Skip to main content
NCBI home page
Journal of Interferon & Cytokine Research logoLink to Journal of Interferon & Cytokine Research
. 2017 Nov 1;37(11):503–512. doi: 10.1089/jir.2017.0050

First Study on Interferon Regulatory Factor in Sturgeon: Expression Pattern of Interferon Regulatory Factor in Dabry's Sturgeon Acipenser dabryanus

Youshen Li 1,,*, Shuhuan Zhang 2,,*, Kai Luo 1, Lihai Xia 1, Wei Hu 1, Guangming Tian 1, Zhitao Qi 1, Qiaoqing Xu 1,✉, Qiwei Wei 2,✉
PMCID: PMC5689120  PMID: 29135372

Abstract

Interferon regulatory factors (IRFs) are crucial regulators in initiating the host innate immune response against pathogen invasions. Dabry's sturgeon (Acipenser dabryanus) is particularly a valuable fish species found in the Yangtze River, China for which there is scarce immunological data. In the present study, we investigated the expression profile of sturgeon IRF genes. All adIRFs were composed of 8 exons and 7 introns, except adIRF1, which possessed 9 exons interrupted by 8 introns. Moreover, the predicted protein sequence has a DNA-binding domain (DBD) sharing high identity with spotted gar (Lepisosteus oculatus). Regarding the expression patterns, 5 adIRF genes were found to be constitutively expressed in all tissues examined, and were significantly higher in lymphoid organs (eg, blood, kidney, intestine, and spleen). Following Aeromonas hydrophila infection, the expression of adIRF1 and adIRF3 were upregulated in the spleen and caudal kidney, while both the adIRF5 and adIRF8 genes were downregulated in caudal kidney. In addition, adIRF4 was significantly upregulated at 3 h postinfection by A. hydrophila in the spleen and caudal kidney. These results suggest that adIRFs are related to the immune response to bacterial infection, which will help clarify the function of these IRFs and provide a fundamental basis for protecting the Dabry's sturgeon.

Keywords: : Dabry's sturgeon (Acipenser dabryanus), interferon regulatory factors (IRFs), expression

Introduction

Since the first interferon regulatory factor (IRF1) was identified as a protein which binds to the cis–acting DNA elements of the IFN-β gene, 9 IRF family members have been identified in mammals, 10 in birds, and 11 in fish (Huang and others 2010, 2015; Feng and others 2015). Previous research has found that IRFs are transcription mediators of virus-, bacteria-, and IFN-induced signaling pathways and thus play a critical role in antiviral defense, the immune response, as well as the regulation of cell growth and apoptosis (Paun and Pitha 2007). Structurally, all members of the IRF family contain a significant homology DNA-binding domain (DBD) in the N-terminal constituted by the first 115 − 120 amino acids, displaying a unique helix-turn-helix structure (Escalante and others 1998; Battistini 2009). Furthermore, each IRF possesses a characteristic IRF association domain (IAD) at the carboxyl terminus which mediates their interactions with other proteins to form transcriptional complexes (Yabu and others 1998). Remarkably, 2 types of association modules have been identified within the IAD domain: (1) IAD1, which is conserved in all IRFs but IRF1 and IRF2; and (2) IAD2, which is found only in IRF1 and IRF2 (Mamane and others 1999; Taniguchi and others 2001; Savitsky and others 2010). In addition, IRF proteins also contain a variety of functional domains, such as the transcription activation domain, transcriptional repression domain, constitutive activation domain, virus activation domain, serine-rich structure domain, and nuclear localization signal (Hiscott 2007; Jia and Guo 2008).

IRF proteins can be divided into 3 categories based on functionality: (1) transcriptional activators (eg, IRF1, IRF3, IRF5, IRF9, and IRF10); (2) repressors (eg, IRF8); and (3) some (eg, IRF2, IRF4, and IRF7) also exert both functions (Huang and others 2010). For instance, IRF1 of zebrafish (Danio rerio) can bind to several IFN promoters through various mechanisms and selectively activate IFNs via myeloid differentiation factor 88- (MyD88-) dependent signaling pathways (Liao and others 2016); IRF3, in some cases, cooperates with IRF1 to activate transcription (Savitsky and others 2010); IRF4 mediates the immune response by activating the expression of other genes during cell differentiation (Ai and others 2017). On the contrary, IRF4 competes with IRF5 binding to MyD88, thereby negatively regulating toll-like receptor (TLR)-mediated inflammatory responses (Ai and others 2017); however, IRF5 positively regulates TLR-dependent signaling when bound to MyD88 (Negishi and others 2005).

Dabry's sturgeon (Acipenser dabryanus), is particularly a valuable fish species found in the Yangtze River, China and has been added to “the list of endangered wild animals” by the United Nations. To date, there are no existing reports of IRFs in Dabry's sturgeon; however, research into the interferon system of Dabry's sturgeon is significant for both disease prevention and treatment, as well as research and development into novel drugs. Consequently, the genomic structure and the tissue distribution of (ad)IRF1, IRF3, IRF4, IRF5, and IRF8 genes in Dabry's sturgeon were performed in this study. Moreover, we assessed the expression pattern of the adIRF1, adIRF3, adIRF4, adIRF5, and adIRF8 genes following Aeromonas hydrophila challenge.

Materials and Methods

Experimental fish and bacterium

Dabry's sturgeon (A. dabryanus) juveniles (32–37 g) were donated by the Yangtze River Fisheries Research Institute (YFI), Chinese Academy of Fishery Sciences. The fish were maintained in aerated water tanks at 25°C for 1 week to ensure that the animals were healthy before sampling. A virulent strain of A. hydrophila named H2 (GenBank Accession NO: MF399208) was isolated and identified from diseased Chinese sturgeon (A. sinensis) in a previous study and was stored in YFI.

Cloning of cDNA and genomic DNA sequences

cDNA samples were prepared from the head kidney with the First-Strand cDNA Synthesis Kit (Fermentas, Canada). DNA samples were isolated from the muscle using a standard phenol/chloroform extraction method. First, degenerate primers (Table 1) were used for PCR amplification of the internal region of adIRF1, adIRF3, adIRF4, adIRF5, and adIRF8 obtained from the cDNA samples. PCR products were respectively isolated using a Gel Extraction Kit (Tiangen, China), cloned into a pMD18-T vector (TaKaRa, Japan), and transformed into Escherichia coli strain DH5α competent cells. The putative clones were then screened via PCR using the aforementioned primers, and the selected clones were sequenced.

Table 1.

Primers Used for cDNA and Genomic DNA Clone

Primer name Sequence (5′-3′) Usage
IRF1-YZ-F/R CCTGTTTCAAGAACGCGCATG/CTGCAGGCAGGCAACGGGT cDNA cloning
IRF3-YZ-F/R ACTTCATCGAAACCCCTCAT/GCTCGTGTCCATACTCTCATA cDNA cloning
IRF4-YZ-F/R ATGAATTTAGACAGTGACTGCAGC/TTCTTGGATGGAAGGGTGCA cDNA cloning
IRF5-YZ-F/R ATGAGTCTCCAGCCACGACG/GTGGAGGTCAGGTTGCTGCA cDNA cloning
IRF8-YZ-F/R ATGACTGACAGAAACCCTGGTG/TACAGTAATCTGCTGAATTTCACG cDNA cloning
IRF1-intron-F1/R1 CCTGTTTCAAGAACGCGCATG/AAGCGTCTTTGTCCAAGTCCCAT First intron cloning
IRF1-intron-F2/R2 ACGCTTGCCTTTTCAAACAGTG/TGTCTGGGAGAGAGTTCATTGC Second intron cloning
IRF1-intron-F3/R3 GACTGTAACAAACCAGACCCGA/CTCCATTCTGAGGGCACACTAA Third, fourth, and fifth intron cloning
IRF1-intron-F4/R4 CCAAGTGTCCCCCTTACCCA/CTGCAGGCAGGCAACGGGT Sixth, seventh, and eighth intron cloning
IRF3-intron-F1/R1 ACTTCATCGAAACCCCTCAT/ACGACCGCTCGCTACCGC First intron cloning
IRF3-intron-F2/R2 GGGCGGTAGCGAGCGGTC/TCCACTTCAGGTTCATAACGAG Second intron cloning
IRF3-intron-F3/R3 CTCGTTATGAACCTGAAGTGGA/AAGTGAGTGGTCAGTCTGTTGTG Third, fourth, and fifth intron cloning
IRF3-intron-F4/R4 ACCCCTCCCCCTTGCTTGATA/GCTCGTGTCCATACTCTCATA Sixth and seventh intron cloning
IRF4-intron-F1/R1 AGTGGCTGATTGAACAGATTGAC/TGACTTCTTTCCACCATTTCCT First intron cloning
IRF4-intron-F2/R2 AATGACTTTGAGGAAATGGTGGA/TAGTGTAGCCAAGCGAGTTCATA Second intron cloning
IRF4-intron-F3/R3 TGAACTCGCTTGGCTACACTATG/GTAAGGCATTTCAGAGTGAGGCT Third intron cloning
IRF4-intron-F4/R4 CGTAACTGGAGGGAGTATGAGCA/GAAACGGGTAGGGGAAAATGAC Fourth and fifth intron cloning
IRF4-intron-F5/R5 GTCATTTTCCCCTACCCGTTTC/TTCTTGGATGGAAGGGTGCA Sixth and seventh intron cloning
IRF5-intron-F1/R1 ATGAGTCTCCAGCCACGACG/CGCAGGTTCGCTTTCCACTT First intron cloning
IRF5-intron-F2/R2 AAGTGGAAAGCGAACCTGCG/GTATGTTCTGGCAAAGGGAAGTT Second, third, and fourth intron cloning
IRF5-intron-F3/R3 AACTTCCCTTTGCCAGAACATAC/CACTGGCAAAGGCGTATGGCAT Fifth intron cloning
IRF5-intron-F4/R4 ATGCCATACGCCTTTGCCAGTG/CACTGCCCTTGAGTCTGTTGGTTC Sixth and seventh intron cloning
IRF8-intron-F1/R1 TGTGGGAAAATGAAGAGAAAACC/TGTTCAAAGCACAGCGAAGCCTC First intron cloning
IRF8-intron-F2/R2 GCTTTGAACAAGAGCCCCGACT/GCAGGGGGGAACTTCACATT Second, third, fourth, and fifth intron cloning
IRF8-intron-F3/R3 CGCAGTAACCGTGAGGGCAT/TACAGTAATCTGCTGAATTTCACG Sixth and seventh intron cloning
Open in a new tab

Sequence analysis

First, the open reading frame (ORF) of the genes was predicted using ORF Finder (www.bioinformatics.org/sms/orf find.html). The prediction of the amino acid sequences was performed using a translate program in ExPASy (http://web.expasy.org/translate). The physicochemical properties of the deduced proteins were analyzed via ProtParam (http://web.expasy.org/protparam). The exon–intron structure was determined by aligning the cDNA sequences to the genomic DNA sequence using the web-based tool, Clustal Omega (www.ebi.ac.uk/Tools/msa/clustalo/).The phylogenetic tree was constructed using amino acid multiple alignment and the neighbor-joining method within the MEGA6 program with the JTT matrix-based model. The degree of confidence for each branch point was determined by bootstrap analysis (1,000 times).

Tissue distribution and immune challenges

To examine the expression pattern in different tissues, 9 healthy Dabry's sturgeon were sacrificed, and 12 tissues (gills, skin, muscle, liver, spleen, head kidney, caudal kidney, intestine, eye, brain, heart, and blood) were removed for RNA extraction. To evaluate the immune responses of adIRF1, adIRF3, adIRF4, adIRF5, and adIRF8, the fish held at 25°C were randomly divided into 2 groups: one group was intraperitoneally injected with 200 μL A. hydrophila suspension with PBS (1.9 × 109cfu/mL), and the other group was intraperitoneally injected with 200 μL PBS (0.1 mol/mL, pH = 7.2) per gram body weight as a control. Four individuals were sampled at 3, 12, 24, and 36 h postinjection (hpi) on each occasion, with the caudal kidney and spleen removed, using the primers of A. hydrophila virulence gene (Ai and others, 2015) to verify the disease caused by H2 (Fig. 1).

FIG. 1.

FIG. 1.

Open in a new tab

PCR amplification by primers of Aeromonas hydrophila virulence gene. M: DL2000DNA Marker; 1: PCR product; 2: positive control; 3: negative control.

Real-time quantitative polymerase chain reaction

The tissues and organs described earlier were used for total RNA extraction, and the cDNA samples were prepared using the First-Strand cDNA Synthesis Kit (Fermentas, Canada). The specific primers were designed to detect the corresponding gene expression (Table 2) and pretested to ensure that each primer pair could not amplify the genomic DNA using real-time quantitative polymerase chain reaction (qRT-PCR). The KAPA SYBR® FAST qPCR Master Mix (KAPA BIOSYSTEMS) and a Step-one Plus real-time PCR system (ABI) were used to measure the expression of adIRFs as described previously (Xu and others, 2010; 2014a, 2014b). Dabry's sturgeon β-actin was amplified with the same qRT-PCR temperature profile for use as the internal reference. The total reaction mixture and reaction procedure for qRT-PCR were performed as described previously (Xu and others 2010, 2014a).

Table 2.

Primers Used for Real-Time Quantitative Polymerase Chain Reaction

Primer name Sequence (5′-3′) GenBank accession No.
IRF1 CCACAGCCGACAGCACAAAC/TCAGGAAACCTTTGCCATTA KY624489
IRF3 ACCCCTCCCCCTTGCTTGATA/GGTTGGTGTTGTAAATCTCCG KY624490
IRF4 AGTGGCTGATTGAACAGATTGAC/TGACTTCTTTCCACCATTTCCT KY624491
IRF5 TGTATCAGAAAGGAGAAACTAACG/CACTGCCCTTGAGTCTGTTGGTTC KY624492
IRF8 GTCTTAGGCAGTGGCTGATTGAG/GATTTCCTGGTTGTAGTCCTGTT KY624493
β-actin CCTTCTTGGGTATGGAATCTTGC/CAGAGTATTTACGCTCAGGTGGG MF536662
Open in a new tab

Statistical analysis

Statistical analysis was performed using SPSS 21.0 software. A one way-analysis of variance (ANOVA) followed by the LSD post hoc test was used to analyze the induction expression data. Differences were considered to be significant at P < 0.05, P < 0.01, or P < 0.001, respectively.

Results

Molecular cloning and characterization of adIRFs

In this study, we cloned the ORF of adIRF1, adIRF3, adIRF4, adIRF5, and adIRF8 that consist of 978 bp, 1,335 bp, 1,341 bp, 1,356 bp, and 1,299 bp, respectively. Each cDNA sequence encodes a protein composed of 316, 445, 447, 452, and 433 amino acids residues, respectively, and the physicochemical properties of the proteins encoded by these 5 adIRF genes have been summarized in Table 3.

Table 3.

The Physicochemical Properties of Dabry's Sturgeon IRFs Protein

Features adIRF1 adIRF3 adIRF4 adIRF5 adIRF8
ORF (bp) 978 1335 1341 1356 1299
Molecular weight (kilodalton, kDa) 79808.31 49764.92 51683.46 56597.35 49901.32
Theoretical pI 5.06 5.27 6.21 5.41 5.88
Open in a new tab

Similar to the IRF genes of other vertebrates, the deduced amino acid sequences of adIRF1, adIRF3, adIRF4, adIRF5, and adIRF8 contain the DBD in the N-terminal, which is characterized by 5 tryptophan repeats. The sequence of the putative adIRF protein is highly similar to that of other species, ranging from 54.0% to 94.8% (Table 4); however, the most similar species to possess the DBD domain in the 5 adIRF proteins is spotted gar, with 78.6%, 67.3%, 92.0%, 88.7%, and 94.8% sequence identity, respectively (Table 4).

Table 4.

Identity Comparison Between Teleost Interferon Regulatory Factor Proteins

    Identity (%)
    DBD Whole length
Molecule Species Human Spotted gar Dabry's sturgeon Human Spotted gar Dabry's sturgeon
IRF1 Dabry's sturgeon 71.4 76.8   39.0 43.7  
  Spotted gar 82.3   76.8 44.1   43.7
  Frog 85.8 77.0 70.5 53.3 43.0 36.3
  Chicken 91.2 82.3 75.0 59.4 44.7 39.3
  Human   82.3 71.4   44.1 39.0
IRF3 Dabry's sturgeon 54.0 67.3   33.3 46.1  
  Spotted gar 47.8   67.3 34.2   46.1
  Frog 51.3 50.4 54.0 31.1 33.3 35.7
  Human   47.8 54.0   34.2 33.3
IRF4 Dabry's sturgeon 77.0 92.0        
  Spotted gar 83.2   92.0 67.3 81.4  
  Frog 84.1 85.8 81.4 70.6   81.4
  Chicken 91.7 89.9 81.7 83.6 71.5 69.0
  Human   83.2 77.0   70.6 67.3
IRF5 Dabry's sturgeon 68.1 88.7   54.3 75.7  
  Spotted gar 71.7   88.7 54.6   75.7
  Frog 69.9 74.5 76.1 58.6 53.8 56.3
  Chicken 64.7 63.2 61.1 57.0 50.4 49.8
  Human   71.7 68.1   54.6 54.3
IRF8 Dabry's sturgeon 88.6 94.8   60.6 80.8  
  Spotted gar 90.4   94.8 62.4   80.8
  Chicken 97.4 89.5 89.5 73.9 60.7 60.2
  Human   90.4 88.6   62.4 60.6
Open in a new tab

DBD, DNA-binding domain.

To verify the 5 adIRF genes, a phylogenetic tree was constructed (Fig. 2). The IRF family can be divided into 4 subfamilies: (1) IRF1 subfamilies (contains IRF1 and IRF2); (2) IRF3 subfamilies (contains IRF3 and IRF7); (3) IRF4 subfamilies (contains IRF4, IRF8, IRF9, and IRF10); and (4) IRF5 subfamilies (contains IRF5 and IRF6). It is apparent that adIRF1 and adIRF5 were clustered in close proximity to Polyodon spathula IRF1 and IRF5, respectively, followed by those of other fish species. Although adIRF4 and adIRF8 were not clustered extremely close to P. spathula, they were closely related to spotted gar (Lepisosteus oculatus) IRF4 and IRF8, respectively. Moreover, adIRF3 was found to be equally distant to the IRF3 of both spotted gar and tilapia (Oreochromis spp) (Fig. 2).

FIG. 2.

FIG. 2.

Open in a new tab

A neighbor-joining phylogenetic tree of vertebrate IRF members. The tree was constructed using an amino acid multiple alignment and the neighbor-joining method within the MEGA6 program (Tamura and others, 2008). The evolutionary history was inferred by using the method based on the JTT matrix-based model. The percentage of trees in which the associated taxa clustered together is shown next to the branches based on 1,000 bootstrap. The accession number for each sequence was given after the common species name and molecular type. The Dabry's sturgeon IRF genes are shown in bold.

Genomic structure analysis of adIRFs

The genomic DNA and cDNA sequences were aligned using Clustal Omega. The adIRF1 gene contained a 9 exon and 8 intron structure, while that of adIRF3, adIRF4, adIRF5, and adIRF8 consisted of 8 exons interrupted by 7 introns (Fig. 3). An intron phase analysis revealed that the classes of adIRF1 introns 1, 4, and 7 to be in phase 0, leaving the others in phase 1 (Fig. 3). In addition, the first, third, and last introns of adIRF3, adIRF4, adIRF5, and adIRF8 were in phase 0, while all other introns were in phase 1 (Fig. 3).

FIG. 3.

FIG. 3.

Open in a new tab

Schematic diagrams of exon–intron structure of adIRF genes in Dabry's sturgeon. Boxes represent exons, and horizontal lines connecting exons represent introns. The number in the box represents the nucleotide length (base pairs). The intron phase is indicated under the bar.

Tissue distribution

To examine the tissue distribution pattern of IRF1, IRF3, IRF4, IRF5, and IRF8 in Dabry's sturgeon, the in vivo expression level of these adIRFs were quantified using real-time PCR. The results revealed that these 5 genes were constitutively expressed in all 12 tissues obtained from healthy fish (Fig. 4). In addition, all these genes were highly expressed in the blood, especially adIRF1. Similar to adIRF1, adIRF5 appeared to exhibit a high level of expression in the blood, followed by the skin, rather than the head kidney; however, adIRF1, adIRF3, adIRF4, and adIRF8 were expressed at moderate or very low levels. adIRF3 was highly expressed in all tissues. In the adIRF4 subfamily, adIRF4 was highly expressed in the blood, spleen, caudal kidney, and heart, while adIRF8 was predominantly detected in the liver, followed by the spleen and caudal kidney.

FIG. 4.

FIG. 4.

Open in a new tab

Tissue distribution of IRF in Dabry's sturgeon. I, SP, BR, HK, M, L, E, SK, G, CK, BL, and H represent the intestine, spleen, brain, head kidney, muscle, liver, eye, skin, gill, caudal kidney, blood, and heart, respectively.

Gene expression of adIRFs in response to A. hydrophila challenge

To further investigate the different patterns of adIRF1, adIRF3, adIRF4, adIRF5, and adIRF8, the expression level induced in response to A. hydrophila challenge was examined. We found that A. hydrophila stimulation upregulated adIRF1 expression in the spleen (3.11-fold; P < 0.05) and the caudal kidney (7.63-fold; P < 0.01) tissue at 36 hpi and 3 hpi, respectively (Fig. 5). Similarly, the expression of adIRF3 was found to be upregulated in the spleen at 3 hpi (3.00-fold; P < 0.05) and 24 hpi (32.65-fold; P < 0.01), as well as the caudal kidney at 36 hpi (4.07-fold; P < 0.01). While the expression of both adIRF5 and adIRF8 genes were downregulated in the caudal kidney at 24 hpi (P < 0.05), it was not affected or increased in the spleen following treatment with A. hydrophila (Fig. 5). For adIRF4, the expression was significantly upregulated at 3 hpi following A. hydrophila exposure in the spleen (P < 0.01) and caudal kidney (P < 0.01) (Fig. 5).

FIG. 5.

FIG. 5.

Open in a new tab

Gene expression of adIRFs in response to A. hydrophila challenges. The expression was normalized to β-actin and is presented as fold-change with compared respective controls. The data are presented as mean SD (n = 4). Statistical comparison of the RNA levels detected at different time points was carried out by the one way-analysis of variance. *P < 0.05, **P < 0.01, ***P < 0.001.

Discussion

IRFs are critical regulators of the immune response and immune cell development, and abnormalities in IRF expression and function have been increasingly linked to numerous diseases (Zhao and others 2015). Further information on the IRFs from lower vertebrates will aid our understanding of the mechanisms of innate and adaptive immunity. In this study, we identified and characterized the structure, mRNA tissue distribution, and gene expression of adIRF1, adIRF3, adIRF4, adIRF5, and adIRF8 from Dabry's sturgeon. Using PCR-based techniques, the cDNA and genomic DNA sequences were obtained.

Phylogenetically, all of the investigated genes were clustered into one group with the corresponding genes from other teleosts, and were found to share the closest relationship with P. spathula (IRF1 and IRF5) and spotted gar (IRF3, IRF4 and IRF8). Structurally, similar to other species, adIRF1, adIRF3, adIRF4, adIRF5, and adIRF8 contain a DBD in the N-terminus. The DBD is typical of all IRF members, which forms a helix-turn-helix structure responsible for binding to the interferon-stimulated response element (IRSE)/interferon regulatory factor-binding element (IRF-E) consensus in the target promoters (Xia and others 2012). The DBD domain of adIRFs share high sequence similarity with other species, ranging from 54.0% to 94.8%, with 67.3% to 94.8% shared with the spotted gar homologs. Furthermore, adIRF1 exhibited a 9 exon and 8 intron structure, while adIRF3, adIRF4, adIRF5, and adIRF8 consisted of 8 exons interrupted by 7 introns. The intron phases in adIRF1 consisted of introns 1, 4, and 7 in phase 0, introns 2, 3, 5, 6, and 8 in phase 1, and were well conserved in adIRF3, adIRF4, adIRF5, and adIRF8 with introns 1, 3, and 7 in phase 0, and introns 2, 4, 5, and 6 in phase 1. In previous studies, Huang and others (2010) indicated that IRF1 all had a 9 exon and 8 intron gene structure, except for zebrafish, for which only 8 exons were present; however, the number of exon–introns in IRF2 to IRF10 is not highly conserved from teleosts to mammals.

The tissue distribution analysis revealed that the adIRFs were strongly transcribed in lymphomyeloid-rich tissues (eg, spleen, head kidney, caudal kidney, liver, blood, and intestine) in Dabry's sturgeon. The adIRF1 expression pattern was high in blood, head kidney, caudal kidney, intestine, and spleen and is similar to the IRF1 expression patterns in mammalian and other fish species (Sun and others 2007; Shi and others 2010; Liu and others 2011; Xu and others 2015; Zhan and others 2016), with predominant expression in immune-related tissues. Unlike the expression profiles of mammalian IRF3 (Honda and Taniguchi 2006), our study demonstrates that adIRF3 was particularly expressed in the immune tissues where the lymphoid and myeloid cells are abundant; this finding is consistent with turbot, Japanese flounder, and Gadus macrocephalus (Hu and others 2011a, 2011b; Sun and others 2015). In previous studies, IRF4, known to be essential for the development and functionality of T and B cells, has been reported to be expressed only in lymphocytes (Marecki and others 1999; Holland and others 2010; Bathige and others 2012; Ai and others 2017). Nevertheless, IRF4 and IRF8 were strongly detected in both hematopoietic and lymphoid tissues, as well as some nonimmune tissues of Dabry's sturgeon. adIRF5 is highly expressed in the blood, head kidney, caudal kidney, and skin which exhibits a similar expression pattern to that observed for grass carp IRF5 (Xu and others 2010a), and turbot IRF5 (Xia and others 2012).

A. hydrophila is a gram-negative bacterium, which causes a hemorrhagic disease in most fish. To obtain further information regarding the role of adIRF genes for the treatment of bacterial infections, the expression pattern of adIRF genes following A. hydrophila challenge was performed in the present study. The results show that exposure to A. hydrophila upregulated the expression of both adIRF1 and adIRF3. In addition, IRF1 expression is known to be sensitive to viral and bacterial challenge (Yao and others 2010; Lu and others 2014; Xu and others 2015; Zhan and others 2016). In large yellow croaker (Pseudosciaena crocea), the expression profiles of IRF1 in blood, spleen, and liver increased after an injection of poly I:C (Yao and others 2010). Similarly, Vibrio anguillarum and A. hydrophila induced the upregulation of IRF1 expression in the blood, liver, kidney, and spleen of half-smooth tongue sole (Cynoglossus semilaevis) and blunt snout bream (Lu and others 2014; Zhan and others 2016), which is consistent with the findings for adIRF1. Although the expression changes vary in magnitude among different fish species, the IRF gene expression pattern exhibits a similar profile in the spleen and kidney. IRF3 in large yellow croaker did not demonstrate significant changes following V. parahemolyticus injection; however, IRF3 expression was significantly increased following an injection of LPS (Yao and others 2012). Thus, the authors considered that the differential levels of IRF3 expression in large yellow croaker between the LPS and bacteria injection groups might be attributed to the LPS content in the bacteria being too low to induce an immune response (Yao and others 2012). The upregulation of adIRF3 in response to A. hydrophila challenge in the present study is similar to that exhibited by IRF3 in the Asian swamp eel following infection with A. hydrophila (Zhan and others 2016). Therefore, we considered that the reason for this result may be attributed to a number of factors, including different bacterial concentrations and individual variability in the immune response. Although both IRF4 and IRF8 are members of the IRF4 subfamily, the expression patterns of adIRF4 and adIRF8 are not identical following A. hydrophila stimulation. In the current study, A. hydrophila challenge led to significant upregulation of adIRF4 in the caudal kidney and spleen; however, A. hydrophila downregulated adIRF8 expression in the caudal kidney. These findings indicate that adIRF4 and adIRF8 may play diverse roles in the antibacterial response, despite belonging to the same IRF subfamily. In rock bream, changes in IRF4 expression (upregulation or downregulation) began 3 h after E. tarada infection (Bathige and others 2012). Moreover, GCRV upregulated zebrafish IRF4a from 3 hpi, and SVCV upregulated zebrafish IRF4a from 6 hpi (Ai and others 2017). In addition, the expression of Asian swamp eel IRF4 was upregulated within 12 h following A. hydrophila infection, and lasted for up to 48 h (Xu and others 2014b). These findings indicate the IRF4 function in the early stage of bacterial or viral infection. In mammals, IRF5 is a key regulator of IFN-α and IFN-β expression, and the associated immune reaction is virus specific (Barnes and others 2001; Tamura and others 2008); however, in teleosts, the expression of IRF5 is only induced by both viruses and bacteria (Xu and others 2010b, 2015). In contrast to Grass carp (Xu and others 2010a) and Asian swamp eel IRF5 (Xu and others 2015), which are upregulated by Flavobacterium cloumnare and A. hydrophila, respectively, stimulation with A. hydrophila downregulated adIRF5 in the caudal kidney at 24 hpi. In addition, A. hydrophila upregulated Asian swamp eel IRF5 in vivo but induced little change in vitro (Xu and others 2015), suggesting that IRF5 may play different roles depending on the species or conditions.

In conclusion, we identified and characterized the structure, mRNA distribution, and gene expression of the adIRF1, adIRF3, adIRF4, adIRF5, and adIRF8 genes in this study. Five adIRFs were constitutively expressed in all 12 tissues from Dabry's sturgeon and exhibited particularly high expression in the immune tissues where the lymphoid and myeloid cells are abundant. While adIRF1 and adIRF3 were significantly upregulated in vivo following A. hydrophila infection, adIRF5 and adIRF8 were downregulated in the caudal kidney. Moreover, adIRF4 is upregulated in response to A. hydrophila challenge in both the spleen and caudal kidney. The results acquired in this study will provide a basis for elucidating the innate immune mechanisms in teleosts.

Acknowledgments

This research was financially supported by grants from the National Basic Research Program of China (973 Program) [grant number 2015CB150700] and from Key Laboratory of Freshwater Biodiversity Conservation, Ministry of Agriculture (LFBC0904).

Author Disclosure Statement

No competing financial interests exist.

References

  1. Ai K, Luo K, Li Y, Hu W, Gao W, Fang L, Tian G, Ruan G, Xu Q. 2017. Expression pattern analysis of IRF4 and its related genes revealed the functional differentiation of IRF4 paralogues in teleost. Fish Shellfish Immunol 60:59–64 [DOI] [PubMed] [Google Scholar]
  2. Ai K, Xu P, Zhou J, Wang J, Yang D, Xu Q. 2015. Establishment and application of multiplex PCR assay for detection of five freshwater bacterial species. Fisheries Sci 34(5):321–326 [Google Scholar]
  3. Barnes BJ, Moore PA, Pitha PM. 2001. Virus-specific activation of a novel interferon regulatory factor, IRF-5, results in the induction of distinct interferon alpha genes. J Biol Chem 276(26):23382–23390 [DOI] [PubMed] [Google Scholar]
  4. Bathige SD, Whang I, Umasuthan N, Lim BS, Park MA, Kim E, Park HC, Lee J. 2012. Interferon regulatory factors 4 and 8 in rock bream, Oplegnathus fasciatus: structural and expressional evidence for their antimicrobial role in teleosts. Fish Shellfish Immunol 33(4):857–871 [DOI] [PubMed] [Google Scholar]
  5. Battistini A. 2009. Interferon regulatory factors in hematopoietic cell differentiation and immune regulation. J Interferon Cytokine Res 29(12):765–780 [DOI] [PubMed] [Google Scholar]
  6. Escalante CR, Yie J, Thanos D, Aggarwal AK. 1998. Structure of IRF-1 with bound DNA reveals determinants of interferon regulation. Nature 391(6662):103–106 [DOI] [PubMed] [Google Scholar]
  7. Feng H, Zhang YB, Zhang QM, Li Z, Zhang QY, Gui JF. 2015. Zebrafish IRF1 regulates IFN antiviral response through binding to IFNφ1 and IFNφ3 promoters downstream of MyD88 signaling. J Immunol 194(3):1225–1238 [DOI] [PubMed] [Google Scholar]
  8. Hiscott J. 2007. Triggering the innate antiviral response through IRF-3 activation. J Biol Chem 282(21):15325–15329 [DOI] [PubMed] [Google Scholar]
  9. Holland JW, Karim A, Wang T, Alnabulsi A, Scott J, Collet B, Mughal MS, Secombes CJ, Bird S. 2010. Molecular cloning and characterization of interferon regulatory factors 4 and 8 (IRF-4 and IRF-8) in rainbow trout, Oncorhynchus mykiss. Fish Shellfish Immunol 29(1):157–166 [DOI] [PubMed] [Google Scholar]
  10. Honda K, Taniguchi T. 2006. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat Rev Immunol 6(9):644–658 [DOI] [PubMed] [Google Scholar]
  11. Hu GB, Xia J, Lou HM, Chen XL, Li J, Liu QM. 2011b. An IRF-3 homolog that is up-regulated by DNA virus and poly I:C in turbot, Scophthalmus maximus. Fish Shellfish Immunol 31(6):1224–1231 [DOI] [PubMed] [Google Scholar]
  12. Hu GB, Yin X, Lou H, Xia J, Dong X, Zhang J, Liu Q. 2011a. Interferon regulatory factor 3 (IRF-3) in Japanese flounder, Paralichthys olivaceus: sequencing, limited tissue distribution, inducible expression and induction of fish type I interferon promoter. Dev Comp Immunol 35(2):164–173 [DOI] [PubMed] [Google Scholar]
  13. Huang B, Qi ZT, Xu Z, Nie P. 2010. Global characterization of interferon regulatory factor (IRF) genes in vertebrates: glimpse of the diversification in evolution. BMC Immunol 11(1):22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Huang Y, Huang X, Cai J, OuYang Z, Wei S, Wei J, Qin Q. 2015. Identification of orange-spotted grouper (Epinephelus coioides) interferon regulatory factor 3 involved in antiviral immune response against fish RNA virus. Fish Shellfish Immunol 42(2):345–352 [DOI] [PubMed] [Google Scholar]
  15. Jia W, Guo Q. 2008. Gene structures and promoter characteristics of interferon regulatory factor 1 (IRF-1), IRF-2 and IRF-7 from snakehead Channa argus. Mol Immunol 45(8):2419–2428 [DOI] [PubMed] [Google Scholar]
  16. Liao Z, Wan Q, Su J. 2016. Bioinformatics analysis of organizational and expressional characterizations of the IFNs, IRFs and CRFBs in grass carp Ctenopharyngodon idella. Dev Comp Immunol 61:97–106 [DOI] [PubMed] [Google Scholar]
  17. Liu Y, Lu X, Luo YR, Zhou JP, Liu XY, Liu JF, Ding XD, Zhang Q. 2011. Molecular characterization and association analysis of porcine interferon regulatory factor 1 gene. Mol Biol Rep 38(3):1901–1907 [DOI] [PubMed] [Google Scholar]
  18. Lu Y, Wang Q, Liu Y, Shao C, Chen S, Sha Z. 2014. Gene cloning and expression analysis of IRF1 in half-smooth tongue sole (Cynoglossus semilaevis). Mol Biol Rep 41(6):4093–4101 [DOI] [PubMed] [Google Scholar]
  19. Mamane Y, Heylbroeck C, Genin P, Algarte M, Servant MJ, LePage C, DeLuca C, Kwon H, Lin R, Hiscott J. 1999. Interferon regulatory factors: the next generation. Gene 237(1):1–14 [DOI] [PubMed] [Google Scholar]
  20. Marecki S, Atchison ML, Fenton MJ. 1999. Differential expression and distinct functions of IFN regulatory factor 4 and IFN consensus sequence binding protein in macrophages. J Immunol 163(5):2713–2722 [PubMed] [Google Scholar]
  21. Negishi H, Ohba Y, Yanai H, Takaoka A, Honma K, Yui K, Matsuyama T, Taniguchi T, Honda K. 2005. Negative regulation of Toll-like-receptor signaling by IRF-4. Proc Natl Acad Sci U S A 102(44):15989–15994 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Paun A, Pitha PM. 2007. The IRF family, revisited. Biochimie 89(6–7):744–753 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Savitsky D, Tamura T, Yanai H, Taniguchi T. 2010. Regulation of immunity and oncogenesis by the IRF transcription factor family. Cancer Immunol Immunother 59(4):489–510 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Shi Y, Zhu XP, Yin JK, Zhang QY, Gui JF. 2010. Identification and characterization of interferon regulatory factor-1 from orange-spotted grouper (Epinephelus coioides). Mol Biol Rep 37(3):1483–1493 [DOI] [PubMed] [Google Scholar]
  25. Sun BJ, Chang MX, Song Y, Yao WJ, Nie P. 2007. Gene structure and transcription of IRF-1 and IRF-7 in the mandarin fish Siniperca chuatsi. Vet Immunol Immunopathol 116(1–2):26–36 [DOI] [PubMed] [Google Scholar]
  26. Sun H, Jiang ZQ, Jiang JL, Wen SH, Li X, Bao N, Su P, Mao MG. 2015. Cloning and expression analysis of IRF3 in Gadus macrocephalus using absolute quantitative PCR. J Fishery Sci China 5:887–895 [Google Scholar]
  27. Tamura T, Yanai H, Savitsky D, Taniguchi T. 2008. The IRF family transcription factors in immunity and oncogenesis. Annu Rev Immunol 26:535–584 [DOI] [PubMed] [Google Scholar]
  28. Taniguchi T, Ogasawara K, Takaoka A, Tanaka N. 2001. IRF family of transcription factors as regulators of host defense. Annu Rev Immunol 19:623–655 [DOI] [PubMed] [Google Scholar]
  29. Xia J, Hu GB, Dong XZ, Liu QM, Zhang SC. 2012. Molecular characterization and expression analysis of interferon regulatory factor 5 (IRF-5) in turbot, Scophthalmus maximus. Fish Shellfish Immunol 32(1):211–218 [DOI] [PubMed] [Google Scholar]
  30. Xu Q, Li R, Monte MM, Jiang Y, Nie P, Holland JW, Secombes CJ, Wang T. 2014a. Sequence and expression analysis of rainbow trout CXCR2, CXCR3a and CXCR3b aids interpretation of lineage-specific conversion, loss and expansion of these receptors during vertebrate evolution. Dev Comp Immunol 45(2):201–213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Xu Q, Wan J, Pan T, Zhou J, Ai K, Yang D. 2015. Antiviral genes in the Asian swamp eel Monopterus albus: comparison of tissue expression and inducible expression of six interferon regulatory factors. Genes Genomics 37(5):429–440 [Google Scholar]
  32. Xu QQ, Chang MX, Xiao FS, Huang B, Nie P. 2010a. The gene and virus-induced expression of IRF-5 in grass carp Ctenopharyngodon idella. Vet Immunol Immunopathol 134(3–4):269–278 [DOI] [PubMed] [Google Scholar]
  33. Xu QQ, Chang MX, Xiao FS, Li N, Nie P. 2010b. Expression characterization of interferon regulatory factor 5 (IRF-5) in grass carp Ctenopharyngodon idellus. Acta Hydrobiol Sin 34(6):1206–1210 [Google Scholar]
  34. Xu QQ, Yang DQ, Tuo R, Wan J, Chang MX, Nie P. 2014b. Gene cloning and induced expression pattern of IRF4 and IRF10 in the Asian swamp eel (Monopterus albus). Dongwuxue Yanjiu 35(5):380–388 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yabu T, Hirose H, Hirono I, Katagiri T, Aoki T, Yamamoto E. 1998. Molecular cloning of a novel interferon regulatory factor in Japanese flounder, Paralichthys olivaceus. Mol Mar Biol Biotechnol 7(2):138–144 [PubMed] [Google Scholar]
  36. Yao CL, Huang XN, Fan Z, Kong P, Wang ZY. 2012. Cloning and expression analysis of interferon regulatory factor (IRF) 3 and 7 in large yellow croaker, Larimichthys crocea. Fish Shellfish Immunol 32(5):869–878 [DOI] [PubMed] [Google Scholar]
  37. Yao CL, Kong P, Huang XN, Wang ZY. 2010. Molecular cloning and expression of IRF1 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 28(4):654–660 [DOI] [PubMed] [Google Scholar]
  38. Zhan FB, Liu H, Lai RF, Jakovlic I, Wang WB, Wang WM. 2016. Molecular identification and functional characterisation of the interferon regulatory factor 1 in the blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol 54:456–465 [DOI] [PubMed] [Google Scholar]
  39. Zhao GN, Jiang DS, Li H. 2015. Interferon regulatory factors: at the crossroads of immunity, metabolism, and disease. Biochim Biophys Acta 1852(2):365–378 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Interferon & Cytokine Research are provided here courtesy of Mary Ann Liebert, Inc.

RESOURCES