The relationship between p53 codon 72 genetic polymorphism and sperm parameters. A study of men with varicocele

Abstract

Purpose

Regulation of the apoptotic process has an important role in spermatogenesis. p53 has a prominent function in apoptosis and recent data suggest a relationship between varicocele and p53 codon 72 polymorphism and male infertility. This prompted us to study the relationship between this polymorphism and spermatic parameters.

Methods

We studied 134 subjects with varicocele admitted consecutively to the outpatients Department of Infertility at the University of Rome La Sapienza. We investigated in these subjects the effect of a strong apoptosis inducer, the p53 codon 72 *Arg/*Arg genotype, on spermatic parameters.

The p53 codon 72 genotype was determined by DNA analysis.

Results

The proportion of spermatozoa with abnormal (curvilinear) motility is higher in men with the *Arg/*Arg genotype than in men carrying the *Pro allele (p = 0.003). No statistical significant relationship has been observed with spermatozoa concentration and atypical spermatozoa.

Conclusions

We conclude: the p53 codon 72*Arg/*Arg genotype, with its strong apoptotic effects, negatively influences spermatozoa motility and male fertility.

Introduction

Apoptosis has an important role during spermatogenesis. Deregulation of the apoptotic process and in particular, increased apoptosis, leads to defective sperm function and infertility. Of the known factors involved in regulation of apoptosis p53 has a prominent role promoting normal semen quality [1, 2]. A relationship between p53 and varicocele has been observed [3] and more recently an association between p53 polymorphisms and male infertility has been reported [4, 5].

Codon 72 in exon 4 of the p53 gene contains a G to C polymorphism that encodes an arginine to proline substitution. The amino acid change affects the biochemical and functional properties of p53. The proline variant is a stronger transcriptional activator whereas the arginine variant is a stronger apoptosis inducer. In Iranian males a statistically significant increase of incidence of the *Arg allele was observed among infertile men as compared to controls [4].

We previously studied the relationship between spermatic parameters and acid phospatase locus 1 (ACP₁) genetic polymorphism in a subsample of subjects presently considered [6]. Correlation analysis showed that sperm concentration and atypical spermatozoa are associated with this genetic polymorphism. On the contrary, spermatozoa motility is not associated with ACP₁ and a principal component analysis (see “Materials and methods”) suggests that this variable belongs to another independent group of associated variables.

Here we have examined the relationship between the p53 codon 72 polymorphism and spermatic parameters in a sample of men with varicocele.

Materials and methods

Subjects

134 subjects with varicocele admitted consecutively to the Outpatients Department were studied: 75 were infertile. All patients gave written informed consent to participate in the study that was approved by the Ethical Committee.

Diagnosis of varicocele was confirmed by use of the scrotal eco‐colordoppler (TOSHIBA APLIO XV). Analysis of spermatic liquid was performed according to the World Health Organization (WHO) criteria (1999). Seminal liquid was obtained after sexual abstinence for three to five days. All subjects had no fever, no pharmacological treatment with non‐steroidal anti‐inflammatory drugs, antibiotics or cortisones in the two weeks preceding the examination. The whole spermatic liquid was collected in a sterile container and delivered to the laboratory within 60 min.

Spermatic parameters were determined from the seminal liquid. Spermatic concentration is reported as millions of spermatozoa/ml. Atypical spermatozoa and abnormal motility are reported in percent (%).

A couple is defined infertile if they are unable to conceive after one year of regular sexual intercourses with the intent to conceive.

A sample of 730 healthy subjects (blood donors) of both sexes was considered as the control for the frequency of p53 codon 72 polymorphism.

p53 codon 72 polymorphism was determined by DNA analysis of blood specimens.

Determination of p53 codon 72 polymorphism

The p53 polymorphism was evaluated using the restriction fragment length polymorphism polymerase chain reaction method described by De La Calle Martin et al. [7]. The primer sequences corresponding to the fourth exon of the human p53 gene were as follows: sense oligo 5′–AATGGATGATTTGATGCTGTCCC–3′ and antisense oligo 5′–GGTGCAAGTCACAGACTTGGC–3′. Polymerase chain reactions were carried out in a total volume of 25 µL containing 200 ng of genomic DNA, 0.4 pmol of each primer, 2 mmol/L MgCl₂, 200 µmol/L deoxynucleotide triphosphates, 1 × buffer and 2 U Taq polymerase. Amplification was performed for 35 cycles with an annealing temperature of 62 °C. Amplified DNA was digested for 3 h with 3 U of AccII restriction enzyme. The DNA fragments were resolved by electrophoresis through a 3 % agarose gel (see Fig. 1).

Figure 1.

Electrophoresis through a 2 % agarose gel of DNA fragments. From left to right: *Arg/*Pro; *Arg/*Pro; *Arg/*Arg; *Arg/*Pro; *Arg/*Pro; *Arg/*Arg; *Arg/*Pro; *Arg/*Arg; *Arg/*Arg; *Arg/*Pro; *Arg/*Pro

Statistical analysis

Independence was evaluated by Chi square analysis, the difference between means was assessed via a Student t test and a Mann–Whitney U‐test and correlation analysis was assessed using a Spearman Rho test. We performed a principal component analysis to determine whether an underlying relationship exists between the variables examined. By using the procedure of starting from an array of correlation coefficients the data may be reduced to a smaller set of components giving useful information about the structuring of variables investigated. The exploratory use of principal component analysis allows for detection of patterning of variables with a potential for discovering new concepts. Indeed, by this method it is possible to analyze the association among different sperm parameters and the relationship between groups of associated sperm parameters and genetic polymorphisms.

Analyses were performed using commercial software (SPSS).

Results

Table 1 shows demographic and clinical parameters of the study samples. Statistically significant differences between fertile and infertile men have been observed for alcohol (p = 0.004), age (p = 0.000), spermatozoa concentration (p = 0.01) and atypical spermatozoa (p = 0.001).

Table 1.

Demographic and clinical parameters of study samples. Spermatozoa concentration is in million/ml and atypical spermatozoa is in percent

	Fertile men		Infertile men		Significance of difference
	Proportion		Proportion
Urinary infections	14.5 %		9.6 %		p = 0.420
Alcohol	7.6 %		26.8 %		p = 0.004
Narcotics	9.2 %		3.6 %		p = 0.409
Smoking	37.1 %		33.3 %		p = 0.220
	Mean	SE	Mean	SE
Age (years)	27.54	0.80	37.77	0.63	p = 0.000
Body Mass Index	23.74	0.45	25.62	1.09	p = 0.077
Spermatozoa concentration	58.40	6.49	36.15	5.41	p = 0.010
Atypical spermatozoa	66.21	2.42	77.91	2.29	p = 0.001
Abnormal motility	12.36	1.90	13.72	1.41	p = 0.581

SE standard error

Table 2 shows the distribution of p53 codon 72 genotypes in men with varicocele and in the general population. No statistically significant difference is observed between men with varicocele and controls nor between fertile and infertile men with varicocele. In infertile men, however, there is a tendency for a higher proportion of *Arg/*Arg and to a lower proportion of *Pro/*Pro genotype as compared to fertile men and to controls.

Table 2.

Distribution of p53 codon 72 genotypes in men with varicocele and in the general population

	P53 genotype
	*Arg/*Arg	*Arg/*Pro	*Pro/*Pro	Total no.
All men with varicocele (a)	65 48.5 %	61 45.5 %	8 6.0 %	134
Infertile (b)	38 50.7 %	34 45.3 %	3 4.0 %	75
Fertile (c)	27 45.8 %	27 45.8 %	5 8.5 %	59
General population (d)	356 48.8 %	294 40.3 %	80 10.9 %	730
Chi square test of independence		χ 2	df	p
(a) vs (d)		3.527	2	0.171
(b) vs (c)		1.273	2	0.529

Df degree of freedom

Table 3 shows the distribution of spermatic parameters in men with varicocele in relation to p53 codon 72 genotype. The proportion of spermatozoa with abnormal (curvilinear) motility is higher in men with the *Arg/*Arg genotype than in men carrying the *Pro allele (p = 0.016). This is observed in both fertile and in non‐fertile men, but is more marked in infertile men. Spermatic concentration and atypical spermatozoa do not show statistically significant differences between the *Arg/*Arg genotype and the genotypes carrying the *Pro allele.

Table 3.

Distribution of spermatic parameters in men with varicocele in relation to p53 codon 72 genotype

		*Arg/*Arg genotype			Carriers of the *Pro allele			Significance of difference (p)
		Mean	SE	No.	Mean	SE	No.	between variances	between means
Spermatozoa concentration	All	46.7	6.2	65	49.8	6.4	69	0.33	0.73
	Infertile	38.8	7.8	38	33.8	7.6	37	0.59	0.65
	Fertile	52.9	9.1	27	64.8	9.7	32	0.65	0.37
Atypical spermatozoa	All	68.8	2.7	65	73.6	2.4	69	0.31	0.18
	Infertile	73.8	3.8	38	81.9	2.5	37	0.32	0.08
	Fertile	64.8	3.7	27	66.7	3.4	32	0.42	0.69
Abnormal motility	All	15.9	1.9	65	10.0	1.3	69	0.06	0.016
	Fertile	14.2	1.8	27	10.4	2.3	32	0.61	0.19
	Infertile	17.4	3.2	38	9.7	1.5	37	0.012	0.038

Statistically significant differences are shown in bold. Spermatozoa concentration is expressed in million/ml. Atipical spermatozoa and abnormal motility values are means of percentages

SE standard error

No statistically significant effect of p53 codon 72 polymorphism has been observed on the following parameters: quantity of seminal liquid, pH of seminal liquid and the degree of varicocele. The last parameter, however, shows a border line increase in infertile men (p = 0.09, data not shown).

The relationship between p53 codon 72 genotype and abnormal motility is not influenced by the following variables: smoking, age or alcohol (data not shown).

Table 4 shows a non‐parametric analysis (Mann–Whitney U test) of the relationship between abnormal spermatozoa motility and the p53 codon 72 genotype. Subjects carrying the *Arg/*Arg genotype show a mean value rank equal to 49.97 for abnormal spermatozoa motility while carriers of *Pro show a mean value rank equal to 34.29 (p = 0.003).

Table 4.

Non parametric analysis (Mann–Whitney U test) of the association between abnormal motility and the p53 codon 72 genotype

	*Arg/*Arg	*Pro allele carriers
Mean rank	49.97	34.29
Total no.	65	69
Mann–Whitney U test	Z	p
551.500	−3.02	0.003

Table 5 shows a principal component analysis performed on spermatic parameters, p53 codon 72 and acid phosphatase locus 1 (ACP₁). ACP₁ is a phosphoprotein‐tyrosine‐phosphatase that is able to dephosphorylate platelet‐derived growth factor receptors (PDGFRs). Decreased activity of PDGFR is associated with severe spermatogenic impairment. In a subsample of subjects examined we found that an ACP₁ genotype with high enzymatic activity is associated with low spermatic concentration and with an increase of atypical spermatozoa concentration [6]. By principal component analysis we attempted to separate the spermatic parameters associated with ACP₁ from those associated with p53 codon 72. In the entire sample and in the subsample of infertile men two statistically significant components are extracted. The first represents the correlation of ACP₁ with spermatozoa concentration and atypical spermatozoa; the second component represents the correlation between p53 codon 72 and abnormal motility of spermatozoa. Such a pattern is clearly observable in infertile men; on the contrary, in fertile men the relationship between ACP₁ and spermatozoa parameters tends to disappear while the relationship between p53 and abnormal motility persists. This suggests that p53 influences abnormal spermatozoa motility in all men with varicocele independently of their reproductive capacity while the effects of ACP₁ on spermatozoa parameters are strictly correlated to infertility.

Table 5.

Principal component analysis of spermatozoa parameters, ACP₁ and p53 codon 72

	All		Infertile		Fertile
	Factor 1	Factor 2	Factor 1	Factor 2	Factor 1	Factor 2
Spermatozoa concentration	0.72	−0.13	0.64	−0.34	0.73	0.34
Atypical spermatozoa	−0.63	0.37	−0.63	0.39	−0.71	0.08
Abnormal motility	0.04	−0.79	−0.12	−0.82	0.45	−0.64
ACP1	0.53	0.06	0.56	0.07	0.19	0.17
p53	0.04	0.69	−0.12	0.61	−0.13	0.72
Variance (%)	27.5	21.6	29.3	22.2	23.0	21.9

Only coefficients ≥0.5 have been considered significant and are shown in bold. Factors (components) represent groups of association

Discussion

Our study indicates that in subjects with varicocele the proportion of spermatozoa with abnormal motility is higher in men with the*Arg/*Arg genotype than in men carrying the *Pro allele. The association is present in both fertile and infertile men suggesting an underlying relationship between p53 codon 72 and varicocele. The data in Table 5 indicate that p53 influences abnormal spermatozoa motility in all men with varicocele independently of their reproductive capacity, while the effects of ACP₁ on spermatozoa parameters are strictly correlated with infertility. The fact that spermatozoa concentration and atypical spermatozoa are associated with ACP₁ and not with p53 while abnormal motility is associated with p53 and not with ACP₁ suggests that different mechanisms and, probably, different metabolic pathways underlying these associations.

ACP₁ may act on the first two parameters through a modulation of platelet‐derived growth factor (PDGF) signaling while abnormal motility could depend on the modulation of apoptosis. The *Arg/*Arg genotype with its pro‐apoptotic activity could negatively influence spermatozoa motility and consequently male fertility.

p53 has an important role in apoptosis and is more expressed in sperm cells of men with varicocele than in normal subjects [3]. Deregulation of the apoptotic process due to p53 genetic variability during spermatogenesis with subsequent defective sperm formation could therefore be more marked in men with varicocele, resulting in negative effects on fertility.

Mashayekhi and Hadiyan [4] found that carriers of the *Arg/*Arg genotype of p53 codon 72 polymorphism have a high risk of developing idiopathic infertility. Abnormal spermatozoa mobility in infertile men with varicocele carrying this genotype, presently reported, is in line with the negative effect of *Arg/*Arg on male fertility reported by these authors.

One could imagine that increased apoptosis leads to a decreased sperm concentration; the present data, however, do not show a significant association between this parameter and the p53 codon 72 genotype. Deregulation of apoptosis due to genetic variability of p53 may have a specific influence on spermatozoa motility. Indeed, the analysis in Table 5 suggests that other spermatic parameters are not correlated with p53 codon 72 polymorphism but are correlated with another genetic factor. Thus, our observations could represent the basis for further studies on the biochemical pathways underlying spermatogenesis and spermatozoa parameters.

From a practical point of view these observations may have importance in early identification of subjects at high risk of infertility. The present data, however, should be confirmed in other independent clinical settings before drawing definitive conclusions. The limitation of the present study is mainly represented by the relatively small number of subjects examined.

Our study of varicocele suggests a relationship between p53 codon 72 and spermatic motility that could be due to the increased apoptosis in cells from carriers of the *Arg/*Arg genotype. This may contribute to infertility observed in men with varicocele. It is likely, however, that other factors are involved. For example, infertile men are about ten years older than fertile ones (see Table 1). On the other hand, although smoking habits are comparable, ten additional years of nicotine consumption may have increased the rate of apoptosis.

Conflict of interest

Vincenzo Gentile, Maria Nicotra, Sergio Minucci, Sara Ambrosi, Patrizia Saccucci, Fulvia Gloria‐Bottini and Egidio Bottini declare that they have no conflict of interest.

Human rights statements and informed consent

All procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional) and with the Helsinki Declaration of 1964 and its later amendments. Informed consent was obtained from all patients for being included in the study.

Animal studies

This article does not contain any studies with animal subjects performed by any of the authors.