Detection of bla_CTX-M Extended Spectrum Beta-lactamase Producing Salmonella enterica Serotype Typhi in a Tertiary Care Centre

Abstract

Introduction

Infections caused by Salmonella are an important public health threat in tropical and subtropical countries. Due to the emergence of resistance to ampicillin, chloramphenicol and trimethoprim/sulfamethoxazole (multidrug resistant salmonellae) in the late 1980s, fluoroquinolones and extended spectrum cephalosporins became the drugs of choice. Resistance to cefotaxime and ceftriaxone due to the production of Extended Spectrum Beta-Lactamase (ESBL) and reduced susceptibility to ciprofloxacin have emerged resulting in treatment failure. The Cefotaximase (CTX-M) type ESBLs are the most widespread beta lactamase among Enterobacteriaceae including salmonellae.

Aim

To detect the presence of bla_CTX-M in salmonellae causing human infections. Detection of qnr genes to identify the coexistence of bla_CTX-M and qnr gene.

Materials and Methods

The study included 103 consecutive, non-repetitive salmonellae isolated from clinical specimens obtained from July 2015- June 2016 which were identified up to species level by conventional/automated methods. Susceptibility to various classes of antimicrobial agents was determined by disc diffusion method. Minimum Inhibitory Concentration (MIC) to cefotaxime and ceftriaxone was determined by agar dilution method. The results were interpreted in accordance with Clinical & Laboratory Standard Institute (CLSI) (guidelines 2015. Detection of the ESBL phenotype was performed by the combined disk method. Polymerase Chain Reaction (PCR) amplification of all isolates was performed using group specific primers to characterize the presence of bla_CTX-M, qnrA, qnrB and qnrS.

Result

Of the 103 study isolates two isolates of Salmonella typhi were resistant to cefotaxime and ceftriaxone and had a MIC of 128μg/ml. PCR amplification and sequencing detected the presence of bla_CTX-M-15 in these two isolates. These two isolates exhibited resistance to ciprofloxacin in vitro but qnr gene was not detected in these isolates.

Conclusion

Resistance to third generation cephalosporins among salmonellae is a cause for concern as it may lead to treatment failure. It is imperative to continuously monitor the susceptibility pattern as enteric fever is endemic in India.

Introduction

Infections caused by Salmonella are an important public health threat in tropical and subtropical countries. In the past, ampicillin, chloramphenicol and trimethoprim/sulfamethoxazole were the antibiotics used for the treatment of enteric fever [1]. Due to the emergence of multidrug resistant among salmonellae in the late 1980s, fluoroquinolones namely ciprofloxacin and extended spectrum cephalosporins such as ceftriaxone and cefotaxime became the drugs of choice [1]. More recently azithromycin has been found to be effective in the treatment of enteric fever [2,3]. Among Salmonella typhi resistance to cefotaxime and ceftriaxone due to the production of ESBL and reduced susceptibility to ciprofloxacin resulting in treatment failure is being reported from many countries [4].

The ESBLs reported in salmonellae includes TEM, SHV, PER and CTX-M [5]. Among Enterobacteriaceae including salmonellae, the Cefotaximase (CTX-M) type ESBLs are the most widespread beta-lactamase. The earliest CTX-M1 type Cefotaximase was isolated in 1989 in Germany [6]. They belong to Ambler class A and are mainly plasmid borne. They hydrolyse cefotaxime more effectively than ceftazidime or ceftriaxone. These enzymes have 40% identity with the TEM or SHV type beta-lactamase. The CTX-M enzyme consists of 40 types [7].

Seven CTX-M beta lactamases (CTX-M 2,3,4,5,6,7,9,15) in Salmonella enterica have been reported from South America, Europe and Mediterranean countries. Of these, CTX-M 5,9,15 have been reported predominantly in the non-typhoidal strains [5]. However, CTX-M in Salmonella enterica serotype typhi is rarely described from Indian isolates [8]. This study was therefore undertaken to detect the presence of bla_CTX-M in salmonellae causing human infections. Fluoroquinolone resistance occurs either due to mutation in the quinolone resistance determining region of gyrA, gyrB, parC and parE or due to plasmid mediated resistance of qnr type [9]. Since, it has been found that the cephalosporin resistance mediated by ESBL often coexists with qnr genes that encodes for ciprofloxacin resistance, detection of qnr genes was also done [4]. Thus this study was done to detect bla_CTX-M in salmonellae that cause human infections and to identify the coexistence of bla_CTX-M and qnr gene.

Materials and Methods

This prospective period study was conducted at Sri Ramachandra Medical College and Research Institute after obtaining Institutional ethics committee approval. The study was conducted form July 2015 to June 2016.

Inclusion Criteria

All isolates of Salmonella from clinical samples with a relevant clinical history.

Exclusion Criteria

Duplicate isolates from the same patient were excluded.

Bacterial Isolates

One hundred and three Salmonella isolates from clinical specimens such as blood (94), stool (7), cerebrospinal fluid (1) and pus from splenic abscess (1) collected were included in the study. All the isolates were identified up to species level by conventional /automated methods using VITEK-2 system (Vitek2 GN-card; BioMerieux, Brussels, Belgium). The isolates were serotyped on the basis of agglutination with somatic O, phase I flagellar H antigens by the slide agglutination tests with antisera (King Institute, Chennai) as specified by the Kauffmann- White scheme.

Antimicrobial Susceptibility Testing

By the disk diffusion antimicrobial susceptibility was determined on Mueller-Hinton agar and interpreted according to the guidelines of the CLSI 2015. The antibiotics tested were ciprofloxacin (5 μg), ceftriaxone (30 μg) and cefotaxime (30 μg), chloramphenicol (30 μg), trimethoprim/sulfamethoxazole (1.25/23.75 μg), ampicillin (10 μg), azithromycin (15 μg). MIC to cefotaxime and ceftriaxone was determined by agar dilution method with the range tested being 0.008-128 μg/ml and interpreted in accordance with CLSI guidelines 2015 [10].

Detection of the ESBL phenotype was performed by the combined disk method using cefotaxime (30 μg) and ceftazidime (30 μg), based on the inhibitory effect of clavulanic acid [5,7]. Escherichia coli (ATCC^® 25992^™) (negative control) and Klebsiella pneumoniae (ATCC^® 700603^™) (positive control) were used as controls. The zone diameter difference of >5 mm for either antimicrobial agent tested in combination with clavulanic acid versus the zone diameter of the agent when tested alone, was considered indicative of production of ESBL

Polymerase Chain Reaction (PCR) amplification

All isolates were subjected to PCR using group specific primers to characterise the bla_CTX-M [10]. Co-existence of qnrA, qnrB and qnrS were also looked for [11]. The primers used in the study are shown in [Table/Fig-1].

[Table/Fig-1]:

Primers used in the study.

Gene	Primer Sequence 5′- 3′	Product size
blaCTX-M	CTX-M-F: CGCTGTTGTTAGGAAGTGTG CTX -M-R: GGCTGGGTGAAGTAAGTGAC	754bp
qnrA	qnrA- F: ATTTCTCACGCCAGGATTTG qnrA- R: GATCGGCAAAGGTTAGGTCA	516-bp
qnrB	qnrB- F: GATCGTGAAAGCCAGAAAGG qnrB- R: ACGATGCCTGGTAGTTGTCC	469-bp
qnrS	qnrS- F: ACGACATTCGTCAACTGCAA qnrS- R : TAAATTGGCACCCTGTAGGC	417-bp

F- Forward primer.

R- Reverse primer.

Extraction of DNA: DNA was extracted from the study isolates by boiling method. A single colony was inoculated into 1.5ml of Luria Bertani broth and incubated overnight. This was centrifuged at 10,000 rpm for 10 minutes. The pellets were suspended in 500μl of distilled water and lysed by heating at 100°C for 10 minutes and centrifuged for 1 minute. The supernatant was utilized as a template for amplification.

PCR conditions for bla_CTX-M: 2 μl of the supernatant was mixed in the 23 μl of the master mix, which contained 0.1 μl of Taq polymerase (Takara Bio Inc.) in 2.5 μl of 10x Taq polymerase buffer, 0.5 μl of dNTP ((Takara Bio Inc.), 1 μl of primer and 18.9 μl Milli Q. Amplification reactions were performed under the following conditions: initial denaturation at 94°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds with an extension at 72°C for 50 seconds, and a final extension for one cycle at 72°C for 5 minutes. The PCR product was then run on a 1.5% agarose gel for detection of the amplified fragment [11].

PCR conditions for qnrA, qnrB and qnrS: A 2 μl of the supernatant was mixed in the 23 μl of the master mix, which contained 0.1 μ l of Taq polymerase (TaKaRa Bio Inc.) in 2.5 μl of 10x Taq polymerase buffer, 0.5 μl of dNTP (TaKaRa Bio Inc.), 1 μl of primer and 18.9 μl Miili Q.

Amplification reactions were performed under the following conditions: initial denaturation at 94°C for 5 minutes, followed by 32 cycles of denaturation at 94°C for 45 seconds, annealing at 53°C for 45 seconds with an extension at 72°C for 60 seconds, and a final extension for one cycle at 72°C for 5 minutes. The PCR product was then run on a 1.5% agarose gel for detection of the amplified fragment [12].

DNA Sequencing

The DNA of bla_CTX-M positive isolates was extracted with PureLink Genomic DNA Kit (Invitrogen), according to the user manual provided with the kit and subjected to automated DNA sequencing (ABI 3100, Genetic Analyser, Applied Biosystems, Foster city, CA, USA). The aligned sequences were analysed with the Bioedit sequence program and similarities searches for the nucleotide sequences were performed with the BLAST program.

Clinical History

The clinical history of the patients with ESBL producing Salmonella infection was collected retrospectively from the medical records department. The data collected were the chief complaints during admission, course in the hospital stay, treatment given and the outcome.

Results

Of the 103 study isolates, the majority were Salmonella typhi (68), followed by Salmonella paratyphi A (26). The others serotypes were Salmonella typhimurium (7) and Salmonella enteritidis (2).

The antimicrobial susceptibility profile of the 103 Salmonella isolates was ampicillin 87.4% (90/103), chloramphenicol 96.1% (99/103), cotrimoxazole 96.1% (99/103) ciprofloxacin 91.2%(94/103), ceftriaxone 98.1%(101/103), cefotaxime 98.1%(101/103) and azithromycin (100%).

MIC₉₀ to both cefotaxime and ceftriaxone was 1 μg/ml. Two isolates of Salmonella typhi which were isolated from blood culture were resistant to cefotaxime and ceftriaxone and had a MIC of 128μg/ml. PCR amplification and sequencing detected the presence of bla_CTX-M-15 in these isolates. PCR for bla_CTX-M-15 is shown in [Table/Fig-2]. qnr was not detected in any of the study isolates.

[Table/Fig-2]:

PCR for bla_{CTX-M 15.}

Lanes 1: Molecular mass marker (100bp DNA ladder); Lane 2: Positive control (Previous positive bla_CTX-M was confirmed by gene sequencing); Lane 3: bla_CTX-M15 positive (amplicon size- 754 bp); Lane 4: Negative control - E.coli ATCC® 25992^™

Discussion

Enteric fever is endemic in India with Salmonella enterica var Typhi (S. typhi) and Salmonella enterica var Paratyphi A (S. paratyphi A) being the major causative agents [1]. These pathogens are transmitted by the faeco-oral route in regions with poor standards of hygiene and sanitation accounting for high morbidity and mortality. Antibiotic therapy constitutes the mainstay of management of enteric fever. Failure to treat an infection properly leads to prolonged illness, complications and development of carrier state. Fluoroquinolones and third-generation cephalosporins were used for the treatment of salmonellae infections after the emergence of MDR Salmonellae (resistant to ampicillin, chloramphenicol and co-trimoxazole) [9,13,14]. This lead to the occurrence of reduced susceptibility to ciprofloxacin. Resistance to third-generation cephalosporins among salmonellae though low at present (1%) is also emerging in India [3].

Plasmid-mediated quinolone resistance is mediated by qnr genes which encode a protein that protects DNA gyrase from ciprofloxacin and by aac(6′)-Ib-cr, an aminoglycoside modifying enzyme with activity against ciprofloxacin. Plasmids bearing qnr or aac(6′)-Ib-cr may also carry an extended spectrum cephalosporin resistance gene, which results in the development of resistance to both fluoroquinolone and cephalosporin and thereby limiting the therapeutic options available for the management of invasive salmonellosis [4,15]. In this study the CTX-M bearing salmonellae did not harbor the qnr genes, though they exhibited resistance to ciprofloxacin in vitro. Hence, the presence of other quinolone resistance mediators like gyr A, gyr B and par C should be looked for.

In countries like Germany, Philippines and Kuwait CTX-M-15 and SHV-12 has been described in typhoidal Salmonellae which showed high-level resistance to ceftriaxone. S. typhi producing ACC-1 AmpC β- lactamase has been reported from India [4,16]. Though ESBL producing Non typhoidal Salmonella have been cited worldwide, their occurrence in serovar Typhi and Paratyphi A is not common [9,15,17].

The incidence of CTX-M-15 among enteric fever producing salmonellae is not alarming as evident in this study, but the potential for their widespread dissemination may result in treatment failures. In many tropical countries including the Indian subcontinent, the widespread availability and uncontrolled use of antibiotics can lay the foundation for rapid dissemination [18].

Since, the bla_CTX-M is located on plasmids in conjunction with mobile genetic elements such as IS EcpI, they disseminate rapidly. Gene transfer experiments in many studies have been performed to localize their position on plasmids. But non-transferrable bla_CTX-M has also been described suggesting their possible chromosomal location. There is a reservoir of ESBLs and CTX-M genes among Escherichia coli and Klebsiella pneumoniae which constitutes a huge risk factor for spread of resistance to other pathogenic Enterobacteriaceae [19]. Additionally, use of third generation cephalosporins to treat enteric fever and other infections caused by Salmonella species may the increase the incidence of CTX-M producing salmonellae. Decreased susceptibility to ciprofloxacin among Salmonella species has also contributed to the increased use and subsequent development of resistance to cephalosporins among salmonellae. The continued surveillance of cephalosporin resistant Salmonella in combination with prudent use of these agents both in animals and humans is crucial for limiting the spread of CTX-M producing salmonellae [19].

There are 2 reports of occurrence of CTX-M15 type ESBL in Salmonella enterica. This includes two Indian patients with Salmonella typhi and 2 others with paratyphi C and paratyphi A. All were travellers returning from India to UAE and Japan respectively [17,20].

The occurrence of bla_CTX-M15 in conjunction with quinolone resistance is alarming because it further limits the therapeutic options available for typhoid fever especially in endemic countries such as India [15]. In the past CTX-M15 ESBLs have been found exclusively in Escherichia coli and Klebsiella species. Salmonella strains can acquire the gene encoding for this enzyme from Escherichia coli and Klebsiella species in the community. This speculation is supported by the fact that the mobile genetic element ISEcpI is responsible for mobilization of the bla genes and it is identified upstream of several bla_CTX-M genes [17] .

Azithromycin is presently being used for the management of uncomplicated typhoid fever and associated with a prompt resolution of clinical symptoms and low prevalence of relapse and convalescent fecal carriage [12]. However, azithromycin treatment failure in a patient with invasive salmonellae infection has been described [21].

Conclusion

To conclude, enteric fever producing salmonellae harbor the CTX-M gene thus making cefotaxime ineffective for treatment. This also implies that use of other third generation cephalosporins for treatment may result in failure of therapy. Though the incidence of CTX-M in this study is not alarming, the potential for rapid dissemination due to the location of the genetic elements and the huge reservoir encountered in Enterobactericeae is a cause for concern.

Limitation

In present study, sample size was too small to conclude any statistically significant results. Also, further studies on Salmonella harboring TEM, SHV and PER genes needs to be carried out as these genes also confers resistance to third generation cephalosporins.

Financial or Other Competing Interests

None.