T helper type 1 polarizing γδ T cells and Scavenger receptors contribute to the pathogenesis of Pemphigus vulgaris

Summary

γδ T cells and Scavenger receptors are key parts of the innate immune machinery, playing significant roles in regulating immune homeostasis at the epithelial surface. The roles of these immune components are not yet characterized for the autoimmune skin disorder Pemphigus vulgaris (PV). Phenotyping and frequency of γδ T cells estimated by flow cytometry have shown increased frequency of γδ T cells (6·7% versus 4·4%) producing interferon‐ γ (IFN‐γ; 35·2% versus 26·68%) in the circulation of patients compared with controls. Dual cytokine‐secreting (IFN‐γ and interleukin‐4) γδ T cells indicate the plasticity of these cells. The γδ T cells of patients with PV have shown higher cytotoxic potential and the higher frequency of γδ T cells producing IFN‐γ shows T helper type 1 polarization. The increased expression of Scavenger receptors expression (CD36 and CD163) could be contributing to the elevated inflammatory environment and immune imbalance in this disease. Targeting the inflammatory γδ T cells and Scavenger receptors may pave the way for novel therapeutics.

Introduction

Pemphigus vulgaris (PV) is an autoimmune blistering disease affecting the skin and mucous membranes. It is the most severe and common form of Pemphigus,1, 2 and worldwide, accounts for 70% of all Pemphigus cases.3 In India, PV is the frontrunner among all cases of Pemphigus, and it has an early age of onset, i.e. 30–40 years, compared with global data.4 The disease is caused by autoreactive antibodies belonging to the IgG class, which are directed against desmogleins. The antigenic stimulus for PV is mainly attributed to the protein Desmoglein 3 (Dsg3), but more than 50% of the patient population shows circulating antibodies to both Dsg1 and Dsg3.5, 6, 7 The pathological manifestation of blister formation in PV is due to a phenomenon called acantholysis. The pathogenesis and pathophysiology of PV depend on various factors like cellular immunity, genetic factors, ethnicity, diet and environment.8, 9

Autoimmune diseases are caused by a breach in tolerance and by anomalous function of the immune system. The cellular component of the immune system, i.e. T‐cell subsets, play a crucial role in the pathogenesis of several autoimmune diseases.10 Based on their expression of surface T‐cell receptor (TCR), T cells are classified into two major groups αβ T cells and γδ T cells. The αβ T cells are the most common type, whereas the γδ T cells are of limited abundance. In the case of humans, γδ receptor‐expressing T cells constitute about 1–10% of total circulating T cells.11 They are programmed for immune response at the epithelial tissue site and mucosal surface. They recognize pathogens through their receptors γδ TCR and have the unique property of recognizing the antigens in an MHC‐independent manner. The γδ T cells are capable of activating and regulating both T helper type 1 (Th1) and Th2 immune responses in infections.12 The majority of the circulating γδ T cells in human blood contain Vγ9 and Vδ2 chains with the potential to activate dendritic cells and B lymphocytes, ultimately driving the immune response.13 Human γδ T cells show their functional diversity by producing Th1 cytokines interferon‐γ (IFN‐γ), interleukin‐2 (IL‐2) and induce conditions to produce Th2 (IL‐4, IL‐5 and IL‐13) cytokines. Recent studies have found that a group of activated γδ T cells produce IL‐17 cytokine.12, 14, 15, 16 A significant role for γδ T cells and their inflammatory cytokines has already been suggested in several diseases including leprosy, systemic sclerosis and psoriasis.17, 18, 19 The considerable role of cellular immunity in PV is least explored and there studies are limited. Our group has reported the crucial role of the Th17 and regulatory T cells and their functional imbalance in the pathogenesis of PV.20 Till now the role of γδ T cells has not been explored to provide a clear insight into the immunopathogenesis of PV.

The overall immune response in an autoimmune disease is the cumulative function of the initial immune response generated by the innate immune system followed by the much advanced adaptive components. Scavenger receptors are a group of pattern recognizing receptors (PRRs) found across several vertebrate species, known to play a crucial role in the host immune response. These receptors comprise eight transmembrane glycoproteins (A–H). They are predominately expressed by the innate immune cells like the γδ T cells, natural killer cells, dendritic cells and macrophages.21, 22, 23 Scavenger receptors have been studied extensively as potential regulators of the initiation and progression of atherosclerosis.24 Out of the eight classes of Scavenger receptors, CD36 is an 88 000 MW protein of class B receptor that is expressed on the surface of the macrophages, endothelial cells and adipocytes. Their role in various inflammatory diseases is well established.25 Recent studies have revealed the role of CD36 in the development of autoimmune colitis, and CD36 deficiency leads to aggressive disease progression.26, 27 Similarly, another Scavenger receptor, CD163, belongs to the Scavenger receptor class I. This 130 000 MW protein clears the haemoglobin by the action of macrophages during haemolysis and act as a PRR for microbial infection. CD163 has been assessed as the anti‐inflammatory marker for macrophage function, and also produces pro‐inflammatory molecules like IL‐10.28, 29 It has been reported that Scavenger receptors are also expressed on the γδ T‐cell surface and they modulate the immune response by responding to the TCR signal strength.23, 30 The exact role of these receptors along with the functional role of γδ T cells in the pathogenesis of PV is yet to be explored. This maiden study aims to uncover the significant and versatile role of γδ T cells along with Scavenger receptors in the immunopathogenesis of PV.

Materials and methods

Study subjects

Thirty newly diagnosed cases of active PV confirmed by histopathology (haematoxylin & eosin staining) with or without direct immunofluorescence positivity were enrolled. These study participants were not affected with any other muco‐epithelial disease and were not on any immunosuppressive drug in the previous 3 months. Similarly, the control group included 30 controls without any sign and symptoms of autoimmune blistering skin diseases.

Sample collection

Blood

A total of 10 ml of venous blood was taken from all the participants: 8 ml of peripheral venous blood samples was collected in sterile endotoxin‐free vacutainers with EDTA as an anticoagulant for peripheral blood mononuclear cells (PBMCs) and 2 ml of blood samples was collected in tubes free of endotoxin for serum.

Skin biopsy

Two‐millimetre punch biopsies were collected from the lesion area of the patients and unaffected skin of the controls (lipoma) and the samples were transported in RNAlater solution for the processing and isolation of RNA.

Screening of anti‐Dsg1 and anti‐Dsg3 levels by ELISA

Screening for the presence of Dsg1 and Dsg3 antibodies in the patient sera was carried out in 96‐well ELISA plates using a high sensitivity anti‐Dsg1 anti‐Dsg3 ELISA‐kit (MESA CUP Desmoglein TEST kit; Medical Biologicals Laboratories Co. Ltd, Nagoya, Japan).

Serum cytokine determination by ELISA

Th1 (IFN‐γ) and Th2 (IL‐4) markers were estimated using a high sensitivity ELISA kit (Diaclone, Besançon Cedex, France) with minimum detection limits of 5 pg/ml for IFN‐γ and 0·07 pg/ml for IL‐4, respectively. The samples, which showed higher concentration, were diluted and measured in triplicate. The reaction was terminated by adding sulphuric acid and absorbance was measured at 450 nm. The absorbance measured by an ELISA reader was proportional to the concentration of the respective cytokine present in the sample.

Phenotypic determination of γδ T cells

Peripheral blood mononuclear cells were isolated by the density gradient method using Ficoll from the heparinized peripheral blood. The cells were counted by a haemocytometer and viability was assessed by a 0·4% trypan blue exclusion test. PBMCs were used (1 × 10⁶ cells/ml) for short‐term culture in RPMI‐1640 medium, supplemented with antibiotics and 10% fetal calf serum. These short‐term cultured cells were further subjected to surface phenotyping and intracellular staining.

Surface phenotyping

Phenotypic analysis was performed by flow cytometry (FACScan CantoTM 337175, BD Biosciences, San Jose, CA, USA) The phenotype of the PBMCs was determined by single‐, two‐and three‐colour experiments by using the following monoclonal antibodies: phycoerythrin‐conjugated anti‐CD3, FITC‐conjugated anti‐TCR‐γδ, allophycocyanin‐conjugated anti‐IL‐4, and phycoerythrin‐Cy7‐conjugated anti‐IFN‐γ. All the antibodies were obtained from Biolegend (San Diego, CA).

Analysis of T helper polarization of γδ T cells

Intracellular analysis of cytokine production

Intracellular cytokine staining was carried out to determine the cytokine production in freshly isolated γδ T cells at the single‐cell level. Cells were stimulated and incubated for 2 hr with 25 μg phorbol myristate acetate and 1 μg ionomycin. After stimulation, cells were washed with PBS and then permeabilized with 0·5% saponin (Sigma Chemical Co., St Louis, MO, USA) in PBS for 30 min at room temperature. Anti‐IL‐4 and anti‐IFN‐γ monoclonal antibodies, differentially fluorochrome‐conjugated (Biolegend), were added to the cells and allowed to bind for 30 min. Control samples were incubated with irrelevant, isotype‐matched antibodies in parallel with the experimental samples. All samples were analysed using a FACS canto flow cytometer.

Isolation of γδ T cells by MACS

Peripheral blood mononuclear cells were isolated by the Histopaque‐1077 density gradient method from the heparinized peripheral blood. These PBMCs were subjected to magnetic assisted cell sorting using specific antibodies for γδ T cells (Miltenyi Biotec, Bergisch Gladbach, Germany).

Cytotoxicity assay

To determine specific cytotoxicity, we used the CytoTox 96^® Non‐Radioactive Cytotoxicity Assay (Promega, Madison, WI, USA) based on the colorimetric detection of the released enzyme lactate dehydrogenase (LDH). Target γδ T cells were harvested, washed, counted and diluted to 1 × 10⁵ cells/ml and 100 μl/well were plated in a 96‐round bottom plate. γδ T cells were washed, counted, diluted and added at an effector : target T‐cell ratio of 2·5 : 1, 5 : 1, 10 : 1, 20 : 1. All of the conditions were assayed in triplicate. After 4 hr at 37°, 50 μl of supernatants was assayed for LDH activity following the manufacturer's protocol. Controls for spontaneous LDH release in effector and target T cells, as well as target maximum release, were prepared. The calculation of cytotoxicity percentage was as follows: % cytotoxicity = [(experimental – effector spontaneous – target spontaneous)/ (target maximum – target spontaneous)] × 100.

Quantitative mRNA expression of CD36 and CD163 (Scavenger receptor) by quantitative PCR

The DNase‐treated RNA so obtained from the blood and tissue was used to synthesize cDNA using MuLV Reverse Transcriptase (Fermentas, Waltham, MA, USA), this was further used as a template to analyse the amplification using primers specific to the different molecules. The expression of CD36 and CD163 molecules as Scavenger receptor were estimated by quantitative PCR in patients and controls. The relative mRNA expression was measured by quantitative PCR using SYBR green chemistry and it was calculated by the 2^−ΔCt method. The following primer sets were used.

CD36 forward primer: 5′‐GCAAAGAAGGGAGACCTGTG‐3′

reverse primer: 5′‐GGCTTGACCAATAGGTTGAC‐3′

CD163 forward primer: 5′‐CCAGCAGCTTAAATGTGGAG‐3′

reverse primer: 5′‐AGGACAGTGTTTGGGACTG‐3′

Statistical analysis

Data were expressed as median (range) and mean ± SD for circulatory levels, phenotypic determination and frequency analysis along with quantitative PCR data profiling. Comparisons between patient and control groups were made using the Wilcoxon rank‐sum (Mann–Whitney) U‐test for non‐parametric data. The Spearman correlation coefficient was calculated for anti‐Dsg level and frequency of γδ T cells in the corresponding patients and controls. Statistical significance was defined at a P‐value < 0·05. Flow cytometry data were analysed using FACS diva software (BD Biosciences, San Jose, CA, USA). All data analyses were done with graphpad prism 6 (La Jolla, CA, USA) and SPSS 19·0 (IBM, NY, USA).

Results

Anti‐Dsg1 and anti‐Dsg3 by ELISA

In all, 40 untreated PV patients were recruited, and their means ± SD of anti‐Dsg1 and anti‐Dsg3 were 45·89 ± 15·53 U/ml and 108·93 ± 17·2 U/ml, respectively, as shown in Table 1. Patients with mucocutaneous lesions (n = 30) were further included in this study. The Spearman correlation coefficients were calculated for anti‐Dsg level and frequency of γδ T cells in corresponding patients and are shown in Table 2. Anti‐Dsg3 level with γδ T cells demonstrated significantly higher correlation (r = 0·951; P < 0·0001) compared with anti‐Dsg1 level (r = 0·337; P < 0·06).

Table 1.

Levels of anti‐Desmoglein 1 (Dsg1) and anti‐Dsg3 by ELISA

(Total patients n = 30)	Mean ± SD
Anti‐Dsg1 (U/ml)	45·89 ± 15·53
Anti‐Dsg3 (U/ml)	108·93 ± 17·2

Table 2.

Correlation analysis of anti‐Desmoglein 1 (Dsg1), anti‐Dsg3 level with γδ T cells

	Anti‐Dsg1	Anti‐Dsg3	γδ T cells
Anti‐Dsg1	r	0·294	0·337
	P‐value	0·115	0·069
Anti‐Dsg3			0·951
			0·0001

Spearman correlation coefficient was calculated for anti‐Dsg level and frequency of γδ T cells in corresponding patients. Anti‐Dsg3 level with γδ T cells demonstrated significantly higher correlation (r = 0·951; P < 0·0001) compared with anti‐Dsg1 level (r = 0·337; P < 0·06).

Th1 and Th2 cytokines profiles by ELISA

The levels of IFN‐γ as Th1 marker and IL‐4 as Th2 marker were measured using a highly specific ELISA kit. The median value of the Th1 cytokine IFN‐γ in patients was increased significantly (P < 0·001), compared with controls, as shown in Fig. 1. In contrast with the increased level of Th1‐type cytokines, the median value of the Th2 cytokine IL‐4 in patients also showed a significant increase (P < 0·0001) compared with controls.

Figure 1.

Circulatory level of interferon‐γ (IFN‐γ) and interleukin‐4 (IL‐4). Serum levels of IFN‐γ and IL‐4 were determined by ELISA. The box plot depicts the minimum and maximum values (whiskers) and the upper and lower quartiles (top and bottom edges of the box). The median is identified by a line inside the box. The length of the box represents the interquartile range. P values were calculated with Mann–Whitney U‐test. **P < 0·001; ***P < 0·0001. [Colour figure can be viewed at wileyonlinelibrary.com]

FACS results

FACS analysis showed high population and frequency of γδ T cells in patients with PV compared with healthy individuals (6·7% versus 4·4%), as shown in Fig. 2 and Table 3. Out of the total γδ T‐cell population, IFN‐γ‐expressing γδ T cells were elevated in patients with PV (35·1% versus 26·4%) and IL‐4‐secreting γδ T cells were lowered (20·5% versus 30·5%), as shown in Figs 2 and 3. Dual‐cytokine‐secreting γδ T cells (IFN‐γ and IL‐4) were found in higher numbers in the circulation of patients with PV (23·4% versus 20·5%). The overall frequency of γδ T cells in patients and controls are summarized in Table 3.

Figure 2.

Representative FACS results of γδ T cells in Control (I) and Patients (II). Peripheral blood mononuclear cells (PBMCs) were isolated and the lymphocyte population was gated, CD3 and γδ T‐cell receptor (TCR) ‐positive cells (P2) were further used for the analysis. (a) To determine the phenotype and frequency of γδ T cells in the circulation, specific antibodies were used. I and II representing control and pemphigus vulgaris (PV) patient's γδ T‐cell frequency (a1), γδ T cells secreting both interferon‐γ (IFN‐γ) and interleukin‐4 (IL‐4) (b), γδ T cells producing only IFN‐γ (c) γδ T cells producing only IL‐4 (d). [Colour figure can be viewed at wileyonlinelibrary.com]

Table 3.

Frequency of γδ T cells in the circulation of controls and patients with pemphigus vulgaris

S.No. (population)	Control (n = 30)	PV patients (n = 30)
γδ T cells%	(Mean ± SD)
I (CD3 and γδ T cells)	4·4 ± 1·2	6·7 ± 1·8
II. (γδ T cells and IFN‐γ)	26·4 ± 0·95	35·1 ± 0·83
III. (γδ T cells and IL‐4)	30·5 ± 2·2	20·5 ± 1·7
IV. (γδ T cells and IFN‐γ and IL‐4)	20·5 ± 1·8	23·4 ± 1·6

IFN‐γ, interferon‐γ; IL‐4, interleukin‐4; PV, pemphigus vulgaris.

Figure 3.

Frequency of γδ T cells in the circulation of pemphigus vulgaris (PV) patients and controls. Representative picture showing the frequency of γδ T cells with a T helper type 1 polarizing pattern in patients and controls. The frequency of γδ T cells (mean ± SD = 6·7 ± 1·8% versus 4·4 ± 1·2%) and total interferon‐γ (IFN‐γ) ‐producing γδ T cells (mean ± SD = 35·1 ± 0·83% versus 26·4 ± 0·95%) have a higher percentage in the patient's circulation compare with the controls. Statistically, the data were analysed and the standard bar represents the mean ± SD. ***P < 0·0001. [Colour figure can be viewed at wileyonlinelibrary.com]

Cytotoxicity assay

The γδ T cell as an effector cell was co‐cultured with the K562 cell line as the target. γδ T cells were harvested, washed, counted and diluted to 1 × 10⁵ cells/ml, and 100 μl/well was plated in a 96‐round‐well plate at effector : target T‐cell ratios of 20 : 1, 10 : 1, 5 : 1, 2·5 : 1. All the γδ T‐cell preparations from patients showed cytotoxic effects on the cell line with specific lysis at 30 ± 6% (20 : 1 and 10 : 1 effector to target ratio), 16·5 ± 2% (5 : 1 effector to target ratio), 6 ± 2% (2·5 : 1 effector to target ratio) and 3·2 ± 1·8% (1 : 1 effector to target ratio), respectively. Whereas the cytotoxicities in healthy controls were 24 ± 3% (20 : 1 and 10 : 1 effector to target ratio), 10 ± 2·4% (5 : 1 effector to target ratio), 4·75 ± 2·5% (2·5 : 1 effector to target ratio) and 4·1 ± 1·2% (1 : 1 effector to target ratio), which were lower compared with the patients (Fig. 4). Each experiment was performed in triplicate and P‐values were calculated with Mann–Whitney U‐test.

Figure 4.

Cytotoxicity assay. γδ T cells isolated from patients (n = 10) and controls (n = 10) were assessed for cytotoxic activity. γδ T cells as effector cells were co‐cultured with the K562 cell line as the target with effector to target ratios of 20 : 1, 10 : 1, 5 : 1, 2·5 : 1 and 1 : 1. γδ T cells from patients showed cytotoxic effects on cell line with specific lysis at 30 ± 6% (20 : 1 and 10 : 1 effector to target ratio), 16·5 ± 2% (5 : 1 effector to target ratio), 6 ± 2% (2·5 : 1 effector to target ratio) and 3·2 ± 1·8% (1 : 1 effector to target ratio), respectively. In controls, cytotoxicity was found to be lower at 24% ± 3% (20 : 1 and 10 : 1 effector to target ratio), 10 ± 2·4% (5 : 1 effector to target ratio), 4·75 ± 2·5% (2·5 : 1 effector to target ratio) and 4·1 ± 1·2% (1 : 1 effector to target ratio), respectively. Each experiment was performed in triplicate and P‐values were calculated with Mann–Whitney U‐test; ***P < 0·0001; **P ≤ 0·001; *P ≤ 0·05. [Colour figure can be viewed at wileyonlinelibrary.com]

Relative mRNA expression of CD36 and CD163 (Scavenger receptor) by quantitative PCR

The relative mRNA expression levels of CD36 and CD163 were found to be higher in patients compared with the controls. The expression profile of CD36 and CD163 was performed in the isolated γδ T cells from blood and tissue. The mRNA expression profiles of both these Scavenger receptors were found to be elevated in the patient samples compared with the healthy controls, as shown in Fig. 5(a,b).

Figure 5.

Relative mRNA expression of Scavenger receptors. Relative mRNA expression (2^−ΔCt) of the Scavenger receptors CD36 (a) and CD163 (b) from isolated γδ T cells from peripheral blood mononuclear cells and in tissues of patients (n = 30) and controls (n = 30). The standard bar represents the mean ± SD. P‐values were calculated with Mann–Whitney U‐test. *P < 0·05; **P < 0·001; ^ns, non‐significant. [Colour figure can be viewed at wileyonlinelibrary.com]

Discussion

Autoimmune diseases are caused by multiple contributing factors, including genetic, environmental and infectious, which add to the complexity of these disorders. Pemphigus vulgaris is a life‐threatening autoimmune skin‐blistering disease, primarily caused by disruption of desmosomes by autoreactive antibodies. The immunological basis of this intricate autoimmune skin disease is poorly understood compared with other skin diseases like psoriasis and vitiligo. Like any other autoimmune disease, autoreactive T cells play a vital role in the progression of this disease. Several studies have identified and characterized autoreactive T cells in PV that recognized Dsg3 epitopes and also stimulate the secretion of both Th1 cytokines such as IFN‐γ and Th2 cytokines such as IL‐4 and IL‐10. Although Th2 cells may be critical for the development of PV, the simultaneous presence of both Th1‐related and Th2‐related immune responses is best to maintain the high titres of autoantibodies in this disease.31, 32, 33, 34 In our previous study, we reported that decreased Treg cells and increased Th17 cells along with the defective Treg‐cell‐associated chemokine receptor and ligand (CCR4‐CCL‐22) are contributing significantly to the immunopathogenesis of PV.20

The γδ T cell is the component of innate immune cells that expresses TCR‐γδ and constitutes about 1–10% of total T‐cells in circulation. These cells are unique innate immune cells that are involved in the immune surveillance at mucosal and epithelial surfaces. Aberrant function of γδ T cells has been reported in several autoimmune diseases, and inflammatory and granulomatous conditions of the skin.14, 15, 16, 35, 36, 37, 38 In the present study, the serum level of IFN‐γ was found to be higher in patients with PV, which are in concordance with earlier reports in psoriasis. In PV patients we found that the serum level of IL‐4 was elevated and this might be due to the secretion of IL‐4 by other immune cells in circulation. We observed increased frequency of circulating γδ T cells in patients with PV compared with the controls (6·7% versus 4·4%) by flow cytometry, indicating their possible involvement in the immunopathogenesis of this blistering skin disease. When we compared anti‐Dsg1 and anti‐Dsg3 titres along with the frequency of γδ T cells in patients and controls we found that the anti‐Dsg3 level with γδ T cells demonstrated significantly higher positive correlation (r = 0·951; P < 0·0001) compared with anti‐Dsg1 level (r = 0·337; P < 0·06). Our findings in flow cytometry also illustrate the increased frequency of IFN‐γ‐producing γδ T cells in the circulation of patients compared with controls (35·1% versus 26·4%), whereas the IL‐4‐producing γδ T‐cell fraction was reduced in patients (20·5% versus 30·5%). Elevated serum levels of IFN‐γ and increased frequency of IFN‐γ‐producing γδ T cells in PV are suggestive of a predominant Th1 type of immune response in PV, which is in concordance with the findings reported in psoriasis. The Th1‐type immune response generated by the γδ T cells in PV could be one of the key propagating factors by which these inflammatory γδ T cells might be migrating to the skin from the circulation under the influence of various receptors and other innate immune components.

In our study, we found a distinct population of dual cytokine (IFN‐γ and IL‐4) secreting γδ T cells in the circulation of patients with PV with higher frequency than control (23·4% versus 20·5%). T cells play a crucial role in the generation and maintenance of immune responses by secreting cytokines. The type of cytokine secreted by T cells provides a fundamental insight into how these cells dynamically alter the intercellular signals to affect immune responses generated toward pathological conditions or clinical interventions. Multiple‐cytokine‐producing CD4 T cells have been studied in infectious viral diseases and found to be functionally superior to single‐cytokine‐producing cells.39, 40 This result is suggestive of some unknown mechanisms that might be maintaining these versatile populations of γδ T cells in this disease. γδ T cells primarily control the infection and any neoplastic transformation by IFN‐γ‐mediated cytotoxicity. The Th1 polarization of γδ T cells in the immunopathogenesis of autoimmune diseases is due to their ability to produce the IFN‐γ that causes cytotoxicity.41, 42 Similarly, the cytotoxicity assays in our study have shown the higher cytotoxic potential of γδ T cells of patients with PV that are efficient producers of IFN‐γ compared with the controls.

Scavenger receptors are a group of PRRs known to play a crucial role in the host immune response. CD36 is a class B and CD163 is a class I receptor, already being implicated in several inflammatory diseases including autoimmune diseases.24, 25, 27 In our study, we have observed the increased relative mRNA expression of these PRRs in the circulation and tissues of patients with PV. The relative mRNA expression profile of CD36 was elevated significantly both in isolated γδ T cells from blood and in the tissue of patients, whereas a significant increase in CD163 was observed only in the tissue. Scavenger receptor CD163 is highly expressed on resident tissue macrophages and to a lesser extent on monocytes. In our study, we have observed the expression profile of CD163 from isolated γδ T cells in circulation. The levels of CD163 was higher in patients with PV but it was not statistically significant. This might be due to limited frequency of γδ T cells in circulation compared with in situ expression in tissue during pathogenesis of PV and also lower expression of CD163. These findings are suggestive of the possible contribution of these receptors in the immunopathogenesis of PV.

In conclusion, this is the first study suggesting the likely involvement of γδ T cells along with the Scavenger receptors in the pathogenesis of PV. The increased number of circulating γδ T cells that produce IFN‐γ shows Th1‐type polarization is predominant in this autoimmune skin disease. Higher expression of Scavenger receptor could be contributing to the inflammatory environment and immune imbalance in this disease. These observations could be exploited as an indicator for the breach in the immune surveillance capability of γδ T cells. These findings will help to enhance our understanding of the immunopathogenesis of PV and may unlock targets for novel drugs, aiming these γδ T cells and Scavenger receptors in future.

Disclosure

None.