Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2017 Sep 12;292(46):18924–18936. doi: 10.1074/jbc.M117.811109

ZNF143 protein is an important regulator of the myeloid transcription factor C/EBPα

David Gonzalez ‡,§,1, Annouck Luyten ‡,1, Boris Bartholdy §,1, Qiling Zhou ‡, Miroslava Kardosova ¶,‖, Alex Ebralidze §, Kenneth D Swanson **, Hanna S Radomska §,***, Pu Zhang §, Susumu S Kobayashi §,**,2, Robert S Welner §,‡‡, Elena Levantini §,§§, Ulrich Steidl §,****, Gilbert Chong ‡, Samuel Collombet ‡, Min Hee Choi ‡, Alan D Friedman ¶¶, Linda M Scott ‖‖, Meritxell Alberich-Jorda ¶,‖,3, Daniel G Tenen ‡,§,4
PMCID: PMC5704476  PMID: 28900037

Abstract

The transcription factor C/EBPα is essential for myeloid differentiation and is frequently dysregulated in acute myeloid leukemia. Although studied extensively, the precise regulation of its gene by upstream factors has remained largely elusive. Here, we investigated its transcriptional activation during myeloid differentiation. We identified an evolutionarily conserved octameric sequence, CCCAGCAG, ∼100 bases upstream of the CEBPA transcription start site, and demonstrated through mutational analysis that this sequence is crucial for C/EBPα expression. This sequence is present in the genes encoding C/EBPα in humans, rodents, chickens, and frogs and is also present in the promoters of other C/EBP family members. We identified that ZNF143, the human homolog of the Xenopus transcriptional activator STAF, specifically binds to this 8-bp sequence to activate C/EBPα expression in myeloid cells through a mechanism that is distinct from that observed in liver cells and adipocytes. Altogether, our data suggest that ZNF143 plays an important role in the expression of C/EBPα in myeloid cells.

Keywords: CCAAT-enhancer-binding protein (C/EBP), gene regulation, hematopoiesis, promoter, transcription factor, C/EBPalpha, ZNF143

Introduction

Pluripotent hematopoietic stem cells are capable of differentiating along myeloid, erythroid, or lymphoid pathways (1), via intermediate, more lineage-restricted progenitor cells. Once a cell has committed to the myeloid pathway, it can further develop into either monocytic or granulocytic lineages. This stepwise differentiation process requires the concerted action of several TFs,5 and aberrant regulation by these TFs has been shown to play a role in leukemia (2–4). One of the critical TFs during myelopoiesis is C/EBPα, which is a member of the bZIP family of TFs. This family of proteins contains a leucine zipper domain that is important in protein dimerization and DNA binding (5). Six C/EBP family members have been identified thus far. These proteins share homology in the DNA-binding C terminus while diverging from each other within their N-terminal domain (6). C/EBPα is indispensable for inducing the granulocytic differentiation of myeloid progenitors (7–9) and for the acquisition and maintenance of adult hematopoietic stem cell quiescence (10). It does so by binding to and repressing genes involved in stem cell renewal and by activating the promoters of a myriad of genes involved in myeloid differentiation (11, 12). In line with these observations, defects in C/EBPα have been reported in ∼10% of patients with acute myeloid leukemia (13–15).

Although much is known about the general transcriptional machinery in eukaryotic cells, the events that are required for the transcription of specific genes that encode master controllers of differentiation, such as CEBPA, are not sufficiently understood. In human liver cell lines, C/EBPα was reported to autoregulate its promoter indirectly through an upstream stimulatory factor–binding site located at −268 bp relative to the transcription start site (TSS) (16). In addition to autoactivation, the murine Cebpa promoter also contains two repressive AP2 sites, one at −218 bp and the other in the 5′-untranslated region, and both sites must be occupied to fully suppress the transcription of C/EBPα (17).

Whereas most of the known regulatory regions within the CEBPA promoter have been described in hepatocytes or adipocytes, less is known about its regulation in hematopoietic cells. However, Runx1 was recently reported to activate the expression of C/EBPα by binding to a conserved site in the murine promoter and to a distal enhancer in hematopoietic cells (18). To further extend our knowledge with regard to myelopoiesis, we examined the proximal promoter of the human CEBPA gene in search of previously undescribed cis-regulatory elements. This analysis revealed a highly evolutionarily conserved 8-bp sequence in the CEBPA promoter that is crucial for its transcription. Using affinity chromatography, we were able to demonstrate that zinc finger protein 143 (ZNF143), a human homolog of Xenopus STAF (19, 20), bound this element. ZNF143 was previously shown to bind to >3000 non-coding RNAs and protein-coding genes genome-wide (21). Binding of ZNF143 to this conserved 8-bp regulatory sequence is crucial for the transcriptional activation of the CEBPA gene promoter in myeloid cells.

Results

Identification of a regulatory region essential for expression of C/EBPα in myeloid cells

To identify regulatory elements required for myeloid expression of human C/EBPα, we mapped the minimal promoter region necessary for gene expression in the immature myeloid cell line, U937. We performed transient transfections of luciferase reporter constructs to test the activity of a series of five deletion constructs extending from −2.2 kb to −78 bp relative to the TSS (Fig. 1A). We observed that most of the transactivation was directed by a region from −438 to −78 (Fig. 1B). Next, we tested a series of internal deletions within the P-438 promoter construct (Fig. 1C). High levels of activity were maintained upon deleting the sequences between positions −329 and −121 and between positions −250 and −121. However, a significant drop in reporter activity was observed upon deleting the sequence between positions −309 and −78 (Fig. 1D). Collectively, these data suggest the presence of one or more important regulatory elements that are located between −329 and −309 and/or between −121 and −78 of the human CEBPA promoter.

Figure 1.

Figure 1.

Identification of the promoter region essential for C/EBPα expression in myeloid cells. A, C, and E, schematic representation of the human CEBPA promoter and luciferase reporter constructs used to study CEBPA transcriptional activation. The numbers indicate the position of the 5′-end of each construct relative to the TSS at position +1. The rectangle labeled LUC represents the luciferase gene. A, luciferase map of CEBPA promoter fragments within −2200 bp relative to the TSS. C, deletion constructs within the 438-bp proximal promoter. Δ followed by a number designates the location of internal deletions shown in the schematics. E, deletion constructs within the 438-bp proximal promoter. B, D, and F, graphs depicting luciferase activity in U937 cells in relative luciferase units (RLU). Note that stepwise deletions demonstrate that the region between −110 and −95 is crucial for transcriptional activation. PXP1 is the empty vector. Error bars, S.D.

Next, we generated a series of deletions between −438 and −78 (Fig. 1E). Whereas a consistently high level of luciferase activity was observed from the P-438, P-121, and P-110 promoter constructs, of which the two latter lack the region between −328 and −306, a significant drop in activity was observed with deletion of the sequence between −110 and −95 (Fig. 1F). These findings indicate that a 116-bp region is sufficient to drive proximal promoter activity in U937 cells and also that the region between −110 and −78 is required for maximal gene transcription.

A specific DNA–protein interaction occurs between −112 and −88 of the CEBPA promoter

Based on our deletion studies, we hypothesized that a TF bound to the proximal promoter between −121 and −78. To further narrow down the binding region, we generated a series of overlapping double-stranded oligonucleotide probes (Fig. 2A) and performed EMSAs using nuclear extracts from U937 cells, which express C/EBPα. Probe II (−112 to −88; Fig. 2B, lanes 5–8) generated two complexes (lane 6) that could be outcompeted by a 100-fold excess of non-labeled (“cold”) specific self-probe (lane 7). These complexes could not be outcompeted by a cold nonspecific probe containing an SP1 site from the PU.1 promoter (lane 8). Probe I (−124 to −101) did not generate a specific shifted band on the gel (Fig. 2B, lane 2). Probe III (−96 to −71; lanes 9–12) generated a complex that could be partially outcompeted with excess unlabeled self-probe (lane 11) but also by the non-self-probe used as a negative control (lane 12), indicative of a nonspecific interaction. Probe II overlaps with portions of both probes I and III but has a unique core region. Given that this probe generated a complex of greater intensity and specificity, we concluded that a specific DNA–protein interaction does indeed occur within this region of the CEBPA promoter.

Figure 2.

Figure 2.

Protein binding to a conserved motif centered around −100 bp. A, schematic representation of the probes designed to pinpoint the region of the CEBPA promoter in which binding occurs. B, EMSAs of the region between positions −124 and −71 using the three overlapping probes (I, II, and III). Note that only probe II (lanes 5–8) generated two complexes that could be outcompeted by a 100-fold excess of unlabeled double-stranded self-oligonucleotide (lane 7). S, self-competitor (non-labeled probe); N, non-self-competitor (unrelated DNA probe). C, EMSA demonstrates binding in nine different cell lines when using probe II. Probe II alone and with self-competitor (S) are loaded as controls in lanes 1 and 3, respectively. D, presence of the conserved 8-base sequence “CCCAGCAG” (gray) shared with several C/EBP family members across different species (h, human; m, mouse; r, rat; c, chicken). The locations of the sequences relative to the TSS are indicated.

EMSA on eight other cell lines demonstrated a similar banding pattern (Fig. 2C), indicating that this factor is widely expressed. Two bands were observed in some cell lines. Given that the assay is performed under non-denaturing conditions, it is difficult to assess whether the probe is binding two different factors, the same factor with different protein modifications, or a single factor that is partially degraded.

A highly conserved 8-bp element within the proximal promoter of different C/EBPs is essential for promoter activation

The results obtained in the luciferase assays and EMSA experiments strongly suggested the presence of an important regulatory region between −112 and −88 upstream of the human CEBPA TSS. Therefore, we examined its sequence conservation between different species. We identified an octameric sequence motif (CCCAGCAG) that was fully conserved among human, mouse, rat, and chicken CEBPA proximal promoters (Fig. 2D). In humans, it is located from position −106 to −99. This octameric sequence is also present in human CEBPD and CEBPE promoters, but not in CEBPB or CEBPG promoters. Interestingly, we also observed a similar motif in the Xenopus CEBPA promoter, with all but the seventh base conserved (CCCAGCCG), at −108 to −101 bp relative to the TSS, suggesting a spatial and sequential conservation of this motif.

To identify which residues are crucial for protein binding, methylation interference assays were performed using the antisense strand of probe II (Fig. 3A). Comparing the patterns produced by the free probe and the retarded band, which represents the DNA–protein complex, we observed three guanosine residues at positions −105, −104, and −101 (Fig. 3A, lane 3) with diminished intensity relative to the free probe (Fig. 3A, lane 4), indicating their close contact with a DNA-binding protein. No other protected regions were observed, showing that this specific site is critical for the formation of the observed complex. We then introduced mutations into these three guanosine residues (G → T at positions −101, −104, and −105) and used this mutated probe to perform EMSA. We assessed the effects on DNA binding but only observed partial loss (data not shown). Next, we performed EMSAs using probes that harbored different numbers of mutated nucleotides. These mutational analyses demonstrated that binding could be abolished only upon mutating at least six of the eight bases in the core sequence CCCAGCAG (Fig. 3B) (data not shown). Fig. 3B demonstrates that alteration of the ACCCAGCAG sequence in probe II to TTCACCAAA abolishes the interaction (lanes 1–4). This unlabeled mutant probe was unable to compete with the observed complex when using the wild-type labeled oligonucleotide, probe II (Fig. 3B, lane 8).

Figure 3.

Figure 3.

The identified protein binds to the conserved CCCAGCAG site. A, methylation interference analysis of DNA contact points of the DNA-binding factor to the C/EBPα promoter demonstrates that a protein makes specific contact with this region. Lanes G and G+A are sequence standards prepared from unmethylated probe by DNA sequencing. Lane F is free DNA, and lane X is DNA from the observed DNA–protein complex. Both samples were subjected to piperidine-mediated cleavage of methylated guanosine residues. The asterisks indicate a direct interaction between the DNA and protein at bases −101, −104, and possibly −105. B, mutation of the conserved CCCAGCAG core region abolishes binding. U937 nuclear extract was incubated with radiolabeled probe II or a mutant derivative (probe M). FP, free probe; *, specific band. C, schematic representation of the WT and mutant luciferase constructs used to test the effect of the full CCCAGCAG sequence on promoter activity. Mutations were introduced in three constructs containing various segments of the CEBPA promoter region. The associated graph reports luciferase activity of each construct in U937 cells after transient transfection. D, UV cross-linking determines the molecular weight of the DNA binding factor at ∼80–95 kDa. A double-stranded oligonucleotide containing BrdU was synthesized and radiolabeled. Samples were electrophoresed on a 6% non-denaturing gel, and two complexes were excised and further separated on a 10% SDS-polyacrylamide gel. Lane 1, upper complex, estimated to be 95 kDa; lane 2, lower band, estimated to be 80 kDa. Error bars, S.D.

These mutant sequences were then cloned into various luciferase constructs. As shown in Fig. 3C, the basic pattern among the wild-type constructs is consistent with that observed previously (Fig. 1C). The luciferase activity of the −443/+124, −181/+124, and −125/+124 constructs was consistently higher than that of the −97/+124 and −78/+124 constructs, leading us to further focus on the region surrounding position −100. Additionally, mutation of the CCCAGCAG site significantly decreased luciferase activity in each of the three mutant constructs to a level comparable with that of the −78 bp minimal sequence (Fig. 3C). These results support our hypothesis that the sequence between −106 and −99 is important for promoter activity of these constructs in luciferase assays.

The zinc finger, ZNF143, binds to the CCCAGCAG site in the CEBPA promoter

Next, we determined the molecular mass of the DNA-binding protein that interacts with this region by UV cross-linking (22). Two BrdU-labeled bases were incorporated in the sequence of probe II at the putative DNA-binding site located between positions −106 and −99. After performing EMSA, excising the bands, and exposing them to UV light, we loaded the gel slices on an SDS-polyacrylamide gel. As shown in Fig. 3D, the lower band migrates with apparent molecular mass of 95 kDa, and the upper band migrates similar to a 105-kDa protein. Attempts to identify the protein using a variety of screening techniques, including FROGS (23) and yeast one-hybrid (24), were unsuccessful. In addition, EMSAs using control sequences demonstrated that the protein was not Sp1 or a member of the STAT family. Finally, we identified the protein binding to the CCCAGCAG site by partially purifying a HeLa nuclear extract using column chromatography in combination with SDS-PAGE and EMSA. HeLa cells were used, as they can be grown in large quantities in spinner flasks and therefore often used to isolate TFs. We first partially purified the DNA-binding activity of the crude nuclear extract by anion-exchange chromatography using a Mono Q column. Approximately 90% of the DNA-binding activity was eluted from the column, leading to a 100-fold purification of the factor compared with crude nuclear extract (Fig. 4A). This fraction was subsequently separated on an 8% SDS-polyacrylamide gel, 12 slices of different sizes in the 100-kDa range were excised (Fig. 4B), and the polypeptides within were renatured and tested for binding in an EMSA using probe II. Fraction 5 contained the highest binding activity (Fig. 4C), so we submitted the gel slice corresponding to this fraction for mass spectrometry analyses.

Figure 4.

Figure 4.

The seven-zinc finger TF ZNF143 binds to the CCCAGCAG site of the CEBPA promoter. A, fractionation of the binding activity on a Q column. B, size fractionation of the binding activity by SDS-PAGE. Twelve fragments were selected for further analysis. C, EMSA of size-fractionated extract using the probe from the −112 to −86 region of the CEBPA promoter demonstrates binding to fractions 4, 5, and 6. D, EMSA demonstrating binding of the protein in fraction 5 to a probe containing the STAF consensus binding site, CCCAGCAG. E, EMSA demonstrating binding to three different ZNF143 probes in U937 cells and that all three probes undergo a similar supershift as probe II (Fig. 2, A and B) by adding the anti-ZNF143 antibody. F, EMSA demonstrates that ZNF143 binds to the CCCAGCAG motif in the CEBPA promoter in vitro. Note that the negative control, normal rabbit serum, did not supershift the complex (lanes 4 and 8).

Simultaneously, motif analysis on 566 bp surrounding the TSS of the human CEBPA gene was performed with the MatInspector tool of Genomatix. This is a software tool that utilizes a large library of matrix description for TF binding sites to locate matches in DNA sequences. MatInspector suggested that the Xenopus protein STAF could bind to the CCCAGCAG sequence (Table 1). This finding was in close agreement with our mass spectrometric findings, as the human homolog of STAF, ZNF143 (19, 20), was identified in fraction 5 (Table 2). Subsequently, using EMSA, we demonstrated that a protein within fraction 5 bound to a synthetic ZNF/STAF consensus binding site (Fig. 4D) (25) as well as to two other published ZNF143 probes (26) (Fig. 4E). EMSA using HeLa extracts with ZNF143 antibodies demonstrates that ZNF143 binds to the CCCAGCAG motif in the CEBPA promoter (Fig. 4F).

Table 1.

Potential TF-binding sites within the human CEBPA promoter

The only motif found to match the −100 bp conserved element is the STAF motif (boldface type; conserved element underlined). Note that the first STAF motif is located at −110 to the TSS, and the second STAF motif is located in the TATA box. Opt., optimized maximum threshold.

TF family Opt. Position Strand Core similarity Matrix similarity Sequence
AP4 0.93 2–18 (−) 1.000 0.948 ttcaaagCCAGaaccag
LEF/TCF 0.94 7–23 (−) 1.000 0.964 tctctttCAAAgccaga
CHRF 0.92 10–22 (+) 1.000 0.928 ggctTTGAaagag
PURA 0.97 242–254 (+) 1.000 0.986 ggAGGCggtgggc
XBBF 0.89 252–270 (−) 1.000 0.907 caggccgcggcGCAAcgcc
CDEF 0.87 258–270 (+) 1.000 0.881 gcgcCGCGgcctg
INSM 0.90 269–281 (+) 1.000 0.943 tgcctGGGGagcg
CP2F 0.90 270–288 (+) 1.000 0.902 gcCTGGggagcgcggcgct
ZF5F 0.95 275–285 (+) 1.000 0.957 gggaGCGCggc
PAX5 0.73 282–310 (−) 0.789 0.735 gggcggcgaaccagCGCGgnacagcgc
SP1 0.88 300–314 (−) 1.000 0.890 catgGGGCggcgaac
CTCF 0.80 302–326 (−) 0.789 0.858 gngcgcggccggcaTGGGgcggcga
STAF 0.77 328–350 (+) 1.000 0.794 aggaCCCAgcaggcgccgcnccg
ZBPF 0.87 336–358 (+) 1.000 0.931 gcaggcgCCGCnccgccgcagcc
EGRF 0.79 342–358 (−) 0.864 0.769 ggctgcggcGGNGcggc
CTCF 0.80 346–370 (+) 1.000 0.838 cnccgccgcagcccGGGGacagagg
NR2F 0.82 355–379 (+) 0.779 0.827 agcccggggacagAGGCcccctcgg
BNCF 0.85 358–375 (−) 1.000 0.942 agggggcctcTGTCcccgg
OAZF 0.73 377–393 (−) 0.750 0.745 tcGCCCcctagagtccg
EGRF 0.86 380–396 (+) 1.000 0.860 actctaggGGGCgacgc
STAF 0.76 389–411 (−) 0.904 0.801 tataCCCGgcaggccgcgtcgcc
CDEF 0.87 390–402 (+) 1.000 0.873 gcgaCGCGgcctg
WHNF 0.95 390–400 (+) 1.000 0.951 gcgACGCggcc

Table 2.

Mass spectrometric data of identified proteins present within fraction 5

Bold indicates that identified protein is human ZNF143.

No. of peptide matches Average cross-correlation Gene
38 2.9993 UPSP:ACTN1_HUMAN
33 3.526 UPSP:ACTN4_HUMAN
30 3.515 UPSP:SND1_HUMAN
29 3.469 UPSP:SYA_HUMAN
23 3.508 UPSP:UBE1_HUMAN
21 2.889 UPTR:O14980_HUMAN
16 3.347 UPSP:HS74L_HUMAN
16 3.322 UPSP:ABCF1_HUMAN
14 3.312 UPSP:HXK2_HUMAN
10 2.139 UPTR:Q76N46_HUMAN
10 3.070 UPSP:SFPQ_HUMAN
10 3.031 UPSP:CSE1_HUMAN
8 3.476 UPSP:AP1B1_HUMAN
7 2.288 UPSP:IDE_HUMAN
6 3.438 UPSP:PMS2_HUMAN
6 3.238 UPSP:SEC8_HUMAN
5 3.165 UPSP:MSH2_HUMAN
3 3.052 UPSP:HXK1_HUMAN
2 3.590 UPSP:CTN1_HUMAN
2 3.532 UPSP:UBP5_HUMAN
1 6.492 UPTR:Q6P665
1 4.637 UPSP:ZNF143_HUMAN
1 4.322 UPTR:Q6NX51_HUMAN
1 4.263 GP:AK044451_1
1 4.231 UPSP:CORO7_HUMAN
1 3.941 UPTR:Q15157_HUMAN
1 3.730 UPTR:Q6MZH1_HUMAN
1 3.721 UPSP:SEC3HUMAN
1 3.687 UPSP:HS105_HUMAN
1 3.496 UPTR:Q8N1G2_HUMAN
1 3.077 UPTR:OQ6N046_HUMAN
1 3.001 UPTR:Q9UEQ5_HUMAN
1 2.895 UPTR:Q5T5N3_HUMAN
1 2.800 UPTR:Q9BVN4_HUMAN
1 2.709 UPSP:YS64_HUMAN
1 2.659 UPSP:XPO7_HUMAN
1 2.639 UPSP:PSA_HUMAN
1 2.500 UPSP:TOP3A_HUMAN
1 2.434 UPSP:MCM3_HUMAN
1 2.316 UPSP:GSPT1_HUMAN
1 2.301 UPSP:KIF2_HUMAN
1 2.153 UPTR:Q5T7F5_HUMAN
1 2.030 UPSP:GCC1_HUMAN

To assess whether ZNF143 binds the CEBPA proximal promoter in myeloid cells, we performed ChIP-exo experiments (27) using ZNF143 antibodies and U937 cells. ChIP-exo is a modification of chromatin immunoprecipitation followed by deep sequencing (ChIP-seq), in which the binding site is narrowed down by employing an exonuclease to trim the immunoprecipitated DNA to a precise distance from the cross-linking site to which the protein binds (27). As expected, we observed binding of ZNF143 to the CEBPA promoter (Fig. 5, A and B). By performing de novo motif discovery on the ChIP-exo data, we identified a motif containing the conserved CCCAGCAG sequence (Fig. 5C), which corresponds to the previously published ZNF143-binding motif (21, 28).

Figure 5.

Figure 5.

ZNF143 binds to the CCCAGCAG motif in the CEBPA promoter in vivo. A, ChIP-exo signal (fragment density, blue track) shows a strong enrichment in the proximal promoter of CEBPA compared with the input (gray track), indicating specific binding of ZNF143. Note the 10-fold difference in scale between input sequencing and ChIP-exo signal. Genomic positions on hg19 are indicated. B, zoom out of the ZNF143 peak in a 10-kb region around CEBPA. C, sequence logos of highly enriched ZNF143 binding motifs in the ChIP-exo peaks correspond to the conserved sequenced found in the CEBPA proximal promoter. This demonstrates the preferential binding of ZNF143 to a motif containing the CCCAGCAG sequence, boxed in blue. Enrichment p values are indicated.

ZNF143 transactivates the human CEBPA promoter in Schneider cells

To test whether ZNF143 is able to transactivate the human CEBPA promoter, we performed transient transfection studies in Drosophila S2 Schneider cells. This cell line was utilized because the presence of binding activity for ZNF143 or the related family member ZNF76 (19) could not be detected by EMSA (Fig. 6A, lane 1). Overexpression of ZNF143 in Schneider cells led to the ∼10-fold transactivation of the −179 bp promoter, whereas overexpression of ZNF76, as well as the empty vector, generated only low luciferase activity (Fig. 6B). In addition, mutating the ZNF143 site reduced transactivation 5-fold. Altogether, we show that ZNF143 can transactivate the CEBPA promoter by binding directly to a site within it.

Figure 6.

Figure 6.

ZNF143, but not its homolog, ZNF76, transactivates the CEBPA promoter. A, no binding is observed to the ZNF143 probe (z1) in Schneider (S2) cells (lane 1). B, graph demonstrating that ZNF143, but not its homologue, ZNF76, activates transcription driven by the CEBPA promoter in luciferase reporter assays. Schneider cells, which do not express endogenous ZNF143 or ZNF76, were transiently transfected with luciferase reporter constructs containing the human CEBPA proximal promoter (−181 to +143) with either the wild-type or mutated octameric site alone (lane 1) or together with ZNF143 expression vector (lane 2), ZNF76 expression vector (lane 3), or an empty expression vector (PPAC; lane 4). Relative luciferase activity (RLU) normalized to Renilla luciferase is shown. Error bars, S.D. of three independent replicates.

ZNF143 is required for C/EBPα expression in myeloid cells

Finally, we investigated whether ZNF143 could regulate C/EBPα expression. We identified two shRNA sequences that reduced ZNF143 transcription. Transduction of these shRNA constructs into U937 myeloid cells reduced ZNF143 expression at both the mRNA and protein level by 80% in comparison with a non-silencing control (NSC) (Fig. 7, A–C). In addition, ZNF143 silencing resulted in a strong reduction of CEBPA transcript levels (Fig. 7, A–C). Because ZNF143 binds a motif conserved in CEBPA, CEBPD, and CEBPE (Fig. 2D), we examined the consequences of ZNF143 knockdown on CEBPE expression (as CEBPD is not expressed in U937 cells (29), the effects of CEBPD knockdown could not be analyzed). A significant reduction of CEBPE transcripts was observed in U937 cells transduced with either of two ZNF143 shRNA constructs (Fig. 7D). Further, we analyzed the effect of ZNF143 silencing on other CEBP members and observed that CEBPB and CEBPG transcription was similarly reduced (Fig. 7D). C/EBPβ reduction was also detectable at the protein level (Fig. 7E). Although CEBPB and CEBPG do not present the binding motif identified in the proximal promoter of CEBPA, CEBPD, and CEBPE (Fig. 2D), analysis of the 5′-untranslated region demonstrated the presence of a conserved sequence with high similarity to the consensus octamer (CEBPB, CCgAGCAG at position −318; CEBPG, CCCAGCga at position −769), which might explain the observed down-regulation. In contrast, there was no reduction in transcript levels of FOS (Fig. 7D), a transcription factor that does not present the ZNF143 conserved motif.

Figure 7.

Figure 7.

ZNF143 activates the transcription of C/EBPα. A, Western blots showing protein expression of ZNF143, both C/EBPα isoforms and HSP90 loading control in U937 cells that were transfected with NSC shRNA or two independent shRNA vectors targeting ZNF143 (sh#1 and sh#2). B, bar graphs quantifying the C/EBPα protein levels from A demonstrate that knockdown of ZNF143 in U937 cells leads to down-regulation of C/EBPα protein levels using two independent shRNA-targeting constructs. C, bar graphs demonstrating levels of ZNF143 mRNA in cells expressing NSC, sh#1, or sh#2. D, CEBPA, CEBPB, CEBPE, CEBPG, and FOS mRNA levels in cells expressing NSC, sh#1, or sh#2. E, Western blots demonstrating that ZNF143 knockdown in U937 cells decreases C/EBPα and C/EBPβ levels. A ZNF143-specific antibody was employed. Actin was used as a loading control. Lanes 1–3, S2 cells overexpressing empty vector control (EV), ZNF76, and ZNF143, respectively. Lanes 4 and 5, U937 cells transduced with NSC, ZNF143 sh#1, and ZNF143 sh#2, respectively. F, quantitative ChIP-PCR using the U937 cells transduced with NSC (black bars), ZNF143 sh#1 (white bars), and ZNF143 sh#2 (gray bars). Immunoprecipitation was performed with antibodies against IgG control and ZNF143, and enrichment was determined in a CEBPA promoter region, intergenic region, and U6 promoter. y axes indicate enrichment as a percentage of input. Error bars, S.D.

Next, a rabbit polyclonal ZNF143-specific antibody, the specificity of which is shown in Fig. 7E, was generated. This antibody was used to perform quantitative ChIP-PCR on shRNA-transduced U937 cells; the observed reduction of ZNF143 protein levels resulted in reduced enrichment of ZNF143 at the CEBPA promoter region (Fig. 7F, left). A similar effect was seen in the U6 promoter, known to be bound by ZNF143 (30) (Fig. 7F, right), whereas no significant changes were observed within an intergenic region that is not bound by ZNF143 (Fig. 7F, middle). Taken together, this study provides evidence that ZNF143 can positively regulate C/EBPα expression in myeloid cells by binding to the CCCAGCAG site ∼100 bp upstream of the CEBPA TSS.

Discussion

In this study, to gain insights into the transcriptional regulation of myeloid development, we investigated the regulatory control elements of the promoter of one of the master regulators of this process, C/EBPα. Because the programs driving hematopoietic development are largely driven by alterations in transcriptional activity, studying potential TF binding sites within such genes may prove to be key in defining the mechanisms that drive lineage development. Indeed, we demonstrate here that ZNF143 binds to the proximal promoter of CEBPA in vitro and that down-regulation of ZNF143 results in a marked decrease in C/EBPα mRNA and protein levels in myeloid cells.

Interestingly, mutational analyses showed that there is some flexibility in the 8-bp sequence for formation of a DNA–protein complex. Although, methylation interference assays defined three guanine residues as being in close proximity to a DNA-binding protein (Fig. 3A), it seems that other bases within this sequence compensate and allow the DNA–protein interaction to occur, as we were unable to abolish binding by just mutating one or two bases of this 8-bp motif. We could only completely abolish binding by mutating at least 6 bases in the core sequence CCCAGCAG (Fig. 3B). This demonstrates that, as for most transcription factors (31), there is flexibility in the DNA-binding motif. A study of ∼100 mouse transcription factors showed that virtually all of them have a unique preference, but almost half of them can recognize several different sequences in addition to the known consensus sequences (32). This is also suggested in Fig. 5B, in which the sixth base C and the eighth base G in the 8-bp motif CCCAGCAG have a very low consensus score. Previously, ZNF76 was reported to repress TBP activity via direct protein–protein interaction (33), but we observed no effect on C/EBPα promoter activity (Fig. 6B). We conclude that ZNF143 is probably responsible for most of the observed C/EBPα transcriptional activity on this conserved cis-element. On the other hand, it is also possible that other factors necessary for ZNF76 to exert its effect on C/EBPα promoter activity are absent in S2 cells. Further, we observed that ZNF143 down-regulation in myeloid cells resulted in a strong reduction in CEBPA, CEBPB, CEBPE, and CEBPG transcript levels. CEBPB and CEBPG do not retain the conserved ZNF143 motif; however, sequences with a 1- or 2-nucleotide difference from the core sequence, CCCAGCAG, were noted elsewhere in the 5′-untranslated region. As already mentioned, our data suggest that there might be some flexibility in the 8-bp sequence for formation of a DNA–protein complex, and we hypothesize that, via the alternative core sequences, ZNF143 can also regulate CEBPB and CEBPG expression. These observations challenge our ability to understand how transcription factors and their DNA-binding motifs exactly interact to regulate subsequent gene expression, as this opens a wider array of potential TF-binding sites, further increasing the complexity of the protein–DNA binding landscape.

ZNF143 is a ubiquitously expressed transcriptional activator that belongs to the Kruppel family of zinc finger proteins. It has been shown to associate with CHD8 and contribute to the efficient transcription of the U6 RNA polymerase III (30). Furthermore, ZNF143 has been implicated in the transcriptional regulation of genes associated with cell cycle and DNA replication (34) and DNA repair genes following exposure to cisplatin (35). ZNF143 is also a key component of the three-dimensional chromatin structure (36) and is required for human embryonic stem cell pluripotency (37). However, until this study, ZNF143 had not been implicated in hematopoietic development, although its knockdown in Zebrafish causes reduced blood cell formation (38).

Whereas the expression of ZNF143 is ubiquitous (Fig. 2C), at the same time, it appears to be important for expression of C/EBPα in myeloid cells. Furthermore, the regions of the CEBPA promoter required for activity in myeloid cells appear to be distinct from those that drive its expression in hepatic cells (16). We hypothesize that ZNF143, rather than being a sole regulator of CEBPA expression in myeloid cells, might interact with other cell type–specific regulatory factor(s) that are yet to be identified. Therefore, it will be important in future studies to identify the component(s) that might further contribute to myeloid transcriptional activity of the CEBPA promoter. A number of ubiquitously expressed transcription factors can contribute to myeloid specificity of promoters, including Sp1 (39–42). One possibility is that other transcription factors cooperate with ZNF143 to provide specificity. Among various candidates, the transcriptional activator Notch1 and its associated DNA-binding repressor, RBPJ, strongly overlap with ZNF143-binding sites in other cell types (21, 28). Interestingly, the Notch target, Hes-1, represses the Cebpa promoter in myeloid cells, with a Hes-1 site at −170 bp (43). In addition, a number of binding sites for the transcriptional repressor THAP11 were observed to coincide with ZNF143 sites (21, 44). Notch1 signaling is aberrant in many human cancers and in myeloid leukemia (45) and has been implicated in regulating self-renewal of tumor stem cells (46). Similarly, THAP11 is involved in self-renewal of embryonic stem cells (47). C/EBPα has also been implicated in regulating self-renewal of fetal liver and adult hematopoietic stem cells (10), and aberrant C/EBPα regulation plays a key role in myeloid leukemia (15) and solid tumors (48). Taken together, it appears that ZNF143 may modulate genes involved in biological processes related to cell growth in rapidly dividing cells, such as stem cells and tumors, via potential cofactors THAP11 and Notch1.

A second possibility is the recent observation that ZNF143 can contribute to specificity by contributing to interactions between promoters and distal regulatory elements (49). Recently, two groups have identified an important CEBPA enhancer at +42 kb relative to the transcription start site that interacts with the promoter to mediate myeloid-specific expression of C/EBPα (50, 51). The effect of competitive or combinatorial binding of ZNF143 and other potential partners on the transcriptional activity of target genes, such as C/EBPα, as well as the potential interaction of ZNF143 binding to the CEBPA promoter and distal regulatory elements (18, 50, 51) merit further investigation.

Experimental procedures

Constructs

We used the GRCh37/hg19 reference genome to determine the sequence of the CEBPA proximal promoter region. All CEBPA constructs used in this study are numbered here relative to the TSS determined previously (16), as illustrated in supplemental Fig. S1. Luciferase constructs were kindly provided by Dr. Gretchen Darlington and were previously used in a study involving Hep3B2 cells (16). These constructs were generated by first subcloning a 2.2-kb EcoRI/NruI fragment into PXP1. Further deletions were generated using BamHI, KpnI, StuI, EagI, AvrII, and SmaI sites. Deletion constructs starting from position −110 or −95 were generated by PCR, subcloned into the pGEM-T vector, and subsequently cloned into the PXP1 vector (52). These constructs were sequenced using the dideoxy method. We then used PCR to generate another series of deletions within 443 bp of the TSS and extending to the initiating ATG (+124). Mutant constructs were generated, using the method of Zaret et al. (53). Two internal primers containing a 9-base mutation, from −117 to −108, were synthesized, primers C (5′-CTAGGTTCACCAAAGCGCCGCGCCG-3′) and B (5′-CGGCGCGGCGCTTTGGTGAACCTAG-3′). Two external BamHI-containing primers, A (5′-CGGGATCCCGCAGGCCTGGTTCTGGCT-3′) and D (5′-GGGGTACCCCGGGGGAGTTAGAGTTCT-3′), were synthesized. 40 PCR cycles (94 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min) were performed using primers A and B in one reaction and primers C and D in the other. PCR products were gel-purified. 1 μl of each purified product was added to a 48-μl PCR for 3 cycles of the following: 94 °C, 1 min; 55 °C, 1 min; 72 °C 1.5 min. 1 μl of primers A and D (10 μm) was added, and 40 PCR cycles were performed: 94 °C, 1 min; 55 °C, 1 min; 72 °C, 1.5 min. The PCR fragment was size-fractionated on a 1.2% agarose gel and purified using Gene-Clean (BIO 101). The fragment was digested with BamHI and KpnI (New England Biolabs) and subcloned into PXPI. Subsequent deletions were made using internal primers. shRNA sequences specifically targeting and consequently down-regulating ZNF143 were cloned into the retroviral vector pRSeG (54). sh#1 (5′-GGCAGATGGTGACAACTTA-3′) targets a sequence from exon 3 that was the human version of an RNAi sequence used previously to target murine ZNF143 in stem cells (55). sh#2 (5′-GGACATGCTACAAGAGTAA-3′) targets a sequence located in the 3′-UTR and was found using Dharmacon's design program for shRNA. ZNF143 and ZNF76 expression constructs were generously donated by Dr. Carbon (Université de Strasbourg, France) and Dr. Kunkel (Texas A&M University, College Station, TX).

Cell culture, transient transfections, and luciferase assays

U937 cells were maintained in RPMI 1640 medium supplemented with 10% FBS and transiently transfected with the indicated constructs (see above, and see Pahl et al. (56)). Briefly, 107 cells were electroporated at 220 V at 960 microfarads with a Bio-Rad Genepulser with 20 μg of supercoiled luciferase reporter construct and 1 μg of CMV-hGH, a plasmid expressing human growth hormone from a CMV promoter. Cells were incubated at 37 °C for 6 h, harvested by centrifugation at 1000 rpm for 5 min, and lysed. Luciferase activity was measured on a Monolight 2010 Luminometer (Analytical Luminescence Laboratories). Transfection efficiencies were controlled by measuring human growth hormone levels by radioimmunoassay (Nichols Institute). Schneider (S2) cells were obtained from ATCC and cultured in insect medium (Sigma) supplemented with 10% FBS at 25 °C and transfected with Transfectin (Bio-Rad).

Preparation of nuclear extracts

Nuclear extracts were prepared as followed; cells were spun down and washed with cold PBS and resuspended in isotonic buffer A (10 mm Hepes, 1.5 mm MgCl2, pH 7.9) for 30 min. Cells were lysed with a 1-ml tuberculin syringe (18-gauge) by rapidly pumping the sample through at least five times. Nuclei were then lysed and resuspended in buffer B (10 mm Hepes, 1.5 mm MgCl2, 400 mm NaCl, pH 7.9). Protein concentration was determined using the method of Bradford (57) (Bio-Rad), and extracts were aliquoted and frozen at −80 °C.

EMSA

Gel shifts assays were performed by incubating 20 μg of nuclear extract with 5 μl of 5× buffer (50 mm Hepes, pH 7.9, 250 mm KCl, 10 mm MgCl2, 1 mm DTT), 2 μg of poly(dI-dC), and 50,000 cpm of 32P-labeled double-stranded probe. Samples were loaded on a 6% polyacrylamide non-denaturing gel and run at 200 V for 3 h in 1× TBE (89 mm Tris, pH 7.6, 89 mm boric acid, 2 mm EDTA). Gels were dried and exposed to film for 12 h or less. ZNF143 antibodies were generously donated by Dr. Philippe Carbon (58). ZNF76 antibodies were generously donated by Dr. Yu-Chung Yang (Case Western University) (33). The sequences of the probes used in EMSA are provided in Table 3.

Table 3.

Probes used in EMSA

The CCCAGCAG core in probe II is underlined, and the mutated bases in its derivative (probe M) are highlighted by boldface type.

Probe Sequence (5′–3′)
Probe I GCCGGCCGCGCGCTAGGACCCAG
Probe II CTAGGACCCAGCAGGCGCCGCGCCG
Probe III GCCGCGCCGCCGCAGCCCGGGGACAG
Probe M CTAGG[b]TTCACCAAAGCGCCGCGCCG
Sp1 site, PU.1 promoter AAACGGGCTGGGGCGGTGATGTCAC
z1: optimal STAF/ZNF143 binding probe (25) TTTACCCACAATGCATTGCGC
z2: ZNF143 probe (26) ATTACCCATAATGCATCGCGG
z3: ZNF143 probe (26) CCGCGGGGCATTGTGGGCCGT

ZNF143 knockdown experiments

Two shRNA constructs were used to generate virus in Phoenix A cells. A mixture of plasmid DNA and Lipofectamine 2000 was added to 150-mm plates of 80% confluent Phoenix A cells containing DMEM without FBS. 4 h later, 10% FBS was added. 60 h later, the medium was collected, concentrated with a Centricon Plus-70 concentration device (Millipore), and stored at −80 °C. 5 × 105 U937 cells were transduced with these viral stocks by co-incubation for 48 h and then grown for 3 days. GFP-positive subpopulations were purified by FACS, resuspended in medium, and grown for an additional week. Whole-cell lysates were tested on Western blots using antibodies against ZNF143 (58) (see below), C/EBPα (14AA, 1:1000; Santa Cruz Biotechnology, Inc.), C/EBPβ (C-19, 1:1000; Santa Cruz Biotechnology, Inc.), Hsp90 (1:2000; BD Bioscience), and β-actin (1:10000; Sigma-Aldrich). RNA was isolated from 5 × 105 cells, and quantitative PCR was carried out using the following oligonucleotides: ZNF143, 5′-CGAGCAGGAAGCCTTCTTTGA-3′ and 5′-CGTAATCTGGGACCCTTTAAGAAC-3;CEBPA, 5′-CAAGAAGTCGGTGGACAAGA-3′ and 5′-GGTCATTGTCACTGGTCAGC-3′; CEBPB, 5′-GCGACGAGTACAAGATCC-3′ and 5′-AGCTGCTTGAACAAGTTCC-3′; CEBPE, 5′-CTCCGATCTCTTTGCCGTGAA-3′ and 5′-TGGGCCGAAGGTATGTGGA-3′; CEBPG, 5′-CCCTGCTCTCATTTCTACCTG-3′ and 5′-ACACTAATTCCGTTCACCCC-3′; FOS, 5′-CCGGGGATAGCCTCTCTTAC-3′ and 5′-GTGGGAATGAAGTTGGCACT-3′.

Generation of antibodies against human ZNF143

Rabbit polyclonal ZNF143 antibody was raised against a C-terminal epitope of human full-length ZNF143 (from amino acid 572 to 594, AFHTASSEMGHQQHSHHLVTTET). Briefly, preimmunized blood was taken 2 weeks before first antigen injection. Antigen was injected into rabbits on days 0, 21, and 42. Blood samples were taken on days 28 and 49. Rabbits were euthanized, and blood was collected for further antibody purification on day 56.

UV cross-linking

EMSA was performed with a double-stranded oligonucleotide containing a halogenated analog of thymidine (BrdU). The sequence of the probe was 5′-CTAGGACCCAGCAGGCGCCGCGCCG-3′. 20 μg of U937 nuclear extract was incubated with 50,000 cpm of double-stranded probe. Samples were then electrophoresed on a 6% non-reducing 1× acrylamide gel. The gel was exposed to X-ray film without drying. The X-ray film was superimposed on the gel, and the area of interest containing the shifted complex was marked. Two bands were carefully excised from the gel using a razor blade. Gel slices were irradiated with UV light at 254 nm for 5 min to cross-link the labeled probe to the DNA-binding protein of interest. Gel slices were then boiled in 200 μl of 2× SDS sample buffer containing both DTT and β-mercaptoethanol for 5 min and loaded into the wells of a 10% SDS-polyacrylamide gel. 1% agarose was loaded into the well to seal it into the well. The gel was run for 3 h at 50 mA, dried on a gel dryer, and then exposed to X-ray film overnight. The apparent molecular weights of the bands of interest were determined by comparison with known size markers.

Methylation interference

50 ng of a single-stranded oligonucleotide spanning from −87 to −111 bp (5′-GCGGCGCGGCGCCTGCTGGGTCCTA-3′) was end-labeled with 50 μCi of [γ-32P]ATP and T4 polynucleotide kinase. This was then gel-purified and annealed to 50 ng of complementary oligonucleotide. 108 dpm of this fragment was then methylated under limiting conditions by adding 1 μl of DMSO to 200 μl of DMS reaction buffer (50 mm sodium cacodylate, pH 8.0, 1 mm EDTA, pH 8.0) for 5 min at room temperature. Stop buffer (1.5 m sodium acetate, pH 7.0, 1 mβ-mercaptoethanol) was added, and the partially methylated fragment was ethanol-precipitated. 50,000 cpm of this methylated probe was incubated with 20 μg of U937 nuclear extract. This sample was then run on a 6% acrylamide gel in 1× TBE. The gel was exposed to film, and the complexes of interest were located by superimposing the X-ray film over the gel. The fragments of interest were isolated and extracted from the gel using 0.3 m ammonium acetate. The pellet was resuspended in 100 μl of 1 m piperidine and heated to 90 °C to cleave the DNA–protein complex. Samples were then lyophilized and run on a 4% denaturing urea gel. Chemical sequencing of unmethylated oligonucleotides was performed by the Maxim–Gilbert method (59), and samples were run along with test samples for comparison.

Protein purification

A 10-liter preparation of HeLa cells was obtained from the National Culture Facility. After centrifugation of this culture, the 10-ml pellet of cells was resuspended in 10 ml of isotonic buffer A (10 mm Hepes, 1.5 mm MgCl2, pH 7.9) for 30 min. Cells were lysed with a 1-ml tuberculin syringe (18-gauge) by rapidly pumping the sample through at least five times. Nuclei were then lysed and resuspended in buffer B (10 mm Hepes, 1.5 mm MgCl2, 400 mm NaCl, pH 7.9). Protein concentration was determined using the method of Bradford (57) (Bio-Rad). Ultimately, we obtained 7.5 ml of protein at a concentration of 10 μg/μl. This sample was then desalted into 10 m Tris, pH 8.0, using a 5-ml HiTrap desalting column, containing Sephadex-G25 (GE Healthcare). The sample was then passed over a 5-ml HiTrap-Q HP column (GE Healthcare). The salt concentration was increased in a step gradient from 100 mm salt to 1 m salt in 100 mm increments. 5 ml/step at a flow rate of 1 ml/min were collected. Fractions were collected and tested for the presence of the DNA-binding activity of interest using EMSAs. As 95% of the activity was found in the 200 mm salt fraction, we concentrated this fraction using a Viva Spin protein concentrator (GE Healthcare), resuspended it in 4× SDS sample buffer (40% glycerol, 240 mm Tris, pH 6.8, 8% SDS, 0.04% bromphenol blue, 5% β-mercaptoethanol), and boiled it for 10 min. We subsequently ran this sample on a 10% polyacrylamide SDS gel and excised 20 different fractions around the 100-kDa marker. Each sample was ground up, resuspended in 300 μl of renaturation buffer (100 mm NaCl, 10 mm Hepes, pH 7.5, 1 mm EDTA), and stored at 4 °C overnight. We performed EMSA on the fractions with probe II to determine which samples contained proteins that were capable of binding to 32P-labeled probe II. Those samples, as well as a sample that did not show any DNA binding activity, were sent to the Biopolymer facility at Harvard Medical School.

ChIP-exo and motif analyses

8.5 × 106 U937 cells were harvested, washed with ice-cold PBS, and cross-linked with 1% formaldehyde (Sigma) for 10 min at room temperature with gentle agitation. 2 m glycine was added to quench the reaction. Cell pellets were obtained by 10 min of cold centrifugation at 2000 rpm and lysed (50 mm Hepes, pH 7.5, 150 mm NaCl, 1 mm EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS + protease inhibitors (Complete Mini, catalogue no. 04693139001, Roche Applied Science). The solution was incubated at 4 °C for 30 min. Cell pellets were collected by 10 min of centrifugation at 2000 rpm at 4 °C, resuspended in lysis buffer, and sonicated in a Bioruptor Next Gen water bath sonicator (Diagenode) to 200–500 bp and sent to Peconic LLC (State College, PA) for ChIP-exo analysis (60). For both ChIP-exo and ChIP-seq input, reads were mapped onto the human genome (hg19, without mitochondrial chromosome and unassembled contigs) using Bowtie2 version 2.1.0 (option: very sensitive). Reads with mapping quality score under 10 were removed (using Samtools view −q10) to remove unmapped and multimapped reads. Identification of enriched regions (peak calling) was performed with Peakzilla (default options), identifying 10,413 peaks. For visualization, reads were elongated to 123 bp, corresponding to the fragment found by Peakzilla (GSE65130). De novo motif discovery was performed using RSAT peak motifs (algorithm: oligo-analysis, dyads, and position analyses; word length: 6–8; other options as default).

ChIP-seq input library preparation

8.5 × 106 U937 cells were cross-linked in 1% formaldehyde (Sigma) for 10 min at room temperature. After cross-linking, cells were washed once with ice-cold PBS. Cell lysis was carried out for 10 min on ice using 350 μl of lysis buffer containing 1% SDS (1st Base), 10 mm EDTA (1st Base), 50 mm Tris, pH 8 (1st Base), and Complete protease inhibitors (Roche Applied Science). Genomic DNA was sheared in a BioruptorTM Next Gen water bath sonicator (Diagenode) to ∼200–500 bp by 10 cycles of 30 s ON, 30 s OFF, on High. DNA fragment size was verified via agarose gel electrophoresis. Input chromatin was reverse–cross-linked in 125 μl of 1% SDS and 0.1 m NaHCO3 (Sigma) for 6–7 h at 65 °C. The chromatin was purified using the QIAquick PCR spin kit (Qiagen), and at least 5 ng of input DNA was processed for deep sequencing using ThruPLEX-FD kits (Rubicon Genomics) according to the manufacturer's instructions. The input library was sequenced using Illumina HiSeq2000 at the Duke-NUS Genome Biology Facility, and tags were mapped to human genome build hg19.

Quantitative ChIP followed by PCR

60 × 106 U937 cells transduced with ZNF143 targeting shRNA constructs (sh#1 and sh#2) or NSC shRNA were used for quantitative ChIP-PCR as described previously (61). Briefly, cells were fixed with 1% formaldehyde and then neutralized with glycine at a final concentration of 0.125 m. After washing with ice-cold PBS three times, cells were lysed in lysis buffer and sonicated to obtain 500-bp genomic DNA fragments. Samples were divided into three equal aliquots, and each was incubated overnight with IgG or antibodies to ZNF143 or CEBPα. The next day, magnetic beads were added for 2 h and subsequently washed (61). After reverse–cross-linking and purifying chromatin, quantitative PCR was performed using the following oligonucleotides: CEBPA promoter region, 5′-GTTAGAGTTCTCCCGGCATG-3′ and 5′-GTCGAAAATATGGGCCGTCC-3′; U6 promoter region, 5′-GCAAAACGCACCACGTGACG-3′ and 5′-CTATGTTCCGACAATCTCTC-3′; and intergenic region, 5′-CAGGCGGTCATTGTCACTG-3′ and 5′-GTGGCTGAAGAACCGGAAC-3′.

Author contributions

D. G. T. and A. D. F. conceptualized the work. D. G., A. L., B. B., M. A.-J., Q. Z., M. K., A. E., K. D. S., H. R., P. Z., S. S. K., R. S. W., E. L., U. S., G. C., S. C., L. M. S., and M. H. C. were responsible for methodology, formal analysis, and investigation. D. G., A. L., M. A.-J., L. M. S., and D. G. T. wrote the manuscript. D. G., A. L., M. A.-J., and L. M. S. were responsible for visualization. A. L. and D. G. T. supervised the work. D. G. T. acquired funding.

Supplementary Material

Supplemental Data

Acknowledgments

We thank Hideyo Hirai and Christian Bach for critical discussions.

This work was supported by the Singapore Ministry of Health's National Medical Research Council under its Singapore Translational Research (STaR) Investigator Award (to D. G. T.) and by the National Research Foundation Singapore and the Singapore Ministry of Education under its Research Centers of Excellence initiative; National Institutes of Health Grants HL131477 and CA66996 (to D. G. T.); institutional funding from the IMG AS CR (RVO 68378050) (to M. A.-J.); and German Research Foundation (DFG) Grant BA 3771/1-1 (to B. B.). The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

This article contains supplemental Fig. S1.

5
The abbreviations used are:
TF
transcription factor
TSS
transcription start site
contig
group of overlapping clones
NSC
non-silencing control.

References

  • 1. Ogawa M. (1993) Differentiation and proliferation of hematopoietic stem cells. Blood 81, 2844–2853 [PubMed] [Google Scholar]
  • 2. Alberich-Jordà M., Wouters B., Balastik M., Shapiro-Koss C., Zhang H., Di Ruscio A., Radomska H. S., Ebralidze A. K., Amabile G., Ye M., Zhang J., Lowers I., Avellino R., Melnick A., Figueroa M. E., Valk P. J., Delwel R., and Tenen D. G. (2012) C/EBPγ deregulation results in differentiation arrest in acute myeloid leukemia. J. Clin. Invest. 122, 4490–4504 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Rosenbauer F., Wagner K., Kutok J. L., Iwasaki H., Le Beau M. M., Okuno Y., Akashi K., Fiering S., and Tenen D. G. (2004) Acute myeloid leukemia induced by graded reduction of a lineage-specific transcription factor, PU.1. Nat. Genet. 36, 624–630 [DOI] [PubMed] [Google Scholar]
  • 4. Tenen D. G., Hromas R., Licht J. D., and Zhang D. E. (1997) Transcription factors, normal myeloid development, and leukemia. Blood 90, 489–519 [PubMed] [Google Scholar]
  • 5. Landschulz W. H., Johnson P. F., and McKnight S. L. (1988) The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240, 1759–1764 [DOI] [PubMed] [Google Scholar]
  • 6. Lekstrom-Himes J., and Xanthopoulos K. G. (1998) Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J. Biol. Chem. 273, 28545–28548 [DOI] [PubMed] [Google Scholar]
  • 7. Radomska H. S., Huettner C. S., Zhang P., Cheng T., Scadden D. T., and Tenen D. G. (1998) CCAAT/enhancer binding protein alpha is a regulatory switch sufficient for induction of granulocytic development from bipotential myeloid progenitors. Mol. Cell Biol. 18, 4301–4314 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Zhang D. E., Zhang P., Wang N. D., Hetherington C. J., Darlington G. J., and Tenen D. G. (1997) Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein α-deficient mice. Proc. Natl. Acad. Sci. U.S.A. 94, 569–574 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Zhang P., Iwasaki-Arai J., Iwasaki H., Fenyus M. L., Dayaram T., Owens B. M., Shigematsu H., Levantini E., Huettner C. S., Lekstrom-Himes J. A., Akashi K., and Tenen D. G. (2004) Enhancement of hematopoietic stem cell repopulating capacity and self-renewal in the absence of the transcription factor C/EBP α. Immunity 21, 853–863 [DOI] [PubMed] [Google Scholar]
  • 10. Ye M., Zhang H., Amabile G., Yang H., Staber P. B., Zhang P., Levantini E., Alberich-Jordà M., Zhang J., Kawasaki A., and Tenen D. G. (2013) C/EBPa controls acquisition and maintenance of adult haematopoietic stem cell quiescence. Nat. Cell Biol. 15, 385–394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Ford A. M., Bennett C. A., Healy L. E., Towatari M., Greaves M. F., and Enver T. (1996) Regulation of the myeloperoxidase enhancer binding proteins Pu1, C-EBPα, -β, and -δ during granulocyte-lineage specification. Proc. Natl. Acad. Sci. U.S.A. 93, 10838–10843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Smith L. T., Hohaus S., Gonzalez D. A., Dziennis S. E., and Tenen D. G. (1996) PU.1 (Spi-1) and C/EBPα regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells. Blood 88, 1234–1247 [PubMed] [Google Scholar]
  • 13. Gombart A. F., Shiohara M., Kwok S. H., Agematsu K., Komiyama A., and Koeffler H. P. (2001) Neutrophil-specific granule deficiency: homozygous recessive inheritance of a frameshift mutation in the gene encoding transcription factor CCAAT/enhancer binding protein-ϵ. Blood 97, 2561–2567 [DOI] [PubMed] [Google Scholar]
  • 14. Nerlov C. (2007) The C/EBP family of transcription factors: a paradigm for interaction between gene expression and proliferation control. Trends Cell Biol. 17, 318–324 [DOI] [PubMed] [Google Scholar]
  • 15. Pabst T., Mueller B. U., Zhang P., Radomska H. S., Narravula S., Schnittger S., Behre G., Hiddemann W., and Tenen D. G. (2001) Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-α (C/EBPα), in acute myeloid leukemia. Nat. Genet. 27, 263–270 [DOI] [PubMed] [Google Scholar]
  • 16. Timchenko N., Wilson D. R., Taylor L. R., Abdelsayed S., Wilde M., Sawadogo M., and Darlington G. J. (1995) Autoregulation of the human C/EBPα gene by stimulation of upstream stimulatory factor binding. Mol. Cell Biol. 15, 1192–1202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Holt E. H., and Lane M. D. (2001) Downregulation of repressive CUP/AP-2 isoforms during adipocyte differentiation. Biochem. Biophys. Res. Commun. 288, 752–756 [DOI] [PubMed] [Google Scholar]
  • 18. Guo H., Ma O., Speck N. A., and Friedman A. D. (2012) Runx1 deletion or dominant inhibition reduces Cebpa transcription via conserved promoter and distal enhancer sites to favor monopoiesis over granulopoiesis. Blood 119, 4408–4418 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Myslinski E., Krol A., and Carbon P. (1998) ZNF76 and ZNF143 are two human homologs of the transcriptional activator Staf. J. Biol. Chem. 273, 21998–22006 [DOI] [PubMed] [Google Scholar]
  • 20. Schuster C., Myslinski E., Krol A., and Carbon P. (1995) Staf, a novel zinc finger protein that activates the RNA polymerase III promoter of the selenocysteine tRNA gene. EMBO J. 14, 3777–3787 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Ngondo-Mbongo R. P., Myslinski E., Aster J. C., and Carbon P. (2013) Modulation of gene expression via overlapping binding sites exerted by ZNF143, Notch1 and THAP11. Nucleic Acids Res. 41, 4000–4014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Williams M., Brys A., Weiner A. M., and Maizels N. (1992) A rapid method for determining the molecular weight of a protein bound to nucleic acid in a mobility shift assay. Nucleic Acids Res. 20, 4935–4936 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Mead P. E., Zhou Y., Lustig K. D., Huber T. L., Kirschner M. W., and Zon L. I. (1998) Cloning of Mix-related homeodomain proteins using fast retrieval of gel shift activities (FROGS), a technique for the isolation of DNA-binding proteins. Proc. Natl. Acad. Sci. U.S.A. 95, 11251–11256 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Iwama A., Pan J., Zhang P., Reith W., Mach B., Tenen D. G., and Sun Z. (1999) Dimeric RFX proteins contribute to the activity and lineage specificity of the interleukin-5 receptor α promoter through activation and repression domains. Mol. Cell Biol. 19, 3940–3950 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Schaub M., Krol A., and Carbon P. (2000) Structural organization of Staf-DNA complexes. Nucleic Acids Res. 28, 2114–2121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Grossman C. E., Qian Y., Banki K., and Perl A. (2004) ZNF143 mediates basal and tissue-specific expression of human transaldolase. J. Biol. Chem. 279, 12190–12205 [DOI] [PubMed] [Google Scholar]
  • 27. Schödel J., Oikonomopoulos S., Ragoussis J., Pugh C. W., Ratcliffe P. J., and Mole D. R. (2011) High-resolution genome-wide mapping of HIF-binding sites by ChIP-seq. Blood 117, e207–e217 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Wang H., Zou J., Zhao B., Johannsen E., Ashworth T., Wong H., Pear W. S., Schug J., Blacklow S. C., Arnett K. L., Bernstein B. E., Kieff E., and Aster J. C. (2011) Genome-wide analysis reveals conserved and divergent features of Notch1/RBPJ binding in human and murine T-lymphoblastic leukemia cells. Proc. Natl. Acad. Sci. U.S.A. 108, 14908–14913 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Agrawal S., Hofmann W. K., Tidow N., Ehrich M., van den Boom D., Koschmieder S., Berdel W. E., Serve H., and Müller-Tidow C. (2007) The C/EBPδ tumor suppressor is silenced by hypermethylation in acute myeloid leukemia. Blood 109, 3895–3905 [DOI] [PubMed] [Google Scholar]
  • 30. Yuan C. C., Zhao X., Florens L., Swanson S. K., Washburn M. P., and Hernandez N. (2007) CHD8 associates with human Staf and contributes to efficient U6 RNA polymerase III transcription. Mol. Cell Biol. 27, 8729–8738 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Todeschini A. L., Georges A., and Veitia R. A. (2014) Transcription factors: specific DNA binding and specific gene regulation. Trends Genet. 30, 211–219 [DOI] [PubMed] [Google Scholar]
  • 32. Badis G., Berger M. F., Philippakis A. A., Talukder S., Gehrke A. R., Jaeger S. A., Chan E. T., Metzler G., Vedenko A., Chen X., Kuznetsov H., Wang C. F., Coburn D., Newburger D. E., Morris Q., et al. (2009) Diversity and complexity in DNA recognition by transcription factors. Science 324, 1720–1723 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Zheng G., and Yang Y. C. (2004) ZNF76, a novel transcriptional repressor targeting TATA-binding protein, is modulated by sumoylation. J. Biol. Chem. 279, 42410–42421 [DOI] [PubMed] [Google Scholar]
  • 34. Izumi H., Wakasugi T., Shimajiri S., Tanimoto A., Sasaguri Y., Kashiwagi E., Yasuniwa Y., Akiyama M., Han B., Wu Y., Uchiumi T., Arao T., Nishio K., Yamazaki R., and Kohno K. (2010) Role of ZNF143 in tumor growth through transcriptional regulation of DNA replication and cell-cycle-associated genes. Cancer Sci. 101, 2538–2545 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Wakasugi T., Izumi H., Uchiumi T., Suzuki H., Arao T., Nishio K., and Kohno K. (2007) ZNF143 interacts with p73 and is involved in cisplatin resistance through the transcriptional regulation of DNA repair genes. Oncogene 26, 5194–5203 [DOI] [PubMed] [Google Scholar]
  • 36. Heidari N., Phanstiel D. H., He C., Grubert F., Jahanbani F., Kasowski M., Zhang M. Q., and Snyder M. P. (2014) Genome-wide map of regulatory interactions in the human genome. Genome Res. 24, 1905–1917 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Chia N. Y., Chan Y. S., Feng B., Lu X., Orlov Y. L., Moreau D., Kumar P., Yang L., Jiang J., Lau M. S., Huss M., Soh B. S., Kraus P., Li P., Lufkin T., Lim B., Clarke N. D., Bard F., and Ng H. H. (2010) A genome-wide RNAi screen reveals determinants of human embryonic stem cell identity. Nature 468, 316–320 [DOI] [PubMed] [Google Scholar]
  • 38. Halbig K. M., Lekven A. C., and Kunkel G. R. (2012) The transcriptional activator ZNF143 is essential for normal development in zebrafish. BMC Mol. Biol. 13, 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Chen H. M., Pahl H. L., Scheibe R. J., Zhang D. E., and Tenen D. G. (1993) The Sp1 transcription factor binds the CD11b promoter specifically in myeloid cells in vivo and is essential for myeloid-specific promoter activity. J. Biol. Chem. 268, 8230–8239 [PubMed] [Google Scholar]
  • 40. Zhang D. E., Hetherington C. J., Tan S., Dziennis S. E., Gonzalez D. A., Chen H. M., and Tenen D. G. (1994) Sp1 is a critical factor for the monocytic specific expression of human CD14. J. Biol. Chem. 269, 11425–11434 [PubMed] [Google Scholar]
  • 41. López-Rodriguez C., Chen H. M., Tenen D. G., and Corbí A. L. (1995) Identification of Sp1-binding sites in the CD11c (p150,95α) and CD11a (LFA-1α) integrin subunit promoters and their involvement in the tissue-specific expression of CD11c. Eur. J. Immunol. 25, 3496–3503 [DOI] [PubMed] [Google Scholar]
  • 42. Khanna-Gupta A., Zibello T., Simkevich C., Rosmarin A. G., and Berliner N. (2000) Sp1 and C/EBP are necessary to activate the lactoferrin gene promoter during myeloid differentiation. Blood 95, 3734–3741 [PubMed] [Google Scholar]
  • 43. Klinakis A., Lobry C., Abdel-Wahab O., Oh P., Haeno H., Buonamici S., van De Walle I., Cathelin S., Trimarchi T., Araldi E., Liu C., Ibrahim S., Beran M., Zavadil J., Efstratiadis A., Taghon T., Michor F., Levine R. L., and Aifantis I. (2011) A novel tumour-suppressor function for the Notch pathway in myeloid leukaemia. Nature 473, 230–233 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Parker J. B., Yin H., Vinckevicius A., and Chakravarti D. (2014) Host cell factor-1 recruitment to E2F-bound and cell-cycle-control genes is mediated by THAP11 and ZNF143. Cell Rep. 9, 967–982 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Yin D. D., Fan F. Y., Hu X. B., Hou L. H., Zhang X. P., Liu L., Liang Y. M., and Han H. (2009) Notch signaling inhibits the growth of the human chronic myeloid leukemia cell line K562. Leuk. Res. 33, 109–114 [DOI] [PubMed] [Google Scholar]
  • 46. Ranganathan P., Weaver K. L., and Capobianco A. J. (2011) Notch signalling in solid tumours: a little bit of everything but not all the time. Nat. Rev. Cancer 11, 338–351 [DOI] [PubMed] [Google Scholar]
  • 47. Dejosez M., Levine S. S., Frampton G. M., Whyte W. A., Stratton S. A., Barton M. C., Gunaratne P. H., Young R. A., and Zwaka T. P. (2010) Ronin/Hcf-1 binds to a hyperconserved enhancer element and regulates genes involved in the growth of embryonic stem cells. Genes Dev. 24, 1479–1484 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Koschmieder S., Halmos B., Levantini E., and Tenen D. G. (2009) Dysregulation of the C/EBPα differentiation pathway in human cancer. J. Clin. Oncol. 27, 619–628 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Bailey S. D., Zhang X., Desai K., Aid M., Corradin O., Cowper-Sal Lari R., Akhtar-Zaidi B., Scacheri P. C., Haibe-Kains B., and Lupien M. (2015) ZNF143 provides sequence specificity to secure chromatin interactions at gene promoters. Nat. Commun. 2, 6186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Avellino R., Havermans M., Erpelinck C., Sanders M. A., Hoogenboezem R., van de Werken H. J., Rombouts E., van Lom K., van Strien P. M., Gebhard C., Rehli M., Pimanda J., Beck D., Erkeland S., Kuiken T., et al. (2016) An autonomous CEBPA enhancer specific for myeloid-lineage priming and neutrophilic differentiation. Blood 127, 2991–3003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Guo H., Cooper S., and Friedman A. D. (2016) In vivo deletion of the Cebpa +37 kb enhancer markedly reduces Cebpa mRNA in myeloid progenitors but not in non-hematopoietic tissues to impair granulopoiesis. PLoS One 11, e0150809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Nordeen S. K. (1988) Luciferase reporter gene vectors for analysis of promoters and enhancers. BioTechniques 6, 454–458 [PubMed] [Google Scholar]
  • 53. Zaret K. S., and Stevens K. A. (1990) Selection and analysis of galactose metabolic pathway variants of a mouse liver cell line. Mol. Cell Biol. 10, 4582–4589 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Niebuhr B., Iwanski G. B., Schwieger M., Roscher S., Stocking C., and Cammenga J. (2009) Investigation of C/EBPα function in human (versus murine) myelopoiesis provides novel insight into the impact of CEBPA mutations in acute myelogenous leukemia (AML). Leukemia 23, 978–983 [DOI] [PubMed] [Google Scholar]
  • 55. Chen X., Fang F., Liou Y. C., and Ng H. H. (2008) Zfp143 regulates Nanog through modulation of Oct4 binding. Stem Cells 26, 2759–2767 [DOI] [PubMed] [Google Scholar]
  • 56. Pahl H. L., Burn T. C., and Tenen D. G. (1991) Optimization of transient transfection into human myeloid cell lines using a luciferase reporter gene. Exp. Hematol. 19, 1038–1041 [PubMed] [Google Scholar]
  • 57. Bradford M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254 [DOI] [PubMed] [Google Scholar]
  • 58. Schaub M., Myslinski E., Krol A., and Carbon P. (1999) Maximization of selenocysteine tRNA and U6 small nuclear RNA transcriptional activation achieved by flexible utilization of a Staf zinc finger. J. Biol. Chem. 274, 25042–25050 [DOI] [PubMed] [Google Scholar]
  • 59. Maxam A. M., and Gilbert W. (1980) Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65, 499–560 [DOI] [PubMed] [Google Scholar]
  • 60. Rhee H. S., and Pugh B. F. (2011) Comprehensive genome-wide protein-DNA interactions detected at single-nucleotide resolution. Cell 147, 1408–1419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Frank S. R., Schroeder M., Fernandez P., Taubert S., and Amati B. (2001) Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation. Genes Dev. 15, 2069–2082 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Data

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES