[ΔMu1::aac(3)IV-ΔaphA-Δnic35-ΔMu2::zeo] ΔdapA::(erm-pir) ΔrecA | Rochat et al., 2017b |
| BW19851 | RP4-2(tet::Mu-1kan::Tn7 integrant) uidA::pir recA1 hsdR17 creB510 endA1 zbf-5 thi | (Metcalf et al., 1994) |
| PRIMERS | ||
| TN-1 | GGACCTACCTCATAGACAA | |
| IS4351-F | TCAGAGTGAGAGAAAGGG | |
| TRO300 | TTGGATTAAGCAATAATATACTACAATAGATGC | |
| TRO301 | TAATGGAGCGGTCAGGAAAT | |
| TRO302 | GCATCTATTGTAGTATATTATTGCTTAATCCAAATGAATATAGTTGAAAATGAAAT | |
| TRO303 | ATTTCCTGACCGCTCCATTAATCTTTATAAGTCCTTTTATAAATT | |
| TRO308 | GTTCTCATATGCTACGAGGAGG | |
| TRO319 | GTACTGAGAGTGCACCATACGTC | |
| TRO370 | TTTGAGGGATAATAAAAAGGATAATTATGTTTAATAAATATATTACTTCTCTTTT | |
| TRO371 | CGGTCCGGAATTCCCTATAACAGATAACGGACAAAAACTTC | |
| TRO372 | TTTGAGGGATAATAAAAAGGATAATTATGATACCAATTAAGAAAAAGAAAATC | |
| TRO373 | CGGTCCGGAATTCCCTATAATCGTAAACTAATCAGTATTGAAAACAT | |
| TRO350 | AATTATCCTTTTTATTATCCCTCAAA | |
| TRO351 | TTATAGGGAATTCCGGACCG | |
| TRO137 | GAGGGAACGACGCAAAGCGATAGTTC | |
| TRO138 | GGAAACAGCTATGACCATGATTACGCC | |
Underlined sequences correspond to regions which hybridize with targeted genes [i.e., aac(6′)-aph(2′) gentamycin resistance marker, gldD, and gldG genes].
DNA technology
Genomic DNA extraction was performed with the Gen Elute Bacterial DNA (Sigma-Aldrich Co.) extraction kit. Plasmid DNA was purified with the NucleoSpin® Plasmid (Machery-Nagel) kit. PCR amplification products were separated on 1% agarose gels and bands were purified with the IllustraTM GFX, PCR DNA and the Gel Band Purification Kit gel extraction system.
Tn4351 mutant library construction
E. coli BW19851 was used for conjugative transfer of pEP4351 plasmid carrying Tn4351 into F. psychrophilum strain THCO2-90 as previously described (Álvarez et al., 2004). Briefly, the donor E. coli strain was grown to mid-log phase in LB broth and 10 mL were centrifuged to harvest cells. Cells were washed twice with TYES broth, and suspended in 50 μL of TYES broth. The recipient F. psychrophilum strain was grown to mid-log phase in TYES broth, 10 mL of culture was centrifuged, and the cell pellet was washed twice with TM buffer, consisting of 20 mM Tris-HCl and 20 mM MgSO4 pH 7.2, and suspended in 50 μL of TM buffer. Cell suspensions of F. psychrophilum and E. coli were mixed together, spotted onto TYES agar, and incubated at 20°C for 48 h. After conjugation, cells were scraped off the plates, diluted in 1 mL of TYES broth, and plated on TYES agar containing 10 μg mL−1 erythromycin. Erythromycin-resistant colonies of F. psychrophilum appeared on TYES agar after 5–7 days of incubation at 18°C.
Identification of Tn4351 interrupted locus and sequencing of the surrounding DNA region
The insertion of Tn4351 into the genome of 439 transconjugants was firmly established using inverse-PCR as previously described (Álvarez et al., 2006). Briefly, genomic DNA of the mutant strains was digested with HindIII followed by a re-ligation process. The resulting circular molecules were used as a template to amplify by inverse PCR the sequences adjacent to the Tn4351 insertion site using a specific pair of primers TN-1/IS4351-F (Table 1) and the GoTaq DNA polymerase (Promega, France). Sanger sequencing of the PCR amplified products was performed on an ABI PRISM 3100 (Applied Biosystems, CA, USA) and sequences were used to locate the transposon insertion site on the THCO2-90 genome (Rochat et al., 2017a).
Construction of pCPGmR shuttle vector, a pCP23-derivative vector carrying a gentamycin resistance marker
The coding sequence of tetQ was replaced by aac(6′)-aph(2′) gene encoding a gentamycin resistance marker, while keeping expression signals unchanged (plasmid map in Figure S1). pCPGmR was constructed as follows: the two DNA fragments were amplified by PCR using Phusion High-Fidelity DNA polymerase (Thermo Fisher), the vector fragment using pCP23 DNA as matrix and primers TRO300/TRO301, aac(6′)-aph(2′) using pZXL5 DNA (Zhang et al., 2012) and primers TRO302/TRO303. The resulting PCR products were assembled by the method developed by Gibson (Gibson et al., 2009) using the Gibson Assembly Master Mix (New England Biolabs). Engineered plasmids were constructed in E. coli S17-1. Correct replacement of tetQ by aac(6′)-aph(2′) was verified by PCR and DNA sequencing with primers TRO308 and TRO319. pCPGmR was then transferred by electrotransformation to E. coli MFDpir, the donor strain used subsequently to introduce plasmids into F. psychrophilum by conjugation. Transconjugants were selected on TYES agar supplemented with 10 μg mL−1 gentamycin and appeared between 3 and 5 days of incubation at 18°C. The presence of plasmid was checked by plasmid DNA extraction.
Complementation of gldD and gldG mutants
Two pCPGmR derivative plasmids containing the coding sequence of gldD and gldG were constructed using Gibson's method (plasmid map available in Figure S2). Briefly, DNA sequences of interest were amplified from THCO2-90 genomic DNA by PCR using primers TRO370/TRO371 and TRO372/TRO373 for gldD and gldG, respectively. The vector was amplified by PCR using primers TRO350/TRO351 and pCPGmR as DNA matrix. The DNA assembly results in the insertion of gld gene upstream of the expression signals of ORF1 of pCP1, a cryptic plasmid isolated from a F. psychrophilum isolate (McBride and Kempf, 1996). Resulting plasmids pCPGmR–gldD and pCPGmR–gldG were checked by PCR and DNA sequencing with primers TRO137 and TRO138. Plasmids were transferred into relevant F. psychrophilum strains by conjugation with E. coli MFDpir.
Adhesion and biofilm assays
Adhesion ability of each strain to 96-well microtiter polystyrene plates with flat bottom (NunclonTM Delta surface, Nunc) was evaluated as previously described (Högfors-Rönnholm et al., 2015) with few modifications. Briefly, the wild-type strain THCO2-90 and the two mutant strains were grown in TYES broth to OD600nm = 0.5. One milliliter of each bacterial culture was centrifuged at 11,093 g for 5 min, the supernatant was removed and cells pellet was resuspended in sterile distilled water. One hundred of microliters of each bacterial suspensions were added in quadruplicate to the microplate and incubated at 18°C for 3 h without shaking. Then, wells were washed twice with sterile distilled water. The adherent cells were stained with 100 μL 1% (w/v) crystal violet solution for 30 min at room temperature. Excess stain was removed by washing the wells four times with sterile distilled water, and stain bound to the adherent cells was released with 100 μL absolute ethanol for crystal violet solubilization. The adhesion ability of the bacterial cells was determined by measuring the OD595nm using a Tecan Microplate Reader (Infinite 200 PRO). As a negative control non-inoculated sterile milliQ water was used. Percentages of binding refer to the level of adhesion observed for each strain, compared with adhesion of the wild-type strain which higher OD595nm value was set to 100%. All assays were performed in quadruplicate and repeated at least two times for reproducibility.
Biofilm formation was evaluated using the standard assay with crystal violet staining as previously described for F. psychrophilum (Álvarez et al., 2006; Levipan and Avendaño-Herrera, 2017) with some modifications. The wild-type strain THCO2-90 and the two mutant strains were grown in half-strength TYES broth to the mid-exponential phase. The cultures were diluted 1:100 in half-strength TYES broth, and 150 μL were deposited in wells of 96-well microtiter polystyrene plates with flat bottom (NunclonTM Delta surface, Nunc). Wells containing non-inoculated medium were used as negative controls. The plate was incubated at 18°C under static condition for 120 h. Every 24 h, biofilm development was evaluated in four wells by strain. The supernatants were discarded, the wells were washed twice with 200 μL of sterile distilled water then 150 μL of 1% (w/v) crystal violet was added to each well. After 30 min, excess stain was removed by washing the wells four times with 200 μL of sterile distilled water and the stain bound to adherent cells was subsequently released by adding 100 μL of absolute ethanol. The biofilm formation was determined by measuring the OD595 nm using a Tecan Microplate Reader and quantified as the specific biofilm formation (SBF) index proposed by (Niu and Gilbert, 2004): SBF = (B − NC)/G, where B is the amount of ethanol-solubilized crystal violet released from biofilm cells, NC is the amount of ethanol-solubilized crystal violet adherent to wells of negative controls, and G is the absorbance of the cell supernatant.
Extracellular protein analysis by LC-MS/MS
Cultures of F. psychrophilum strains THCO2-90, gldD::Tn and gldG::Tn were grown in 50 mL of TYES broth at 200 rpm and 18°C until reaching late exponential phase (OD600 = 0.8). For secretome analysis, the supernatants were recovered by centrifugation at 6,000 g for 10 min at 4°C and concentrated by ultrafiltration using Amicon Ultra-centrifugal filters (Millipore, MW cut off 10 kDa) at 4,000 g for 30 min at 4°C. Then, 10 μg of each protein suspension was separated using one-dimensional short migration in SDS-PAGE. In-gel digestion of the proteins was performed on bands excised from one-dimensional SDS-PAGE. Each lane of short migration was cut and washed for 15 min with an acetonitrile/100 mM ammonium bicarbonate mixture (1:1). Digestion was performed in 50 mM ammonium bicarbonate pH 8.0 and the quantity of modified trypsin (Promega, sequencing grade) was 0.1 μg per sample. Digestion was carried out for 6 h at 37°C. The supernatant was reserved. Peptides were extracted by 5% formic acid in water/acetonitrile (v/v). Supernatant and extracted tryptic peptides were dried and resuspended in 50 μL of 0.1% (v/v) formic acid and 2% (v/v) acetonitrile. For shaving, cells pellets obtained from the culture centrifugation were washed twice in PBS and resuspended in 0.8 mL of PBS containing 1.2 mM sucrose and 1 mM CaCl2 pH 7.4. Samples were digested in-solution for 10 min at 37°C by adding 2 μg mL−1 of sequencing-grade modified trypsin. Enzymatic reaction was quenched by reducing the pH of peptide mixtures with 0.1% formic acid. Samples were filtered with Millex GV (0.25 μm, Millipore, ref SLCG004SL) and the resulting peptide mixtures were pre-cleaned with a Strata-X column (Phenomenex, ref. 8B-S100-TAK). Columns were washed with 1.5 mL of washing buffer [3% acetonitrile (ACN) and 0.1% trifluoroacetic acid (TFA)]. The peptide mixtures were charged into the columns, followed by three washing steps of 500 μL. Elution of peptides was achieved using 600 μL of elution buffer (40% ACN and 0.1% TFA). The resulting samples were concentrated under vacuum to dryness and resuspended in 50 μL of 0.1% TFA and 2% ACN. Before analysis in a high-resolution mass spectrometer, samples were diluted 1/100.
LC-MS/MS analysis was performed using an Ultimate 3000 RSLC system (Dionex, Voisins-le-Bretonneux, France) connected to a LTQ Orbitrap mass spectrometer (Thermo Fisher) by a nanoelectrospray ion source. Samples were resuspended in 50 μL of nano HPLC buffer (2% ACN/ 0.1% formic acid) and a dilution 1/100 was achieved for shaving experiments.
Liquid chromatography—mass spectrometry
Mass spectrometry was performed using an Orbitrap Fusion™ Lumos™ Tribrid™ (Thermo Fisher Scientific) coupled to an UltiMate™ 3000 RSLCnano System (Thermo Fisher Scientific). Four microliters of each sample were loaded at 20 μL min−1 on a precolumn (μ-Precolumn, 300 μm i.d × 5 mm, C18 PepMap100, 5 μm, 100 Å, Thermo Fisher) and washed with loading buffer. After 3 min, the precolumn cartridge was connected to the separating column (Acclaim PepMap®, 75 μm × 500 mm, C18, 3 μm, 100 Å, Thermo Fisher). Buffer A consisted of 0.1% formic acid in 2% acetonitrile and buffer B of 0.1% formic acid in 80% acetonitrile.
The peptide separation analysis was achieved at 300 nl min−1 with a linear gradient from 1 to 35% buffer B for 50 min and 35 to 45% for 5 min. One run took 65 min, including the regeneration step at 98% buffer B. Ionization (1.6 kV ionization potential) and capillary transfer (275°C) were performed with a liquid junction and a capillary probe (SilicaTip™ Emitter, 10 μm, New Objective). Peptide ions were analyzed using Xcalibur 3.1.66.10. The machine settings were as follows: 1) full MS scan in Orbitrap (scan range [m/z] = 400–1,500) and 2) MS/MS using CID (35% collision energy) in Orbitrap (AGC target = 4.0 × 102, max. injection time = 50 ms, data type = profile). Analyzed charge states were set to 2–5, the dynamic exclusion to 60 s and the intensity threshold was fixed at 5.103.
Processing and bioinformatics analyses
The genome of F. psychrophilum THCO2-90 (Rochat et al., 2017a) was searched by the X!TandemPipeline (open source software developed by PAPPSO, version 3.4.3, http://pappso.inra.fr/bioinfo/xtandempipeline/). Protein identification was run with a precursor mass tolerance of 10 ppm and a fragment mass tolerance of 0.5 Da. Enzymatic cleavage rules were set to trypsin digestion (“after Arg and Lys, unless Pro follows directly after”) and no semi-enzymatic cleavage rules were allowed. The fix modification was set to cysteine carboxyamidomethylation and methionine oxidation was considered as a potential modification. In a second pass, N-terminal acetylation was added as another potential modification, whereas all other previous settings were retained. The identified proteins were filtered as follows: 1) peptide E < 0.01 with a minimum of 2 peptides per protein and 2) a protein E < 10−4.
Statistical analysis of LC-MS/MS data
Peptide quantities of the proteome were analyzed by spectral counting (SC). SC takes into account the number of assigned spectra for each protein and is correlated to relative protein abundance. The P-values obtained from both ANOVA for the SC were considered significant below a value of 0.01.
Fish infection challenges
The rainbow trout (O. mykiss) homozygous line A36 was used (Quillet et al., 2007). The uniformity of genetic background in isogenic lines and the high susceptibility of line A36 to F. psychrophilum infection makes this line highly relevant to test for changes in bacterial virulence. Fish were reared at 10°C in dechlorinated recirculated water until they reached 3–4 g, and were then transferred to continuous flow aquaria for infection experiments. Bacteria used for infections were prepared as follows: strains THCO2-90, gldD::Tn and gldG::Tn were grown in TYES broth at 200 rpm and 18°C until late-exponential phase (DO600 nm = 1). This culture density corresponds to 109 colony-forming units (CFU) mL−1, determined by serial dilutions and plate counting on TYES agar. Two experimental infection models differing by the infection route were tested: intramuscular injection and immersion. Two independent experiments were performed for each experimental infection model.
For injection challenge, 50 μL of serial dilutions performed in TYES broth by diluting bacterial cultures to obtain 106, 107, and 108 CFU mL−1 were used. These doses correspond to theoretical 0.1, 1, and 10 LD50 previously determined for the wild-type strain. Groups of 10 fish were challenged with each dose by intramuscular injection after anesthesia. As a negative control, a group of 10 fish were injected with 50 μL of sterile TYES broth.
For immersion challenge, bacterial cultures performed in TYES broth were diluted directly into the water of aquaria (15 L) at a final concentration of 5 × 106 CFU mL−1. Bacteria were maintained in contact with fish for 24 h by stopping the water flow then subsequently removed by restoring the water flow. Sterile TYES broth was used for the control group. Bacterial counts were determined at the beginning and at the end of the immersion challenge by plating serial dilutions of water samples on TYES agar. Water was maintained at 10°C and under continuous oxygenation for the duration of the immersion. Groups were composed of 46 fish. Virulence was evaluated according to fish mortality 14 days post-infection. Six fish of each group were randomly chosen and sacrificed 6 h after the end of immersion challenge to evaluate the bacterial load from spleen, gill, and skin mucus. Organs were mechanically disrupted in Lysing Matrix tubes containing 500 μL of 1% peptone water and 1 mm ceramic beads (Mineralex). Samples were homogenized at 6.0 m s−1 for 45 s on a FastPrep-24 instrument (Thermo Fisher). Serial dilutions of the homogenized solution were plated on TYES agar.
Ethics statements
Animal experiments were performed in accordance with the European Directive 2010/2063/UE and approved by the institutional review ethics committee, COMETHEA, of the INRA Center in Jouy-en-Josas, France. Authorizations were approved by the Direction of the Veterinary Services of Versailles (authorization number 15-58).
Results
Isolation of Tn4351 gldD and gldG mutants
To develop a functional genomic approach aiming to understand the role and the relative importance of genes of F. psychrophilum, a Tn4351-mutant library was constructed in strain THCO2-90 according to the previously developed strategy (Álvarez et al., 2004). About 2,000 erythromycin-resistant transconjugants were obtained. The specific localization of Tn4351 was performed by inverse PCR (Álvarez et al., 2006) on a subset of this library, formally identifying the insertion site for 439 transconjugants. Among them, two strains carrying a transposon insertion into gld homologous genes were selected for further characterization (Figure 1). In the first one, hereafter named gldD::Tn, the Tn4351 transposon is located after position 1,222,107 of the THCO2-90 chromosome and interrupts the THC0290_1046 gene, disrupting the protein after amino acid residue 36 (out of a total of 187). THC0290_1046 encodes the gliding motility lipoprotein precursor GldD (protein_id = SHH90844.1). In the other mutant, hereafter named gldG::Tn, the Tn4351 transposon is located after position 2,148,164 and disrupts the THC0290_1849 gene that encodes the gliding motility transmembrane protein GldG (protein_id = “SHI04365.1”), leading to a truncated protein after residue 307 (out of a total of 559). GldG likely forms along with GldA and GldF an ATP-dependent ABC transporter, found to be required for gliding in F. johnsoniae (Hunnicutt and McBride, 2001). In silico analysis of their genetic context suggests that gldD could be transcribed from the promoters of mutY and ssb genes (Figure 1). gldG lies downstream of gldF, a genetic organization highly conserved among genomes of the class Flavobacteriia carrying gldG and gldF homologous genes (Figure S3; McBride and Zhu, 2013) and upstream of dnaN, an essential gene likely transcribed from its own promoter (Figure 1).
Figure 1.
Map of the genetic context of gldD::Tn and gldG::Tn mutants. Red triangles correspond to Tn4351 insertion in the gldD (upper panel) and gldG (lower panel) genomic regions. Putative promoter sequences are underlined, the consensus sequence of Bacteroidetes promoters (“TAnnTTTG” box) are shown in bold. Putative Rho-independent terminators, shown in blue, were predicted using ARNold finding terminators (http://rna.igmors.u-psud.fr/toolbox/arnold/).
GldD and gldG are involved in colony spreading and extracellular proteolytic activity
The two mutant strains showed a lack of colony spreading when grown on 1/5 TYES agar, while the wild-type strain displayed the characteristic wide spreading phenotype (Figure 2A). In addition, strains gldD::Tn and gldG::Tn displayed a significant diminution of their extracellular proteolytic activity compared to the wild-type strain using gelatin as substrate (Figure 2B). Similar defects were observed using casein as substrate (data not shown). Interestingly, whereas no differences were observed in their growth kinetics when grown in the tryptone-rich TYES broth, with a doubling time of about 3 h for strains THCO2-90, gldD::Tn and gldG::Tn, both mutant strains were unable to grow in BH minimal broth supplemented with 0.5% casein or gelatin as C-source, contrary to the wild-type strain (Figure 2C).
Figure 2.
Spreading and extracellular proteolytic activity. (A) Spreading of five different strains of F. psychrophilum grown on 1/5 TYES agar after 72 h at 18°C: a, THCO2-90; b, gldG::Tn; c, gldD::Tn; d, gldG::Tn pCPGmR-gldG; e, gldD::Tn pCPGmR-gldD. (B) Extracellular proteolytic activity of the same strains grown on TYES agar + 0.75% gelatin after 72 h at 18°C. (C) Growth of strains THCO2-90 (blue), gldG::Tn (red), and gldD::Tn (green) in BH minimal broth medium supplemented with 0.5% of casein or gelatin after 72 h at 18°C, 200 rpm. The results are representative of three independent experiments.
Complementation of gldD::Tn and gldG::Tn mutant strains
In order to complement the Tn4351 erythromycin-resistant mutants, a new shuttle vector derived from pCP23 (Agarwal et al., 1997) was constructed by substituting the tetracycline-resistance marker tetQ by the aac(6')-aph(2') gentamycin-resistance gene. Conjugative transfer of the resulting plasmid, pCPGmR, in F. psychrophilum led to hundreds of gentamycin-resistant clones after 3–4 days on TYES gentamycin. The presence of plasmid was confirmed by DNA extraction. No gentamycin-resistant clones were obtained using E. coli MFDpir empty of plasmid as donor. In contrast, conjugations performed using E. coli MFDpir pCP23 (tetQ) or empty of plasmid as donor strains led to hundreds of F. psychrophilum false positive clones, which appeared on TYES tetracycline after 6–7 days of incubation. To complement Tn4351 mutants, the coding sequence of gldD and gldG was cloned under the control of a F. psychrophilum promoter into pCPGmR (see Figure S2). Introduction of pCPGmR-gldD and pCPGmR-gldG into gldD::Tn and gldG::Tn mutants, respectively, resulted in the complementation of each of them. Spreading on 1/5 TYES agar was comparable for the resulting colonies with those of the wild-type strain (Figure 2A). The extracellular proteolytic activity was also restored by plasmid introduction (Figure 2B). These results indicate that GldD and GldG are both required for efficient spreading and extracellular proteolytic activity in F. psychrophilum.
Inactivation of gldD or gldG impairs adhesion, biofilm formation, and bacterial sedimentation
The ability of F. psychrophilum cells to adhere to polystyrene plates has been previously reported (Högfors-Rönnholm et al., 2015). Here, under similar assayed conditions, both strains gldD::Tn and gldG::Tn showed an impaired adhesion ability to polystyrene plates after 3 h of incubation at 18°C (Figure 3A). Biofilm formation depends on adhesion of microorganisms to each other and to biotic or abiotic surfaces and F. psychrophilum cells form biofilms on polystyrene plates (Álvarez et al., 2006; Sundell and Wiklund, 2011). Interestingly, both strains gldD::Tn and gldG::Tn showed a strongly reduced biofilm formation ability in contrast to the wild-type strain when grown in 1/2 TYES broth under static condition (Figure 3B). When grown as planktonic bacteria in liquid culture, reduced sedimentation was observed after 48 h of incubation for both mutant strains compared to the wild-type strain (Figure 3C). Altogether, these results imply that both GldD and GldG proteins are required for proper adhesion of F. psychrophilum cells to surfaces, as well as for auto-adhesion ability required for biofilm development.
Figure 3.
Adhesion, biofilm formation, and sedimentation. (A) Adhesion of the F. psychrophilum strains THCO2-90 (blue), gldG::Tn (red), and gldD::Tn (green) to polystyrene after 3 h of incubation at 18°C without shaking. (B) Biofilm formation kinetic of the same strains (same color code) grown in 1/2 TYES broth for 120 h at 18°C without shaking. (C) Bacterial cells sedimentation of strains THCO2-90 (left); gldG::Tn (center) and gldD::Tn (right) grown in TYES broth after 48 h at 18°C, 200 rpm. The results are representative of three independent experiments.
Inactivation of gldD or gldG impairs extracellular protein abundance
As described above, inactivation of F. psychrophilum gldD or gldG genes led to pleiotropic phenotypes in vitro. The impaired bacterial surface functions such as extracellular proteolytic activity, cell sedimentation and cell adhesion of strains gldD::Tn and gldG::Tn suggest an effect of these mutations on protein secretion efficiency. To test this hypothesis, we used a label-free proteomic approach that combined SDS-PAGE electrophoresis and LC-MS/MS analyses, to compare the exoproteomes of strains THCO2-90, gldD::Tn and gldG::Tn (Table S1). Among the 414 proteins identified in total, 90 and 158 were significantly altered in abundance in the culture supernatant of strains gldD::Tn and gldG::Tn, respectively, compared to those of wild-type strain. Among them, 20 and 9 proteins were not detected at all for strains gldD::Tn (Table 2) and gldG::Tn (Table 3), respectively, including the extracellular protease Fpp1 and a probable S8 subtilisin family serine endopeptidase. Strikingly, among the proteins significantly less abundant in the mutant strains, proteins involved in T9SS, gliding and other proteolytic enzymes were identified (i.e., GldN, GldK, and PorT that belong to the core T9SS machinery, the PorU peptidase; the SprB adhesin; the Fpp2 extracellular protease and the collagenase; Tables 2, 3). Among the 39 and 9 proteins predicted to have either a TIGR04183 or a TIGR04131 CTD in the proteome of strain THCO2-90, 29, and 5, respectively, were not found or significantly less abundant in both mutants' supernatants. Finally, 11 and 83 proteins were more abundant in the culture supernatant of strains gldD::Tn and gldG::Tn, respectively, compared to the wild-type strain. Among them, most are of unknown function, and none possess a CTD domain (Table S1).
Table 2.
Secretome of strains THCO2-90 and gldD::Tn identified by LC-MS/MS analysis of cell-free supernatanta.
| Locus tag | Gene | Predicted functionb | CTDc | Ratio TH/gldDd | Spectrum count averagese | |
|---|---|---|---|---|---|---|
| TH | gldD::Tn | |||||
| THC0290_0237 | fpp1 | Psychrophilic metalloprotease Fpp1 precursor | TIGR04183 | Absent | 17.33 | 0.00 |
| THC0290_1494 | Probable ribonuclease | TIGR04183 | Absent | 13.67 | 0.00 | |
| THC0290_1520 | Probable endonuclease precursor | TIGR04183 | Absent | 10.67 | 0.00 | |
| THC0290_1527 | Protein of unknown function precursor containing a C-terminal secretion signal. Putative adhesin | TIGR04131 | Absent | 10.33 | 0.00 | |
| THC0290_2201 | Protein of unknown function precursor, putative adhesin | Absent | 10.33 | 0.00 | ||
| THC0290_1797 | Protein of unknown function precursor | TIGR04183 | Absent | 9.00 | 0.00 | |
| THC0290_1998 | Protein of unknown function precursor | Absent | 7.67 | 0.00 | ||
| THC0290_0944 | Probable S8 subtilisin family serine endopeptidase precursor | TIGR04183 | Absent | 7.00 | 0.00 | |
| THC0290_1048 | Protein of unknown function precursor, putative adhesin | TIGR04131 | Absent | 5.67 | 0.00 | |
| THC0290_0737 | Protein of unknown function | Absent | 4.00 | 0.00 | ||
| THC0290_0121 | Probable lipoprotein precursor | Absent | 3.67 | 0.00 | ||
| THC0290_0908 | Protein of unknown function | Absent | 3.67 | 0.00 | ||
| THC0290_1054 | Protein of unknown function precursor containing a C-terminal secretion signal | TIGR04183 | Absent | 3.00 | 0.00 | |
| THC0290_0171 | Probable cell surface protein (Leucine-rich repeat protein) precursor | TIGR04183 | Absent | 8.33 | 0.00 | |
| THC0290_2158 | Uncharacterized protein precursor. Probable phage protein. | 54.00 | 18.00 | 0.33 | ||
| THC0290_0500 | Probable S8 and S53 subtilisin family serine endopeptidase precursor | 52.67 | 52.67 | 1.00 | ||
| THC0290_0743 | gldN | Gliding motility protein precursor GldN | 46.50 | 62.00 | 1.33 | |
| THC0290_0740 | gldK | Gliding motility lipoprotein precursor GldK | 43.50 | 58.00 | 1.33 | |
| THC0290_0339 | porT | PorT protein | 28.00 | 9.33 | 0.33 | |
| THC0290_0174 | Probable cell surface protein (Leucine-rich repeat protein) precursor | TIGR04183 | 24.00 | 8.00 | 0.33 | |
| THC0290_2147 | gldJ | Gliding motility lipoprotein precursor GldJ | 23.67 | 94.67 | 4.00 | |
| THC0290_0754 | Protein of unknown function precursor, putative adhesin | 18.25 | 24.33 | 1.33 | ||
| THC0290_1615 | Protein of unknown function | 18.00 | 24.00 | 1.33 | ||
| THC0290_0291 | Protein of unknown function precursor | 18.00 | 6.00 | 0.33 | ||
| THC0290_2029 | Protein of unknown function precursor | 17.50 | 11.67 | 0.67 | ||
| THC0290_0129 | Putative outer membrane protein precursor | TIGR04183 | 17.00 | 22.67 | 1.33 | |
| THC0290_0091 | Probable glycoside hydrolase precursor | TIGR04183 | 14.00 | 9.33 | 0.67 | |
| THC0290_2146 | porU | Por secretion system protein PorU precursor. C-terminal signal peptidase | 12.25 | 16.33 | 1.33 | |
| THC0290_0931 | Collagenase precursor | TIGR04183 | 11.29 | 26.33 | 2.33 | |
| THC0290_1526 | Protein of unknown function precursor | 10.00 | 3.33 | 0.33 | ||
| THC0290_1595 | Protein of unknown function precursor, putative adhesin | TIGR04183 | 9.75 | 13.00 | 1.33 | |
| THC0290_1616 | Protein of unknown function precursor, putative adhesin | TIGR04131 | 8.33 | 16.67 | 2.00 | |
| THC0290_0175 | Probable cell surface protein (Leucine-rich repeat protein) | TIGR04183 | 7.75 | 10.33 | 1.33 | |
| THC0290_0299 | Probable M36 fungalysin family metalloprotease precursor | TIGR04183 | 6.93 | 106.33 | 15.33 | |
| THC0290_1047 | Protein of unknown function precursor, putative adhesin | TIGR04131 | 6.50 | 4.33 | 0.67 | |
| THC0290_0176 | Probable cell surface protein (Leucine-rich repeat protein) precursor | TIGR04183 | 6.40 | 10.67 | 1.67 | |
| THC0290_0238 | fpp2 | Psychrophilic metalloprotease Fpp2 precursor | TIGR04183 | 6.15 | 67.67 | 11.00 |
| THC0290_0186 | Probable cell surface protein (Leucine-rich repeat protein) precursor | TIGR04183 | 5.40 | 9.00 | 1.67 | |
| THC0290_0300 | Probable M36 fungalysin family metalloprotease precursor | TIGR04183 | 5.00 | 6.67 | 1.33 | |
| THC0290_0173 | Probable cell surface protein | TIGR04131 | 4.77 | 47.67 | 10.00 | |
Proteins which relative abundance changed at least ±2-fold significantly (p < 0.01) and for which at least 3 spectra have been identified in one of analyzed strain (full data available in Table S1).
Proteins annotation as previously described (Rochat et al., 2017a).
CTD type identified by BLASTP analysis.
Protein abundance ratio calculated using spectral counts.
Average number of spectral counts calculated using triplicates values for each strain.
Table 3.
Secretome of strains THCO2-90 and gldG::Tn identified by LC-MS/MS analysis of cell-free supernatanta.
| Spectrum count averagese | ||||||
|---|---|---|---|---|---|---|
| Locus tag | Gene | Predicted functionb | CTDc | Ratio TH/gldGd | TH | gldG::Tn |
| THC0290_0237 | fpp1 | Psychrophilic metalloprotease Fpp1 precursor | TIGR04183 | Absent | 17.33 | 0.00 |
| THC0290_0944 | Probable S8 subtilisin family serine endopeptidase precursor | TIGR04183 | Absent | 7.00 | 0.00 | |
| THC0290_1048 | Protein of unknown function precursor, putative adhesin | TIGR04131 | Absent | 5.67 | 0.00 | |
| THC0290_0171 | Probable cell surface protein (Leucine-rich repeat protein) precursor | TIGR04183 | Absent | 8.33 | 0.00 | |
| THC0290_2147 | gldJ | Gliding motility lipoprotein precursor GldJ | 40.57 | 94.67 | 2.33 | |
| THC0290_1520 | Probable endonuclease precursor | TIGR04183 | 32.00 | 10.67 | 0.33 | |
| THC0290_0174 | Probable cell surface protein (Leucine-rich repeat protein) precursor | TIGR04183 | 24.00 | 8.00 | 0.33 | |
| THC0290_0740 | gldK | Gliding motility lipoprotein precursor GldK | 17.40 | 58.00 | 3.33 | |
| THC0290_2201 | Protein of unknown function precursor, putative adhesin | 15.50 | 10.33 | 0.67 | ||
| THC0290_0743 | gldN | Gliding motility protein precursor GldN | 13.29 | 62.00 | 4.67 | |
| THC0290_1047 | Protein of unknown function precursor, putative adhesin | TIGR04131 | 13.00 | 4.33 | 0.33 | |
| THC0290_0500 | Probable S8 and S53 subtilisin family serine endopeptidase precursor | 10.53 | 52.67 | 5.00 | ||
| THC0290_1615 | Protein of unknown function | 10.29 | 24.00 | 2.33 | ||
| THC0290_1494 | Probable ribonuclease | TIGR04183 | 10.25 | 13.67 | 1.33 | |
| THC0290_0129 | Putative outer membrane protein precursor | TIGR04183 | 8.50 | 22.67 | 2.67 | |
| THC0290_0175 | Probable cell surface protein (Leucine-rich repeat protein) | TIGR04183 | 7.75 | 10.33 | 1.33 | |
| THC0290_0238 | fpp2 | Psychrophilic metalloprotease Fpp2 precursor | TIGR04183 | 6.15 | 67.67 | 11.00 |
| THC0290_2158 | Uncharacterized protein precursor. Probable phage protein. | 6.00 | 18.00 | 3.00 | ||
| THC0290_0754 | Protein of unknown function precursor, putative adhesin | 5.62 | 24.33 | 4.33 | ||
| THC0290_1616 | Protein of unknown function precursor, putative adhesin | TIGR04131 | 5.56 | 16.67 | 3.00 | |
| THC0290_0300 | Probable M36 fungalysin family metalloprotease precursor | TIGR04183 | 5.40 | 9.00 | 1.67 | |
Proteins which relative abundance changed at least ±2-fold significantly (p < 0.01) and for which at least 3 spectra have been identified in one of analyzed strain (full data available in Table S1).
Proteins annotation as previously described (Rochat et al., 2017a).
CTD type identified by BLASTP analysis.
Protein abundance ratio calculated using spectral counts.
Average number of spectral counts calculated using triplicates values for each strain.
Cell surface shaving with trypsin and LC-MS/MS analysis of strains gldD::Tn and wild-type enabled the identification of 426 proteins (Table S2). Among them, 74 were significantly altered in abundance in strain gldD::Tn compared to the wild-type strain. Indeed, 39 proteins (8 with a CTD domain) were not detected or significantly less abundant, including the GldJ gliding protein and the GldN T9SS machinery subunit (Table 4). In contrast, 35 proteins were more abundant in strain gldD::Tn such as the predicted cysteine protease FcpB and the gliding motility precursor RemF. Contrary to results obtained in the supernatant fractions, the SprB surface adhesin and the PorU peptidase were not detected in the wild-type cells, whereas these proteins were identified in strain gldD::Tn (Table 4).
Table 4.
Surfome of strains THCO2-90 and gldD::Tn identified by LC-MS/MS analysisa.
| Locus tag | Gene | Predicted functionb | CTDc | Ratio TH/gldDd | Spectrum count averagese | |
|---|---|---|---|---|---|---|
| TH | gldD::Tn | |||||
| THC0290_2147 | gldJ | Gliding motility lipoprotein precursor GldJ | Absent | 27.00 | 0.00 | |
| THC0290_2385 | RCC1 (Regulator of Chromosome Condensation) repeat domain protein precursor | TIGR04183 | Absent | 5.67 | 0.00 | |
| THC0290_0143 | ATPase, MoxR family | Absent | 4.67 | 0.00 | ||
| THC0290_0091 | Probable glycoside hydrolase precursor | TIGR04183 | Absent | 4.33 | 0.00 | |
| THC0290_1535 | fahA | Fumarylacetoacetase | Absent | 4.33 | 0.00 | |
| THC0290_1494 | Probable ribonuclease | TIGR04183 | Absent | 3.33 | 0.00 | |
| THC0290_1675 | Probable asparagine synthetase [glutamine-hydrolyzing] | Absent | 3.33 | 0.00 | ||
| THC0290_0462 | nrdB | Ribonucleoside-diphosphate reductase, beta subunit | Absent | 3.00 | 0.00 | |
| THC0290_1326 | ybcL | Probable phospholipid-binding protein precursor YbcL | Absent | 3.00 | 0.00 | |
| THC0290_1520 | Probable endonuclease precursor | Absent | 3.00 | 0.00 | ||
| THC0290_2305 | fabH3 | 3-oxoacyl-[acyl-carrier-protein] synthase III protein FabH3 | Absent | 3.00 | 0.00 | |
| THC0290_0129 | Putative outer membrane protein precursor | TIGR04183 | 45.00 | 15.00 | 0.33 | |
| THC0290_0149 | Probable alcohol dehydrogenase | 15.00 | 5.00 | 0.33 | ||
| THC0290_0164 | sodA | Superoxide dismutase [Mn] | 15.00 | 5.00 | 0.33 | |
| THC0290_1498 | rho | Transcription termination factor Rho | 14.00 | 4.67 | 0.33 | |
| THC0290_1932 | Protein of unknown function precursor containing a C-terminal secretion signal. Putative adhesin. | TIGR04131 | 12.67 | 12.67 | 1.00 | |
| THC0290_1081 | dapD | 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferas | 7.00 | 7.00 | 1.00 | |
| THC0290_0973 | lpdA1 | Dihydrolipoyl dehydrogenase | 7.00 | 4.67 | 0.67 | |
| THC0290_0743 | gldN | Gliding motility protein precursor GldN | 6.80 | 11.33 | 1.67 | |
| THC0290_0754 | Protein of unknown function precursor, putative adhesin | 6.33 | 6.33 | 1.00 | ||
| THC0290_2067 | rplQ | 50S ribosomal protein L17 | 5.33 | 5.33 | 1.00 | |
| THC0290_2146 | porU | Por secretion system protein PorU precursor. C-terminal signal peptidase | 0 | 0.00 | 22.67 | |
| THC0290_1795 | Probable lipoprotein precursor | 0 | 0.00 | 13.00 | ||
| THC0290_0025 | sprB | Putative adhesin precursor SprB (modular protein) | TIGR04131 | 0 | 0.00 | 6.33 |
| THC0290_0021 | remF | Gliding motility protein RemF precursor | 0.30 | 3.67 | 12.33 | |
Proteins which relative abundance changed at least ±2-fold significantly (p < 0.01) and for which at least 3 spectra have been identified in one of analyzed strain (full data available in Table S2).
Proteins annotation as previously described (Rochat et al., 2017a).
CTD type identified by BLASTP analysis.
Protein abundance ratio calculated using spectral counts.
Average number of spectral counts calculated using triplicates values for each strain.
When analyzing the surfome of gldG::Tn compared to the wild-type strain, 582 proteins were identified in total (Table S2). Among the 69 proteins altered in abundance in strain gldG::Tn, 14 were not detected or significantly less abundant, including the above-mentioned GldJ, GldK, and GldN or the collagenase (Table 5), which is in agreement with the results obtained in the supernatant fractions (Table 3). In contrast, and as observed for strain gldD::Tn, 55 proteins were undetected or less abundant in the wild-type surfome, including SprB, PorU, and RemF (Table 5).
Table 5.
Surfome of strains THCO2-90 and gldG::Tn identified by LC-MS/MS analysisa.
| Locus tag | Gene | Predicted functionb | CTDc | Ratio TH/gldGd | Spectrum count averagese | |
|---|---|---|---|---|---|---|
| TH | gldG::Tn | |||||
| THC0290_2147 | gldJ | Gliding motility lipoprotein precursor GldJ | Absent | 27.00 | 0 | |
| THC0290_2385 | RCC1 (Regulator of Chromosome Condensation) repeat domain protein precursor | TIGR04183 | Absent | 5.67 | 0 | |
| THC0290_0091 | Probable glycoside hydrolase precursor | TIGR04183 | Absent | 4.33 | 0 | |
| THC0290_0232 | hppD | 4-hydroxyphenylpyruvate dioxygenase | Absent | 3.67 | 0 | |
| THC0290_1494 | Probable ribonuclease | TIGR04183 | Absent | 3.33 | 0 | |
| THC0290_1252 | Universal stress protein, UspA family | Absent | 3.00 | 0 | ||
| THC0290_1520 | Probable endonuclease precursor | TIGR04183 | Absent | 3.00 | 0 | |
| THC0290_2305 | fabH3 | 3-oxoacyl-[acyl-carrier-protein] synthase III protein FabH3 | Absent | 3.00 | 0 | |
| THC0290_0740 | gldK | Gliding motility lipoprotein precursor GldK | 16.0 | 10.7 | 0.7 | |
| THC0290_0129 | Putative outer membrane protein precursor | TIGR04183 | 11.3 | 15.0 | 1.3 | |
| THC0290_0743 | gldN | Gliding motility protein precursor GldN | 6.8 | 11.3 | 1.7 | |
| THC0290_0931 | Collagenase precursor | 2.7 | 33.7 | 12.3 | ||
| THC0290_2146 | porU | Por secretion system protein PorU precursor. C-terminal signal peptidase | 0 | 0.00 | 18.33 | |
| THC0290_1795 | Probable lipoprotein precursor | 0 | 0.00 | 17.67 | ||
| THC0290_0025 | sprB | Putative adhesin precursor SprB (modular protein) | TIGR04131 | 0 | 0.00 | 8.33 |
| THC0290_0946 | pafA | Alkaline phosphatase precursor | 0 | 0.00 | 8.00 | |
| THC0290_0866 | Protein of unknown function | 0 | 0.00 | 5.67 | ||
Proteins which relative abundance changed at least ±2-fold significantly (p < 0.01) and for which at least 3 spectra have been identified in one of analyzed strain (full data available in Table S2).
Proteins annotation as previously described (Rochat et al., 2017a).
CTD type identified by BLASTP analysis.
Protein abundance ratio calculated using spectral counts.
Average number of spectral counts calculated using triplicates values for each strain.
This proteomic analysis reveals that inactivation of gldD or gldG by Tn4351 results in a major defect in surface protein localization, especially for those proteins likely translocated through the T9SS apparatus.
Virulence of F. psychrophilum is impaired by mutation in gldD or gldG in a rainbow trout infection model
The effect of gldD or gldG inactivation on the virulence of F. psychrophilum was investigated in rainbow trout using two different routes of infection, intramuscular injection and immersion. First, the LD50 of strain THCO2-90 was established at 6.0 × 103 bacteria by performing intramuscular injection challenge in rainbow trout. This value was used as a reference to compare the virulence of strains THCO2-90, gldD::Tn and gldG::Tn. Groups of 10 fish were injected with 2 x 104 CFU of strains THCO2-90, gldD::Tn or gldG::Tn. This dose theoretically corresponds to 4-fold the LD50 of the wild-type strain. Fish challenged with the wild-type strain quickly died and the cumulative mortality reached 100% 8 days post infection. In contrast, strains gldD::Tn and gldG::Tn showed cumulative mortalities of 20 and 0% respectively by 8 days, and 40 and 20% by 14 days (Figure 4).
Figure 4.

Intramuscular experimental challenge. Rainbow trout survival following intramuscular injection with F. psychrophilum strains THCO2-90 (blue), gldG::Tn (red), and gldD::Tn (green). The plots show the survival of rainbow trout following intramuscular challenge with 2 × 104 CFU of each strain for 14 days. The results are representative of two independent experiments.
We further investigated the impact of gldD or gldG inactivation on virulence using an immersion challenge model that supposedly more closely mimics the natural infection route. Fish were bathed for 24 h in water contaminated by bacterial culture of strains THCO2-90, gldD::Tn or gldG::Tn (theoretical initial concentration 5 × 106 CFU mL−1). Following the bath challenge, an increase in bacterial concentration in water was observed for all tanks, whatever the strain (Table 6). Four days post-infection, fish cumulative mortality reached 100% with the wild-type strain, while the mortality of fish infected with strains gldD::Tn or gldG::Tn was similar to that of the non-infected group (≤8%; Figure 5A). When bath-challenged with the wild-type strain, the bacterium was detected on the surface and in organs of all fish arbitrarily sampled 6-h after the end of immersion. The bacterial load in spleen and gills was on average 3.5 × 104 and 2.8 × 104 CFU, respectively. In contrast, the bacterium was only detected in 2 out of 12 fish infected with strains gldD::Tn or gldG::Tn. For those fish, the bacterial loads were 102 and 3.5 × 102 CFU in the spleen and 1.4 × 102 and 2.6 × 102 CFU in the gills, respectively (Figures 5B,C). In addition, F. psychrophilum was always detected in samples of skin mucus of fish infected with the wild-type strain, while the bacterium was systematically absent from the skin mucus of fish infected with the mutant strains (12 fish sampled for each group; data not shown).
Table 6.
Bacterial loads in aquarium water during immersion challenge.
| CFU mL−1 | ||
|---|---|---|
| Time (hours) | ||
| Strain | 0 | 24 |
| THCO2-90 | 2 × 106 | 8 × 107 |
| gldD::Tn | 9 × 106 | 4 × 107 |
| gldG::Tn | 8 × 106 | 5 × 107 |
Average of bacterial quantification determined at the beginning (0 h) and the end (24 h) of fish infection challenge from two independent experiments.
Figure 5.
Experimental immersion challenge. (A) Rainbow trout survival following infection by immersion challenge with F. psychrophilum. Fish were infected for 24 h with 5 × 106 CFU mL−1 in a final volume of 15 L with strains THCO2-90 (blue), gldG::Tn (red), and gldD::Tn (green). (B,C) Bacterial load of rainbow trout infected with strains THCO2-90, gldG::Tn and gldD::Tn. Six fish infected by each strain were sacrificed at 4 h post-infection. The bacterial loads of spleen (B) and gills (C) are shown. The results of two independent experiments are presented.
These results revealed that the virulence of strains gldD::Tn and gldG::Tn is strongly attenuated in rainbow trout whatever the infection route, with considerably lower invasion and proliferation abilities in vivo.
Discussion
In order to understand the role and the relative importance of F. psychrophilum genes in its lifestyle, a Tn4351-mutant library was constructed in the strain THCO2-90. By characterizing a subset of this library by inverse-PCR, two F. johnsoniae orthologous genes, gldD and gldG, were found disrupted in our mutant collection. Both gldD::Tn and gldG::Tn display a lack of spreading on agar plate which is restored by complementation. In addition to their motility deficiency, other phenotypes such as impaired extracellular proteolytic activity or reduced adhesion ability in vitro and in vivo were observed. In F. johnsoniae, strains carrying mutations in gldD or gldG also exhibit phenotypes other than motility such as extracellular chitin utilization deficiency and a higher resistance to bacteriophage infections (Hunnicutt and McBride, 2001; Hunnicutt et al., 2002). In addition, a gldD mutant in C. algicola showed only partially deficient motility (i.e., residual spreading on agar still occurred), which raised the idea that GldD may have a role other than gliding (Zhu and McBride, 2016).
The deficiency in extracellular proteolytic activity of strains gldD::Tn and gldG::Tn in F. psychrophilum suggests that inactivation of these genes has consequences on the secretion process. Bacterial exoproteome analyses showed important changes in the abundance of extracellular proteins in both mutants. The disruption of the gldD or gldG gene of F. psychrophilum provokes a remarkable diminution of GldJ gliding protein. Similarly, in F. johnsoniae, disruption of the orthologous genes gldD and gldG resulted in a dramatic reduction of GldJ abundance (Braun and McBride, 2005). In addition, the disruption of gldD or gldG provokes a remarkable diminution of GldK, GldN, and SprT proteins, described as three components of the core machinery of the T9SS in F. johnsoniae (Rhodes et al., 2010; Shrivastava et al., 2013), C. ochracea (Kita et al., 2016) and P. gingivalis (Sato et al., 2010, 2013). These changes might explain the secretion deficiency observed in gldD or gldG mutants. Strikingly, among the proteins absent or significantly less abundant in the exoproteome of both mutant strains, a significant number possess one of the TIGR04183 or TIGR04131-type domains, which were found to be required for efficient protein export by the T9SS in several Bacteroidetes species (McBride and Nakane, 2015; Kulkarni et al., 2017). It is important to note that not all proteins follow this trend. The SprB adhesin, which carries a TIGR04131-type domain required for its secretion to the cell surface by the T9SS (Rhodes et al., 2010; Sato et al., 2010; Shrivastava et al., 2013) is less abundant in the spent media of mutant strains compared to the wild-type strain. However, opposite results were observed in the surfome analyses: SprB was not detected on wild-type cells surface, whereas specific peptides were detected in mutant strains. Surfome proteomic analysis was performed using the intact cell surface shaving method, which is based on the digestion of exposed proteins by added trypsin, resulting in peptides release for further identification. One key limitation to this approach is that only the protruding protein domains are accessible to proteases (Grandi, 2010). The differences observed in the case of SprB could be attributed to technical limitations, such as a protein resistance to trypsin cleavage under these native conditions or a hindered access to trypsin. In F. johnsoniae, the deletion of PorV showed that the secretion of many but not all proteins carrying the T9SS C-terminal secretion signal was affected. It should to be noted that the secretion of SprB was not disturbed (Kharade and McBride, 2015). Recently, it has been proposed that the secretion of SprB-like large proteins (366 kDa) may require the involvement of additional proteins in addition to those forming the T9SS, as well as regions of the secreted protein other than the CTD to interact with the secretion system (Kulkarni et al., 2017). Altogether, our results suggest that mutations in gldD or gldG provoke a perturbation in the T9SS activity of F. psychrophilum. The exact reasons for the disorders observed in mutant strains remain unknown and further studies are needed to determine the precise molecular functions of GldD and GldG proteins. They could be involved in any critical steps of the secretion process, from the T9SS assembly to the recognition and translocation of its substrates across the outer membrane, or they may be involved in still another unknown function that indirectly impacts the T9SS. The decreased amount of three components of the core machinery in both mutants could result in a bottleneck, limiting protein export and possibly explaining the reduced secretion efficiency observed using proteomics. Taking into account these results, it is also unclear whether strains gldD::Tn and gldG::Tn are defective in spreading because they lack the gliding motor or due to an inefficient protein secretion.
Undoubtedly, the pleiotropic effects displayed by the gldD::Tn and gldG::Tn mutants have a profound impact on their virulence as shown by their very low ability to colonize fish and to induce mortality using rainbow trout as an infection model. The immersion challenge revealed the importance of GldD and GldG in F. psychrophilum virulence. In contrast with fish infected with the wild-type strain, both mutant strains were not detected in the skin mucus of experimentally infected fish and they showed a lower ability to colonize the gills. These results are in line with the important diminution of adhesive properties observed in vitro. Skin mucus acts as a first barrier and is an important part of the fish immune system, containing numerous antibacterial factors secreted by skin cells, such as immunoglobulins, agglutinins, lectins, lysins, and lysozymes; but skin mucus can also be an important microenvironment and portal of entry for pathogenic bacteria (Benhamed et al., 2014). F. psychrophilum is able to adhere to fish skin mucus (Högfors-Rönnholm et al., 2015) and to different mucosal tissues such as fins, gills, skin, and eyes (Nematollahi et al., 2003b; Papadopoulou et al., 2017). Exoproteome analyses revealed that both mutant strains display an important decrease in the amount of several putative adhesins. Papadopoulou and co-workers had previously noted that the F. psychrophilum adhesion process was likely mediated by bacterial surface proteinaceous compounds, since proteinase K treatment of cells significantly decreased bacterial adhesion to polystyrene surface (Papadopoulou et al., 2015). The lack of one or some of these adhesins is thus likely responsible for the impaired adhesion of mutant cells to abiotic or biotic surfaces. Both mutant strains exhibit also an impaired biofilm formation capacity. It is well-known that adhesion to surfaces is the first essential step during microbial biofilm formation (Joo and Otto, 2012). Our results are consistent with findings describing a significant overexpression of genes encoding some of these predicted adhesins (e.g., THC0290_1047, THC0290_1048, and THC0290_2201) during biofilm formation in other F. psychrophilum strains (Levipan and Avendaño-Herrera, 2017). Some of these adhesins possess a TIGR04183 or TIGR04131 domain. These observations indicate a potential requirement of T9SS for secretion of adhesion factors and, consequently, for biofilm formation by F. psychrophilum, as previously demonstrated in F. johnsoniae (Shrivastava et al., 2013) and in C. ochracea (Kita et al., 2016).
The lack of extracellular proteolytic activity found in vitro by both strains gldD::Tn and gldG::Tn could explain their high degree of attenuation during rainbow trout infection. Proteolytic degradation of host tissues has been reported to be involved in the virulence of several fish-pathogenic bacteria such as Yersinia ruckeri, Vibrio anguilarum, and Edwarsiella tarda (Fernandez et al., 2003; Yang et al., 2007; Zhou et al., 2015), and secreted enzymes were also proposed as virulence factors in F. psychrophilum (Bertolini et al., 1994; Ostland et al., 2000). One of the most reduced extracellular protease in the exoproteome of mutant strains, the collagenase, was found to be involved in the virulence of F. psychrophilum in ayu (Plecoglossus altivelis) as a fish infection model (Nakayama et al., 2015). Other extracellular proteases such as two M36 fungalysin family metalloproteases or the subtilisin-like extracellular protease were much less abundant in mutant strains and they also may contribute to virulence. Interestingly, it has been reported that the inactivation by Tn4351 of fpgA encoding a glycosyltransferase results in similar phenotypes as gldD or gldG inactivation, such as a lack of colony spreading and extracellular proteolytic activity and a complete loss of virulence (Pérez-Pascual et al., 2015).
The role of GldD and GldG proteins was first studied in the environmental Bacteroidetes species F. johnsoniae and was long considered to be essentially linked to gliding motility (Hunnicutt and McBride, 2001; Hunnicutt et al., 2002). The previous observation that the non-gliding bacterium P. gingivalis lacks gldD and gldG orthologs also suggested that they might be involved more in gliding than in secretion. However, our results do not support this assumption. In this study, we assessed for the first time their role in the fish pathogen F. psychrophilum. The exhaustive exoproteome analysis of gldD and gldG mutants highlighted their impact on the secretory process, especially for some but not all proteins translocated by the T9SS. Extracellular proteins are of particular interest as they provide insight into the pathogenicity of this microorganism. Our data support the hypothesis that the impaired secretion of extracellular enzymes and adhesins resulting from the disruption of gldD or gldG is responsible for the reduced host colonization and infective ability of F. psychrophilum. These results provide important information when considering the lack of knowledge regarding F. psychrophilum virulence factors as well as the need to identify new targets for therapeutic interventions against F. psychrophilum infections.
Author contributions
DP-P: Mutant library construction, phenotypic characterization, proteomics, animal experimentation, and drafting of the manuscript; TR: phenotypic characterization, mutant complementation, animal experimentation, and drafting of the manuscript with substantial intellectual contribution; BK: mutant library construction and animal experimentation; EG and FN-R: mutant library construction; CH: proteomics (sample preparation, LC-MS/MS, statistical analyses of data); EQ: development of the rainbow trout isogenic line and data interpretation; JG: data analysis and manuscript preparation; JB: substantial intellectual contribution throughout the study, animal experimentation, data analysis and manuscript preparation. ED: substantial intellectual contribution throughout the study, interpretation of data, manuscript preparation, and acquisition of funding. All authors read and approved the final manuscript.
Conflict of interest statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Acknowledgments
The authors are very grateful to the staff of the fish facilities especially Dimitri Rigaudeau (INRA IERP and PEIMA, France) and to Nicolas Dechamp (INRA GABI, France) for supplying fish, technical help and advices. We thank also the Plateforme d'Analyse Protéomique Paris Sud-Ouest (PAPPSO, http://pappso.inra.fr/) for its assistance with the proteomic analyses.
Footnotes
Funding. This work was supported in part by the European Project FP7 AQUAEXCEL n°262336.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2017.02168/full#supplementary-material
References
- Agarwal S., Hunnicutt D. W., McBride M. J. (1997). Cloning and characterization of the Flavobacterium johnsoniae (Cytophaga johnsonae) gliding motility gene, gldA. Proc. Natl. Acad. Sci. U.S.A. 94, 12139–12144. 10.1073/pnas.94.22.12139 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Álvarez B., Álvarez J., Menéndez A., Guijarro J. A. (2008). A mutant in one of two exbD loci of a TonB system in Flavobacterium psychrophilum shows attenuated virulence and confers protection against cold water disease. Microbiology 154(Pt 4), 1144–1151. 10.1099/mic.0.2007/010900-0 [DOI] [PubMed] [Google Scholar]
- Álvarez B., Secades P., McBride M. J., Guijarro J. A. (2004). Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum. Appl. Environ. Microbiol. 70, 581–587. 10.1128/AEM.70.1.581-587.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Álvarez B., Secades P., Prieto M., McBride M. J., Guijarro J. A. (2006). A mutation in Flavobacterium psychrophilum tlpB inhibits gliding motility and induces biofilm formation. Appl. Environ. Microbiol. 72, 4044–4053. 10.1128/AEM.00128-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Avendaño-Herrera R., Houel A., Irgang R., Bernardet J. F., Godoy M., Nicolas P., et al. (2014). Introduction, expansion and coexistence of epidemic Flavobacterium psychrophilum lineages in Chilean fish farms. Vet. Microbiol. 170, 298–306. 10.1016/j.vetmic.2014.02.009 [DOI] [PubMed] [Google Scholar]
- Benhamed S., Guardiola F. A., Mars M., Esteban M. A. (2014). Pathogen bacteria adhesion to skin mucus of fishes. Vet. Microbiol. 171, 1–12. 10.1016/j.vetmic.2014.03.008 [DOI] [PubMed] [Google Scholar]
- Bertolini J. M., Wakabayashi H., Watral V. G., Whipple M. J., Rohovec J. S. (1994). Electrophoretic detection of proteases from selected strains of Flexibacter psychrophilus and assessment of their variability. J. Aquat. Anim. Health 6, 224–233. [DOI] [Google Scholar]
- Braun T. F., McBride M. J. (2005). Flavobacterium johnsoniae GldJ is a lipoprotein that is required for gliding motility. J. Bacteriol. 187, 2628–2637. 10.1128/JB.187.8.2628-2637.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Braun T. F., Khubbar M. K., Saffarini D. A., McBride M. J. (2005). Flavobacterium johnsoniae gliding motility genes identified by mariner mutagenesis. J. Bacteriol. 187, 6943–6952. 10.1128/JB.187.20.6943-6952.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cepeda C., Santos Y. (2000). Rapid and low-level toxic PCR-based method for routine identification of Flavobacterium psychrophilum. Int. Microbiol. 3, 235–238. [PubMed] [Google Scholar]
- Cooper A. J., Kalinowski A. P., Shoemaker N. B., Salyers A. A. (1997). Construction and characterization of a Bacteroides thetaiotaomicron recA mutant: transfer of Bacteroides integrated conjugative elements is RecA independent. J. Bacteriol. 179, 6221–6227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- del Cerro A., Mendoza M. C., Guijarro J. A. (2002). Usefulness of a TaqMan-based polymerase chain reaction assay for the detection of the fish pathogen Flavobacterium psychrophilum. J. Appl. Microbiol. 93, 149–156. 10.1046/j.1365-2672.2002.01661.x [DOI] [PubMed] [Google Scholar]
- Duchaud E., Boussaha M., Loux V., Bernardet J. F., Michel C., Kerouault B., et al. (2007). Complete genome sequence of the fish pathogen Flavobacterium psychrophilum. Nat. Biotechnol. 25, 763–769. 10.1038/nbt1313 [DOI] [PubMed] [Google Scholar]
- Fernandez L., Lopez J. R., Secades P., Menendez A., Marquez I., Guijarro J. A. (2003). In vitro and in vivo studies of the Yrp1 protease from Yersinia ruckeri and its role in protective immunity against enteric red mouth disease of salmonids. Appl. Environ. Microbiol. 69, 7328–7335. 10.1128/AEM.69.12.7328-7335.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fujiwara-Nagata E., Eguchi M. (2009). Development and evaluation of a loop-mediated isothermal amplification assay for rapid and simple detection of Flavobacterium psychrophilum. J. Fish Dis. 32, 873–881. 10.1111/j.1365-2761.2009.01066.x [DOI] [PubMed] [Google Scholar]
- Fujiwara-Nagata E., Chantry-Darmon C., Bernardet J. F., Eguchi M., Duchaud E., Nicolas P. (2013). Population structure of the fish pathogen Flavobacterium psychrophilum at whole-country and model river levels in Japan. Vet. Res. 44:34. 10.1186/1297-9716-44-34 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gibson D. G., Young L., Chuang R. Y., Venter J. C., Hutchison C. A., III., Smith H. O. (2009). Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343–345. 10.1038/nmeth.1318 [DOI] [PubMed] [Google Scholar]
- Glew M. D., Veith P. D., Peng B., Chen Y. Y., Gorasia D. G., Yang Q., et al. (2012). PG0026 is the C-terminal signal peptidase of a novel secretion system of Porphyromonas gingivalis. J. Biol. Chem. 287, 24605–24617. 10.1074/jbc.M112.369223 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gómez E., Álvarez B., Duchaud E., Guijarro J.A. (2015). Development of a markerless deletion system for the fish-pathogenic bacterium Flavobacterium psychrophilum. PLoS ONE 10:e0117969. 10.1371/journal.pone.0117969 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gómez E., Méndez J., Cascales D., Guijarro J. A. (2014). Flavobacterium psychrophilum vaccine development: a difficult task. Microb. Biotechnol. 7, 414–423. 10.1111/1751-7915.12099 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gómez E., Pérez-Pascual D., Fernández L., Méndez J., Reimundo P., Navais R., et al. (2012). Construction and validation of a GFP-based vector for promoter expression analysis in the fish pathogen Flavobacterium psychrophilum. Gene 497, 263–268. 10.1016/j.gene.2012.01.069 [DOI] [PubMed] [Google Scholar]
- Grandi G. (2010). Bacterial surface proteins and vaccines. F1000 Biol. Rep. 2:36. 10.3410/B2-36 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Heath J. E., Seers C. A., Veith P. D., Butler C. A., Nor Muhammad N. A., Chen Y. Y., et al. (2016). PG1058 is a novel multidomain protein component of the bacterial type IX secretion system. PLoS ONE 11:e0164313. 10.1371/journal.pone.0164313 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Högfors-Rönnholm E., Norrgård J., Wiklund T. (2015). Adhesion of smooth and rough phenotypes of Flavobacterium psychrophilum to polystyrene surfaces. J. Fish Dis. 38, 429–437. 10.1111/jfd.12250 [DOI] [PubMed] [Google Scholar]
- Hunnicutt D. W., McBride M. J. (2001). Cloning and characterization of the Flavobacterium johnsoniae gliding motility genes gldD and gldE. J. Bacteriol. 183, 4167–4175. 10.1128/JB.183.14.4167-4175.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hunnicutt D. W., Kempf M. J., McBride M. J. (2002). Mutations in Flavobacterium johnsoniae gldF and gldG disrupt gliding motility and interfere with membrane localization of GldA. J. Bacteriol. 184, 2370–2378. 10.1128/JB.184.9.2370-2378.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Joo H. S., Otto M. (2012). Molecular basis of in vivo biofilm formation by bacterial pathogens. Chem. Biol. 19, 1503–1513. 10.1016/j.chembiol.2012.10.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kharade S. S., McBride M. J. (2014). Flavobacterium johnsoniae chitinase ChiA is required for chitin utilization and is secreted by the type IX secretion system. J. Bacteriol. 196, 961–970. 10.1128/JB.01170-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kharade S. S., McBride M. J. (2015). Flavobacterium johnsoniae PorV is required for secretion of a subset of proteins targeted to the type IX secretion system. J. Bacteriol. 197, 147–158. 10.1128/JB.02085-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kita D., Shibata S., Kikuchi Y., Kokubu E., Nakayama K., Saito A., et al. (2016). Involvement of the Type IX secretion system in Capnocytophaga ochracea gliding motility and biofilm formation. Appl. Environ. Microbiol. 82, 1756–1766. 10.1128/AEM.03452-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kulkarni S. S., Zhu Y., Brendel C. J., McBride M. J. (2017). Diverse C-terminal sequences involved in Flavobacterium johnsoniae protein secretion. J. Bacteriol. 199:e00884-16. 10.1128/JB.00884-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lasica A. M., Goulas T., Mizgalska D., Zhou X., de Diego I., Ksiazek M., et al. (2016). Structural and functional probing of PorZ, an essential bacterial surface component of the type-IX secretion system of human oral-microbiomic Porphyromonas gingivalis. Sci. Rep. 6:37708. 10.1038/srep37708 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Levipan H. A., Avendaño-Herrera R. (2017). Different phenotypes of mature biofilm in Flavobacterium psychrophilum share a potential for virulence that differs from planktonic state. Front. Cell. Infect. Microbiol. 7:76. 10.3389/fcimb.2017.00076 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu J., McBride M. J., Subramaniam S. (2007). Cell surface filaments of the gliding bacterium Flavobacterium johnsoniae revealed by cryo-electron tomography. J. Bacteriol. 189, 7503–7506. 10.1128/JB.00957-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- McBride M. J., Kempf M. J. (1996). Development of techniques for the genetic manipulation of the gliding bacterium Cytophaga johnsonae. J. Bacteriol. 178, 583–590. 10.1128/jb.178.3.583-590.1996 [DOI] [PMC free article] [PubMed] [Google Scholar]
- McBride M. J., Nakane D. (2015). Flavobacterium gliding motility and the type IX secretion system. Curr. Opin. Microbiol. 28, 72–77. 10.1016/j.mib.2015.07.016 [DOI] [PubMed] [Google Scholar]
- McBride M. J., Zhu Y. (2013). Gliding motility and Por secretion system genes are widespread among members of the phylum bacteroidetes. J. Bacteriol. 195, 270–278. 10.1128/JB.01962-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Metcalf W. W., Jiang W., Wanner B. L. (1994). Use of the rep technique for allele replacement to construct new Escherichia coli hosts for maintenance of R6K gamma origin plasmids at different copy numbers. Gene 138, 1–7. [DOI] [PubMed] [Google Scholar]
- Nakane D., Sato K., Wada H., McBride M. J., Nakayama K. (2013). Helical flow of surface protein required for bacterial gliding motility. Proc. Natl. Acad. Sci. U.S.A. 110, 11145–11150. 10.1073/pnas.1219753110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nakayama H., Tanaka K., Teramura N., Hattori S. (2015). Expression of collagenase in Flavobacterium psychrophilum isolated from cold-water disease-affected ayu (Plecoglossus altivelis). Biosci. Biotechnol. Biochem. 80, 135–144. 10.1080/09168451.2015.1079477 [DOI] [PubMed] [Google Scholar]
- Narita Y., Sato K., Yukitake H., Shoji M., Nakane D., Nagano K., et al. (2014). Lack of a surface layer in Tannerella forsythia mutants deficient in the type IX secretion system. Microbiology 160(Pt 10), 2295–2303. 10.1099/mic.0.080192-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nelson S. S., Bollampalli S., McBride M. J. (2008). SprB is a cell surface component of the Flavobacterium johnsoniae gliding motility machinery. J. Bacteriol. 190, 2851–2857. 10.1128/JB.01904-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nelson S. S., Glocka P. P., Agarwal S., Grimm D. P., McBride M. J. (2007). Flavobacterium johnsoniae SprA is a cell surface protein involved in gliding motility. J. Bacteriol. 189, 7145–7150. 10.1128/JB.00892-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nematollahi A., Decostere A., Pasmans F., Haesebrouck F. (2003a). Flavobacterium psychrophilum infections in salmonid fish. J. Fish Dis. 26, 563–574. 10.1046/j.1365-2761.2003.00488.x [DOI] [PubMed] [Google Scholar]
- Nematollahi A., Decostere A., Pasmans F., Ducatelle R., Haesebrouck F. (2003b). Adhesion of high and low virulence Flavobacterium psychrophilum strains to isolated gill arches of rainbow trout Oncorhynchus mykiss. Dis. Aquat. Organ. 55, 101–107. 10.3354/dao055101 [DOI] [PubMed] [Google Scholar]
- Ngo T. P., Bartie K. L., Thompson K. D., Verner-Jeffreys D. W., Hoare R., Adams A. (2017). Genetic and serological diversity of Flavobacterium psychrophilum isolates from salmonids in United Kingdom. Vet. Microbiol. 201, 216–224. 10.1016/j.vetmic.2017.01.032 [DOI] [PubMed] [Google Scholar]
- Nicolas P., Mondot S., Achaz G., Bouchenot C., Bernardet J. F., Duchaud E. (2008). Population structure of the fish-pathogenic bacterium Flavobacterium psychrophilum. Appl. Environ. Microbiol. 74, 3702–3709. 10.1128/AEM.00244-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nilsen H., Sundell K., Duchaud E., Nicolas P., Dalsgaard I., Madsen L., et al. (2014). Multilocus sequence typing identifies epidemic clones of Flavobacterium psychrophilum in Nordic countries. Appl. Environ. Microbiol. 80, 2728–2736. 10.1128/AEM.04233-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Niu C., Gilbert E. S. (2004). Colorimetric method for identifying plant essential oil components that affect biofilm formation and structure. Appl. Environ. Microbiol. 70, 6951–6956. 10.1128/AEM.70.12.6951-6956.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ostland V., Byrne P., Hoover G., Ferguson H. (2000). Necrotic myositis of rainbow trout, Oncorhynchus mykiss (Walbaum): proteolytic characteristics of a crude extracellular preparation from Flavobacterium psychrophilum.Necrotic myositis of rainbow trout, Oncorhynchus mykiss (Walbaum): proteolytic characteristics of a crude extracellular preparation from Flavobacterium psychrophilum. J. Fish Dis. 23, 329–336. 10.1046/j.1365-2761.2000.00251.x [DOI] [Google Scholar]
- Papadopoulou A., Dalsgaard I., Lindén A., Wiklund T. (2017). In vivo adherence of Flavobacterium psychrophilum to mucosal external surfaces of rainbow trout (Oncorhynchus mykiss) fry. J. Fish Dis. 40, 1309–1320. 10.1111/jfd.12603 [DOI] [PubMed] [Google Scholar]
- Papadopoulou A., Howell A., Wiklund T. (2015). Inhibition of Flavobacterium psychrophilum adhesion in vitro. FEMS Microbiol. Lett. 362:fnv203. 10.1093/femsle/fnv203 [DOI] [PubMed] [Google Scholar]
- Pérez-Pascual D., Gómez E., Álvarez B., Méndez J., Reimundo P., Navais R., et al. (2011). Comparative analysis and mutation effects of fpp2-fpp1 tandem genes encoding proteolytic extracellular enzymes of Flavobacterium psychrophilum. Microbiology 157(Pt 4), 1196–1204. 10.1099/mic.0.046938-0 [DOI] [PubMed] [Google Scholar]
- Pérez-Pascual D., Gómez E., Guijarro J. A. (2015). Lack of a type-2 glycosyltransferase in the fish pathogen Flavobacterium psychrophilum determines pleiotropic changes and loss of virulence. Vet. Res. 46:1. 10.1186/s13567-014-0124-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pérez-Pascual D., Menéndez A., Fernández L., Méndez J., Reimundo P., Navais R., et al. (2009). Spreading versus biomass production by colonies of the fish pathogen Flavobacterium psychrophilum: role of the nutrient concentration. Int. Microbiol. 12, 207–214. 10.2436/20.1501.01.100 [DOI] [PubMed] [Google Scholar]
- Quillet E., Dorson M., Le Guillou S., Benmansour A., Boudinot P. (2007). Wide range of susceptibility to rhabdoviruses in homozygous clones of rainbow trout. Fish Shellfish Immunol. 22, 510–519. 10.1016/j.fsi.2006.07.002 [DOI] [PubMed] [Google Scholar]
- Rhodes R. G., Pucker H. G., McBride M. J. (2011a). Development and use of a gene deletion strategy for Flavobacterium johnsoniae to identify the redundant gliding motility genes remF, remG, remH, and remI. J. Bacteriol. 193, 2418–2428. 10.1128/JB.00117-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rhodes R. G., Samarasam M. N., Shrivastava A., van Baaren J. M., Pochiraju S., Bollampalli S., et al. (2010). Flavobacterium johnsoniae gldN and gldO are partially redundant genes required for gliding motility and surface localization of SprB. J. Bacteriol. 192, 1201–1211. 10.1128/JB.01495-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rhodes R. G., Samarasam M. N., Van Groll E. J., McBride M. J. (2011b). Mutations in Flavobacterium johnsoniae sprE result in defects in gliding motility and protein secretion. J. Bacteriol. 193, 5322–5327. 10.1128/JB.05480-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rochat T., Barbier P., Nicolas P., Loux V., Pérez-Pascual D., Guijarro J. A., et al. (2017a). Complete genome sequence of Flavobacterium psychrophilum strain OSU THCO2-90, used for functional genetic analysis. Genome Announc. 5:e01665-16. 10.1128/genomeA.01665-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rochat T., Fujiwara-Nagata E., Calvez S., Dalsgaard I., Madsen L., Calteau A., et al. (2017b). Genomic characterization of Flavobacterium psychrophilum serotypes and development of a multiplex PCR-based serotyping scheme. Front. Microbiol. 8:1752. 10.3389/fmicb.2017.01752 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sato K., Naito M., Yukitake H., Hirakawa H., Shoji M., McBride M. J., et al. (2010). A protein secretion system linked to bacteroidete gliding motility and pathogenesis. Proc. Natl. Acad. Sci. U.S.A. 107, 276–281. 10.1073/pnas.0912010107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sato K., Yukitake H., Narita Y., Shoji M., Naito M., Nakayama K. (2013). Identification of Porphyromonas gingivalis proteins secreted by the Por secretion system. FEMS Microbiol. Lett. 338, 68–76. 10.1111/1574-6968.12028 [DOI] [PubMed] [Google Scholar]
- Shrivastava A., Berg H. C. (2015). Towards a model for Flavobacterium gliding. Curr. Opin. Microbiol. 28, 93–97. 10.1016/j.mib.2015.07.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shrivastava A., Johnston J. J., van Baaren J. M., McBride M. J. (2013). Flavobacterium johnsoniae GldK, GldL, GldM, and SprA are required for secretion of the cell surface gliding motility adhesins SprB and RemA. J. Bacteriol. 195, 3201–3212. 10.1128/JB.00333-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shrivastava A., Lele P. P., Berg H. C. (2015). A rotary motor drives Flavobacterium gliding. Curr. Biol. 25, 338–341. 10.1016/j.cub.2014.11.045 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shrivastava A., Rhodes R. G., Pochiraju S., Nakane D., McBride M. J. (2012). Flavobacterium johnsoniae RemA is a mobile cell surface lectin involved in gliding. J. Bacteriol. 194, 3678–3688. 10.1128/JB.00588-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Siekoula-Nguedia C., Blanc G., Duchaud E., Calvez S. (2012). Genetic diversity of Flavobacterium psychrophilum isolated from rainbow trout in France: predominance of a clonal complex. Vet. Microbiol. 161, 169–178. 10.1016/j.vetmic.2012.07.022 [DOI] [PubMed] [Google Scholar]
- Simon R., Priefer U., Puhler A. (1983). A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Nat. Biotechnol. 1, 784–791. 10.1038/nbt1183-784 [DOI] [Google Scholar]
- Starliper C. E. (2011). Bacterial coldwater disease of fishes caused by Flavobacterium psychrophilum. J. Adv. Res. 2, 97–108. 10.1016/j.jare.2010.04.001 [DOI] [Google Scholar]
- Strepparava N., Wahli T., Segner H., Petrini O. (2014). Detection and quantification of Flavobacterium psychrophilum in water and fish tissue samples by quantitative real time PCR. BMC Microbiol. 14, 105. 10.1186/1471-2180-14-105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sundell K., Wiklund T. (2011). Effect of biofilm formation on antimicrobial tolerance of Flavobacterium psychrophilum. J. Fish Dis. 34, 373–383. 10.1111/j.1365-2761.2011.01250.x [DOI] [PubMed] [Google Scholar]
- Tomek M. B., Neumann L., Nimeth I., Koerdt A., Andesner P., Messner P., et al. (2014). The S-layer proteins of Tannerella forsythia are secreted via a type IX secretion system that is decoupled from protein O-glycosylation. Mol. Oral Microbiol. 29, 307–320. 10.1111/omi.12062 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Van Vliet D., Wiens G. D., Loch T. P., Nicolas P., Faisal M. (2016). Genetic diversity of Flavobacterium psychrophilum Isolates from three Oncorhynchus spp. in the United States, as revealed by multilocus sequence typing. Appl. Environ. Microbiol. 82, 3246–3255. 10.1128/AEM.00411-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wiens G. D., LaPatra S. E., Welch T. J., Rexroad C., Call D. R., Cain K. D., et al. (2014). Complete genome sequence of Flavobacterium psychrophilum strain CSF259-93, used to select rainbow trout for increased genetic resistance against bacterial cold water disease. Genome Announc. 2:e00889-14. 10.1128/genomeA.00889-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu A. K., Kropinski A. M., Lumsden J. S., Dixon B., MacInnes J. I. (2015). Complete genome sequence of the fish pathogen Flavobacterium psychrophilum ATCC 49418(T.). Stand. Genomic Sci. 10:3. 10.1186/1944-3277-10-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang H., Chen J., Yang G., Zhang X. H., Li Y. (2007). Mutational analysis of the zinc metalloprotease EmpA of Vibrio anguillarum. FEMS Microbiol. Lett. 267, 56–63. 10.1111/j.1574-6968.2006.00533.x [DOI] [PubMed] [Google Scholar]
- Zhang X., Paganelli F. L., Bierschenk D., Kuipers A., Bonten M. J., Willems R. J., et al. (2012). Genome-wide identification of ampicillin resistance determinants in Enterococcus faecium. PLoS Genet. 8:1002804. 10.1371/journal.pgen.1002804 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou Z. J., Sun B. G., Sun L. (2015). Edwardsiella tarda Sip1: a serum-induced zinc metalloprotease that is essential to serum resistance and host infection. Vet. Microbiol. 177, 332–340. 10.1016/j.vetmic.2015.03.030 [DOI] [PubMed] [Google Scholar]
- Zhu Y., McBride M. J. (2014). Deletion of the Cytophaga hutchinsonii type IX secretion system gene sprP results in defects in gliding motility and cellulose utilization. Appl. Microbiol. Biotechnol. 98, 763–775. 10.1007/s00253-013-5355-2 [DOI] [PubMed] [Google Scholar]
- Zhu Y., McBride M. J. (2016). Comparative analysis of Cellulophaga algicola and Flavobacterium johnsoniae gliding motility. J. Bacteriol. 198, 1743–1754. 10.1128/JB.01020-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.




